Letters in Applied Microbiology 2004, 39, 137–143
doi:10.1111/j.1472-765X.2004.01551.x
High-level gene expression in Lactobacillus plantarum using a pheromone-regulated bacteriocin promoter G. Mathiesen1, E. Sørvig1,2, J. Blatny1, K. Naterstad2, L. Axelsson2 and V.G.H. Eijsink1 Department of Chemistry, Biotechnology and Food Science, Agricultural University of Norway, A˚s, Norway, and 2Norwegian Food Research Institute, Matforsk AS, Osloveien 1, Norway
1
2004/0108: received 2 February 2004, revised 1 April 2004 and accepted 5 April 2004
ABSTRACT G . M A T H I E S E N , E . S Ø R V I G , J . B L A T N Y , K . N A T E R S T A D , L . A X E L S S O N A N D V . G . H . E I J S I N K . 2004.
1 Aims: To use promoters and regulatory genes involved in the production of the bacteriocin sakacin P to obtain high-level regulated gene expression in Lactobacillus plantarum. Methods and Results: In a plasmid containing all three operons naturally involved in sakacin P production, the genes encoding sakacin P and its immunity protein were replaced by the aminopeptidase N gene from Lactococcus lactis (pepN) or the b-glucuronidase gene from Escherichia coli (gusA). The new genes were precisely fused to the start codon of the sakacin P gene and the stop codon of the immunity gene. This set-up permitted regulated (external pheromone controlled) overexpression of both reporter genes in L. plantarum NC8. For PepN, production levels amounted to as much as 40% of total cellular protein. Conclusions: Promoters and regulatory genes involved in production of sakacin P are suitable for establishing inducible high-level gene expression in L. plantarum. Significance and Impact of the Study: This study describes a system for controllable gene expression in lactobacilli, giving some of the highest expression levels reported so far in this genus. Keywords: b-glucuronidase, aminopeptidase N, Lactobacillus plantarum, regulation, sakacin P.
INTRODUCTION Lactic acid bacteria (LAB) are important micro-organisms, because of their many roles in the fermentation and preservation of food and because of their presence in the human intestine (Axelsson 1998; Ross et al. 2002). As many LAB have the generally regarded as safe (GRAS) status and some LAB show probiotic effects on animal and human health (Mercenier et al. 2003), they are important organisms for biotechnological applications. LAB have potential as food-grade cell factories and as delivery vehicles for antigens, antibodies and growth factors. Many LAB produce anti-microbial peptides called bacteriocins, whose production is often regulated via a quorumCorrespondence to: Vincent G.H. Eijsink, Department of Chemistry, Biotechnology and Food Science, Agricultural University of Norway, Chr. M. Falsensvei 1, PO Box 5003, N-1432 A˚s, Norway (e-mail:
[email protected]).
Present address: Janet Blatny, Norwegian Defence Research Establishment, PO Box 25, N-2027 Kjeller, Norway. ª 2004 The Society for Applied Microbiology
sensing system (Kleerebezem et al. 1999; Nes and Eijsink 1999; Eijsink et al. 2002; Quadri 2002). In the case of class I bacteriocins (lantibiotics such as nisin), the bacteriocin itself acts as pheromone, which activates a two-component regulatory system consisting of a histidine kinase receptor and a cognate response regulator. For class II bacteriocins, there is one known case of a bacteriocin that induces its own production (Kleerebezem and Quadri 2001). However, in most cases strains producing class II bacteriocins secrete a separate pheromone peptide with no or little bacteriocin activity, whose gene is co-transcribed with the genes encoding the cognate two-component regulatory system (see Fig. 1). In both systems, the phosphorylated response regulator acts as a transcription activator, enhancing transcription of all operons involved in bacteriocin production. The genes and promoters involved in nisin production have been used to develop a nisin-controlled expression (NICE) system for efficient, regulated overproduction of
138 G . M A T H I E S E N ET AL.
∆ 1 kb
Fig. 1 Schematic overview of inserts in some of the plasmids used in this study. pMLS114 contains the natural ssp gene cluster and contains all genes necessary for production of sakacin P, encoded by sppA (Hu¨hne et al. 1996). The genes are transcribed from characteristic promoters (indicated by the thin arrows), which are all activated by the phosphorylated form of the response regulator encoded by the sppR gene (Brurberg et al. 1997; Risøen et al. 2000). Other gene products: sppIP, peptide pheromone; sppK, histidine kinase; spiA, immunity protein; sppT and sppE, transport system. PorfX precedes another putative bacteriocin gene (Brurberg et al. 1997). In pGM1, sppA and spiA have been replaced with pepN. pGM4 is a derivative of pGM1 carrying a deletion (n) in sppIP
heterologous proteins in lactococci (de Ruyter et al. 1996), lactobacilli (Pavan et al. 2000), and other Gram-positive bacteria (Eichenbaum et al. 1998). Similar systems may be developed on the basis of genes and promoters involved in the production of class II bacteriocins. For example, Axelsson et al. (1998) have established a two-plasmid system for overproduction of heterologous bacteriocins in Lactobacillus sakei, based on genes and promoters involved in the production of sakacin A. Studies with the aminopeptidase N reporter gene (pepN from Lactococcus lactis) have shown that this system is not suitable for high-level protein production in Lactobacillus plantarum (G. Mathiesen, V.G.H. Eijsink and L. Axelsson, unpublished observations). Recently, regulated bacteriocin promoters have been used to construct one-plasmid inducible expression systems (Axelsson et al. 2003; Sørvig et al. 2003). These new systems showed promising results with the gusA reporter gene, but in all cases, expression levels in L. plantarum were ca 10 times lower than the levels obtained with the NICE system (Pavan et al. 2000; Sørvig et al. 2003). Our previous studies on overproduction of sakacin P in lactobacilli (Hu¨hne et al. 1996; I.M. Aasen and L. Axelsson, unpublished observations) showed that the highest production levels were obtained in strains harbouring all operons naturally involved in sakacin P production, in their natural organization (plasmid pMLS114; Fig. 1). Therefore, pMLS114 was used as a starting point for establishing regulated expression of aminopeptidase N from Lactococcus lactis (pepN) and b-glucuronidase from Escherichia coli (gusA) in L. plantarum. The resulting gene expression system allowed controlled gene expression in lactobacilli, at levels that are among the highest ever described for lactic acid bacteria.
MATERIALS AND METHODS Bacterial strains, plasmids and standard genetic techniques Table 1 gives an overview of the bacterial strains and plasmids used in this study. Escherichia coli cells were grown in shaking flasks at 37C in brain–heart infusion (BHI) medium (Oxoid Ltd, Basingstoke, UK). Lactobacillus plantarum NC8 was grown in MRS medium (Oxoid Ltd) at 30C without shaking, unless stated otherwise. For plates, media were solidified by adding 1Æ5% (w/v) agar. Antibiotic concentrations were: ampicillin – 150 lg ml)1 (E. coli); kanamycin – 50 lg ml)1 (E. coli); erythromycin – 200 lg ml)1 (E. coli) and 5 lg ml)1 (lactobacilli). All cloning steps were conducted according to standard procedures as described in Sambrook et al. (1989). PCR reactions were performed in a PTC-100 Programmable Thermal Controller (MJ Research, Inc., Waltham, MA, USA) with Pfu DNA polymerase (Promega Corp., Madison, WI, USA), as recommended by the polymerase supplier. Oligonucleotides were purchased from Medprobe (Oslo, Norway). PCR fragments were subcloned using the TOPO system provided by Invitrogen (Carlsbad, CA, USA). All PCR-derived DNA fragments were sequenced using the BigDye Terminator Cycle Sequencing Kit, according to the manufacturer’s recommendations, and the ABI Prism 377 DNA sequencer (Perkin Elmer/Applied Biosystems, Foster City, CA, USA). Chemically competent E. coli JM109 (Promega Corp.), or DH5a (Invitrogen) were transformed applying the protocol provided by the supplier. Lactobacilli were transformed according to the protocol of Aukrust et al. (1995). Plasmid DNA from E. coli and lactobacilli was isolated using the QIAprep Miniprep Kit (Qiagen, Venlo, The
ª 2004 The Society for Applied Microbiology, Letters in Applied Microbiology, 39, 137–143, doi:10.1111/j.1472-765X.2004.01551.x
GENE EXPRESSION IN LACTOBACILLUS
139
Table 1 Strains and plasmids used in this study
Strains E. coli DH5a E. coli JM109 E. coli TOP10 L. plantarum NC8 Plasmid pCR2Æ1-TOPO pCR Blunt-TOPO pMLS114 pKRV3a-gus pSTO10 pGM1 pGM4 pGM4-GUS
Relevant characteristics/purpose
Source or reference
Host Host Host Host
Invitrogen Promega Invitrogen Aukrust and Blom (1992)
strain strain strain strain
for plasmids for plasmids for ‘TOPO-cloning’ of PCR fragments (silage isolate) for pMLS114 derivatives
Vector for cloning of PCR fragments, Ampr Vector for cloning of PCR fragments, Kanr Derivative of pLPV111 containing all spp genes necessary for production of the class II bacteriocin sakacin P (see Fig. 1), Emr Source of gusA gene Source of pepN gene pMLS114 derivative; pepN replaces sppA and spiA, Emr (Fig. 1) pMLS114 derivative; pepN replaces sppA and spiA; deletion in sppIP, Emr (Fig. 1) pMLS114 derivative; gusA replaces sppA and spiA; deletion in sppIP, Emr
Netherlands). Lactobacillus cells were incubated for 25 min 2 at 37C with 5 mg ml)1 lysozyme, 15 U ml)1 mutanolysin and 100 lg ml)1 RNase (all Sigma, St Louis, MO, USA) before adding the lysis buffer from the QIAprep kit. Extraction and purification of DNA from agarose gels was performed using the QIAquick Gel Extraction Kit (Qiagen). Plasmid construction All derivatives of plasmid pMLS114 (Fig. 1; Hu¨hne et al. 1996), were based on a precise exchange of the two genes in the bacteriocin operon (sppA + spiA; Fig. 1) by either pepN (Strøman 1992) or gusA (Schlaman et al. 1994). Thus, the new gene was inserted by making both a translational fusion with the ATG start codon of sppA and a stop codon fusion
Invitrogen Invitrogen Hu¨hne et al. (1996) Axelsson et al. (2003) Chr Hansen A/S, Denmark, Strøman (1992) This work This work This work
with spiA. The constructs were made using recombinant PCR (Higuchi 1990) and standard subcloning steps. The primers used at the fusion points are shown in Table 2. In plasmid pGM1 (Fig. 1), the bacteriocin operon is replaced with pepN; plasmid pMLS114 was used as template for PsppA and the region downstream of the stop codon of spiA, whereas plasmid pSTO10 (Table 1) was used as a template for the pepN gene. To make pepN expression dependent on externally added peptide, a deletion was introduced in the sppIP gene in pGM1, yielding pGM4 (Table 1; Fig. 1). The primers used at the deletion point are shown in Table 2. pGM4-GUS is analogous to pGM4, containing the gusA instead of the pepN gene. The primers used at the fusion points are shown in Table 2. The template for the gusA gene was pKRV3a-gus (Table 1). All constructs were transformed to L. plantarum NC8.
Table 2 Primers used at fusion and deletion points Primers*
Sequence
Application
PepN2R PepN3F PepN6R PepN7F GusA2R GusA4F GusA6R GusA7F IPdel2R IPdel3F
CGTTTTACAGCCATTAGAATCATACTCCTATATATTATTTTAT GAGTATGATTCTAATGGCTGTAAAACGTTTAATT TAAGCTGCTACAATTTTTCAGCAATATCAG GAAAAATTGTAGCAGCTTAATTCTGTAGCAC GGACGTACCATTAGAATCATACTCCTATATATTATT GAGTATGATTCTAATGGTACGTCCTGTAGAAAC GAATTAAGCTGTCATTGTTTGCCTC GGCAAACAATGACAGCTTAATTCTGT CACCAACAACCGAAAGTTTTTTAAATATCATCATACTTTCTCC GATATTTAAAAAACTTTCGGTTGTTGGTGAGCATGTTATATAC
Fusion of PsppA–pepN Fusion of PsppA–pepN Stop codon fusion pepN–spiA Stop codon fusion pepN–spiA Fusion of PsppA–gusA Fusion of PsppA–gusA Stop codon fusion gusA–spiA Stop codon fusion gusA–spiA Deletion of sppIP Deletion of sppIP
*F, forward direction; R, reverse direction. Start codons and stop codons are underlined; nucleotides adjacent to the deletion in the sppIP gene are printed in bold face. ª 2004 The Society for Applied Microbiology, Letters in Applied Microbiology, 39, 137–143, doi:10.1111/j.1472-765X.2004.01551.x
140 G . M A T H I E S E N ET AL.
1
2
3
4
5
kDa 200
116 97 66
pheromone (IP-673) to a final concentration of 50 ng ml)1. b-Glucuronidase activities were determined using a modified b-galactosidase assay (Miller 1972) as described by Axelsson et al. (2003). GUS activities were calculated as described by Miller (Miller 1972) and expressed as Miller Unit equivalents (MU). The induction protocol used for GUS production differed slightly from the induction protocol used for PepN production; when applied to PepN production, the GUS protocol yielded similar results (Fig. 2, Table 3; G. Mathiesen, unpublished observations).
45
RESULTS
Fig. 2 SDS-PAGE analysis of cell-free extracts from various Lactobacillus plantarum NC8 transformants. Lane 1, pMLS114; lane 2, pGM1; lane 3, pGM4 (induced); lane 4, pGM4 (noninduced); lane 5, molecular mass markers. Induction of cultures of L. plantarum NC8 (pGM4) (lane 3) was achieved by addition of pheromone (IP-673) to a final concentration of 25 ng ml)1. Addition of similar amounts of pheromone to cultures of L. plantarum harbouring pMLS114 or pGM1 had no visible effect on the outcome of the experiment. The arrows indicate PepN bands
Gene expression studies Over night cultures of L. plantarum NC8 harbouring pepNcontaining plasmids were diluted 100-fold (to O.D.600 ca 0Æ1) in MRS with appropriate antibiotics. If induction was desirable, 25 ng ml)1 pheromone peptide (IP-673) (Molecular Biology Unit, University of Newcastle-upon-Tyne, UK) was added to the medium and the cultures were grown to an O.D.600 of 2Æ3–2Æ5. In dose–response experiments the pheromone concentration was varied from 0 to 100 ng ml)1. Cells were harvested by centrifugation and disrupted by glass beads (106 lm and finer, G-4649; Sigma) essentially as described by van de Guchte et al. (1991). The resulting protein extract was used to assay aminopeptidase activity using L-lysine p-nitroanilide (Sigma) as substrate (Exterkate 1984). The protocol for determining PepN activity (Exterkate 1984) was modified in the sense that reactions were conducted at 30C (instead of 37C) and in 0Æ1 M Tris–HCl, pH 8Æ5 (instead of a 0Æ1 M sodium phosphate buffer). PepN activities were measured three times, using three independent cultures. Protein concentrations were determined using 3 the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA, USA) with bovine serum albumin as a standard. The crude protein extracts were analysed on 12% SDS polyacrylamide gels and the amounts of PepN were quantified as a percentage of the total intracellular protein content by scanning the gels with a densitometer (Gel Doc 1000; Bio-Rad). Lactobacillus plantarum NC8 cells harbouring pGM4-gus were induced at an O.D.600 of ca 0Æ3 by addition of
In pMLS114-derived pGM1 (Fig. 1), the pheromone autoinduction loop is intact, meaning that PepN production does not require externally added pheromone. pGM4 (Fig. 1) is a pGM1 variant with a deletion in the pheromone gene (sppIP), meaning that cells harbouring pGM4 need externally added pheromone for activation of pepN expression. Table 3 shows that the highest PepN levels were reached in induced cultures of L. plantarum NC8 (pGM4). SDS-PAGE analysis of cell-free extracts from L. plantarum NC8 harbouring pGM1 or pGM4 (Fig. 2) shows the expected PepN band at ca 95 kDa. Scanning of SDSPAGE gels containing cell-free extracts of induced L. plantarum NC8 (pGM4) harvested at an O.D.600 of 2Æ3–2Æ5 showed that PepN levels amounted to more than 40% of the total intracellular protein content. Noninduced cells of L. plantarum NC8 (pGM4) produced 25-fold less PepN than induced cells (Fig. 2, Table 3). Figure 3 shows a clear dose–response relationship between the amount of PepN produced by L. plantarum NC8 (pGM4) and the amount of peptide pheromone added to the culture. PepN activity increased almost linearly with pheromone concentration in the 0Æ5–15 ng ml)1 range, and maximum PepN production was achieved at 25 ng ml)1. Maximum PepN levels were obtained in cultures grown at 30C, whereas Table 3 PepN activity in recombinant Lactobacillus plantarum NC8 strains Specific activity* Plasmid
Increase upon No pheromone Pheromone (25 ng ml)1) induction
pMLS114
