Hepatic HNF4␣ Deficiency Induces Periportal Expression of Glutamine Synthetase and Other Pericentral Enzymes Vesna S. Stanulovic´ ,1 Irene Kyrmizi,3 Marianna Kruithof-de Julio,1 Maarten Hoogenkamp,1 Jacqueline L. M. Vermeulen,1 Jan M. Ruijter,2 Iannis Talianidis,3 Theodorus B. M. Hakvoort,1 and Wouter H. Lamers1 In liver, most genes are expressed with a porto-central gradient. The transcription factor hepatic nuclear-factor4␣ (HNF4␣) is associated with 12% of the genes in adult liver, but its involvement in zonation of gene expression has not been investigated. A putative HNF4␣-response element in the upstream enhancer of glutamine synthetase (GS), an exclusively pericentral enzyme, was protected against DNase-I and interacted with a protein that is recognized by HNF4␣-specific antiserum. Chromatin-immunoprecipitation assays of HNF4␣-deficient (H4LivKO) and control (H4Flox) livers with HNF4␣ antiserum precipitated the GS upstream enhancer DNA only from H4Flox liver. Identical results were obtained with a histone-deacetylase1 (HDAC1) antibody, but antibodies against HDAC3, SMRT and SHP did not precipitate the GS upstream enhancer. In H4Flox liver, GS, ornithine aminotransferase (OAT) and thyroid hormone-receptor 1 (TR1) were exclusively expressed in pericentral hepatocytes. In H4LivKO liver, this pericentral expression remained unaffected, but the genes were additionally expressed in the periportal hepatocytes, albeit at a lower level. The expression of the periportal enzyme phosphoenolpyruvate carboxykinase had declined in HNF4␣-deficient hepatocytes. GS-negative cells, which were present as single, large hepatocytes or as groups of small cells near portal veins, did express HNF4␣. Clusters of very small GS- and HNF4␣-negative, and PCNA- and OV6positive cells near portal veins were contiguous with streaks of brightly HNF4␣-positive, OV6-, PCNA-, and PEPCK-dim cells. Conclusion: Our findings show that HNF4␣ suppresses the expression of pericentral proteins in periportal hepatocytes, possibly via a HDAC1-mediated mechanism. Furthermore, we show that HNF4␣ deficiency induces foci of regenerating hepatocytes. (HEPATOLOGY 2007;45:433-444.)
Abbreviations: CPS, carbamoylphosphate synthetase; GS, glutamine synthetase; HAT, histone acetyltransferase; HDAC, histone deacetylase; HNF4␣ (NR2A1), hepatic nuclear factor 4␣; nt, nucleotide; OAT, ornithine aminotransferase; PCNA, proliferating-cell nuclear antigen; PEPCK, phosphoenolpyruvate carboxykinase; TR, thyroid-hormone receptor 1; SHP, small heterodimer partner; SMRT, silencing mediator of retinoid and thyroid receptors. From the 1AMC Liver Center and 2Department of Anatomy & Embryology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; and 3Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology Hellas, Crete, Greece. Received May 15, 2006; accepted October 4, 2006. Supported by NWO grant 902-23-196 (to W.H.L). Dr. Stanulovic´ is currently affiliated with Department of Medical Physiology, University Medical Center Groningen, Rijksuniversiteit Groningen, Antonius Deusinglaan 1, 7913AV Groningen, The Netherlands. Address reprint requests to: Dr. W. H. Lamers, AMC Liver Center, Academic Medical Center, University of Amsterdam, Meibergdreef 69-71, 1105 BK, Amsterdam, The Netherlands. E-mail:
[email protected]; fax: (31) 20 5669190. Copyright © 2007 by the American Association for the Study of Liver Diseases. Published online in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/hep.21456 Potential conflict of interest: Dr. Lamers received grants from NWO.
T
he development and maintenance of liver architecture and function is regulated by liver-enriched transcription factors.1 One of these, hepatic nuclear factor 4␣ (HNF4␣; NR2A1) is expressed at high levels in liver, kidney, intestine, and pancreas2,3 and binds to the promoter of 12% of genes that are expressed in adult liver.4 HNF4␣ is an orphan member of the nuclear-receptor superfamily.2 Depending on chain length and degree of saturation,5 fatty acyl-coenzyme A thioesters may act as agonistic or antagonistic factors, but whether or not these thioesters function as ligands remains unsettled.2,6-8 Transcriptional regulation by HNF4␣ is accomplished by interactions with coactivator or corepressor mediators (e.g., GRIP1, SRC-1, CBP/p300, SMRT).6,7,9,10 The resulting coactivator or corepressor complexes have intrinsic histone acetyltransferase (HAT) and histone deacetylase (HDAC) activity, respectively. Histone modifications play an important role in the regulation of the 433
434
´ ET AL. STANULOVIC
accessibility of the DNA. They can promote an open chromatin structure, in which the DNA template is accessible for transcription factors, or facilitate chromatin condensation, leading to a transcriptionally nonpermissive state.11 During embryonic development HNF4␣ supports gastrulation by regulating genes that are expressed in the extraembryonic visceral endoderm.3 In liver organogenesis and regeneration, HNF4␣ directs hepatoblasts differentiation to hepatocytes and controls the formation of the liver parenchyma.12-15 The adult mammalian liver is actively involved in amino-acid, carbohydrate and lipid metabolism, xenobiotic detoxification, and the production of bile acids and serum proteins. To maintain homeostasis, the complementary routes of the metabolic functions of the liver (e.g., gluconeogenesis and glycolysis, lipid oxidation and lipogenesis) are heterogeneously expressed.16 Amino-acid metabolism, gluconeogenesis, lipid oxidation, energy metabolism and glycogen synthesis from lactate take place in the upstream, periportal hepatocytes. On the other hand, glycolysis, lipogenesis, cytochrome P450-dependent detoxification and glycogen synthesis from glucose are located in the downstream, pericentral hepatocytes. Ammonia detoxification by the urea cycle is found in a wide periportal zone, whereas its detoxification via glutamine biosynthesis is found exclusively in a narrow pericentral zone of hepatocytes.16 We have extensively investigated the regulation of expression of GS as a paradigm for pericentral gene expression. Previous in vitro experiments have shown that interactions between the upstream enhancer located at ⫺2.5 kb and several intronic regulatory elements determine the degree of activation of the GS promoter.17-19 However, the in vivo mechanism regulating pericentral GS expression has remained unclear. HNF4␣ has been reported to be involved in the regulation of both periportally expressed genes (e.g., the gluconeogenic enzymes PEPCK20and glucose-6-phosphatase,21 and the urea cycle enzyme OTC22), and pericentrally expressed genes (e.g., some cytochrome P-450 genes, including Cyp7␣ and UDP-glucuronyltransferase,23,24 and apolipoprotein E25). In the course of our analysis of the regulation of GS, we noticed the presence of a potential HNF4␣-response element in the GS upstream enhancer. This study explores the regulation of GS expression through this upstream enhancer element and shows that HNF4␣ binds to the GS upstream enhancer. When we extended the study to HNF4␣-deficient livers, we observed that HNF4␣ not only stimulates expression of periportal genes (PEPCK), but also suppresses the expression of GS and several other pericentrally expressed genes in the periportal areas, suggesting that these genes
HEPATOLOGY, February 2007
Fig. 1. Sequence of the GS upstream enhancer element. The F1-R1 probe used for the in vitro footprinting experiments was prepared using the F1 and R1 oligonucleotides. Arrows marked by “HNF4” identify the oligonucleotides used in the electrophoretic mobility shift assay. The consensus binding site for the HNF4 is printed in bold.
share a common regulatory mechanism. In addition, we observed that the HNF4␣-deficient liver contains regenerative foci.
Materials and Methods Animals. The liver-specific HNF4␣ knockout mouse (HNF4␣fl/fl;AlbCre⫺/⫹, designated H4LivKO) and its control (HNF4␣fl/fl;AlbCre⫺/⫺, designated H4Flox) were described previously.13 Albumin-cre mice express cre recombinase in their hepatocytes from neonatal day 10 onward.26 Sequence Analysis. The GS upstream enhancer is a 244bp long element located ⫺2.5kb relative to the transcription-start site.17 This sequence was analyzed for transcription factor-binding sites with MatInspector Professional (release 4.3, Genomatix Software, Genomatix, Munchen, Germany), which is based on the MatInspector program,27 using the vertebrate matrix library and optimized thresholds. Preparation of Protein Extracts. Nuclear extracts from rat livers were prepared as described.28 Briefly, livers were homogenized in 2 M sucrose and nuclei were purified through a 2 M sucrose cushion. Chromatin was precipitated in 0.4 M (NH4)2SO4. Nuclear proteins were precipitated from the resulting supernatant by increasing the (NH4)2SO4 concentration to 2.2 M, followed by dialysis against 40 mM KCl. In Vitro Footprinting. The DNA matrix was produced by PCR, using a [␥32P]dATP-radiolabelled oligonucleotide primer, and purified on a 2% MS8 agarose gel. The F1 and R1 primer set used for footprinting is depicted in Fig. 1. The reaction mixture contained 20 g of rat liver nuclear extract or BSA diluted in 15 l buffer containing 25 mM HEPES pH 7.6, 40 mM KCl, 50 mM (NH4)2SO4, 20% glycerol, 0.1 mM EDTA, 1 mM DTT. After addition of 12.5 l buffer containing 90 mM HEPES pH 7.6, 144 mM KCl, 24 mM MgCl2, 24% glycerol, 0.36 mM EDTA, 3.6 mM DTT and 10 g ds
HEPATOLOGY, Vol. 45, No. 2, 2007
poly(dIdC), the mixture was incubated on ice for 10 minutes, followed by the addition of 2 L probe (20,000 cpm). After incubation on ice for 20 minutes, 0, 0.5, 1.0, 5.0 or 10.0 g of DNase I was added for exactly 2 additional minutes. The reactions were terminated by addition of 50 l 50 mM EDTA pH 8.0, 0.2% SDS, 100 g/ml tRNA, 500 g/ml proteinase K and incubated at 50°C for 30 minutes. Samples were phenol- extracted and ethanol-precipitated. The pellets of the radiolabelled DNA were dissolved in 4 l loading buffer (95% formamide, 10 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol), of which 2 l was separated on a denaturing 6% polyacrylamide gel. Radioactivity was collected on a storage phosphor screen and visualized using a Storm 680 phosphorimager (Molecular Dynamics, Sunnyvale, CA). The results were analyzed with ImageQuant (version 5.0 software). Electrophoretic Mobility Shift Assay. Doublestranded probes were designed on basis of the rat GS upstream enhancer sequence. Probes for the intact and mutated HNF4␣ binding sites were 5⬘-GGGGCTGACCAAGGGGGGCAAAGCTTCTTGTTTA and 5⬘GGGGCTGACCGCGCGCGCGCGCGCGCTTGTTTA, respectively (Fig. 1). Probes were radiolabelled with [␣32P]dATP using the Klenow enzyme and purified on a Sephadex G50. Nuclear extract (5 g) was pre-incubated on ice for 10 minutes in the presence of 20 mM HEPES pH 7.6, 60 mM KCl, 12% glycerol, 1 mM EDTA, 1 mM DTT, 1 mM spermidine, 1 g ds poly(dIdC). After addition of 1 l probe (20,000 cpm), specific complexes were allowed to form on ice for 20 minutes. To perform competition experiments, unlabelled oligonucleotides were added to the reaction mixture in 10, 100 and 1,000fold excess. The supershift analysis employed 1 l of goat anti-human HNF4␣ antibody (Santa Cruz Biotechnology, CA). Unlabelled competitors or antibodies were incubated with the basic reaction mixture for an additional 10 minutes. Samples were loaded onto a native 6% polyacrylamide gel and run at 10 V/cm. The radioactivity on the dried gels was visualized and analyzed as described for in vitro footprinting. Chromatin Immunoprecipitation. In order to crosslink the transcription complexes in their native nuclear environment, the livers of anaesthetized mice were perfused via the portal vein with, successively, PBS, 1% formaldehyde, and 0.125 M glycine for 10 minutes each. Crosslinked nuclei were purified by centrifugation through a sucrose gradient as described.29 Immunoprecipitations and washings were performed as described.30,31 Anti-HDAC1 was purchased from Upstate Biotechnology (Milton Keynes, UK), while anti-SMRT and anti-HDAC3 were from Santa Cruz Biotechnology. The anti–small heterodimer partner
´ ET AL. STANULOVIC
435
(anti-SHP) and anti-HNF4␣ antisera used were described previously.32,33 Antigen specificities were confirmed by immunoprecipitation-Western-blot assays with cross-linked chromatin or native nuclear extracts and by competition experiments. Real-time PCR analysis of GS upstream nhancer was performed using sense 5⬘-GCAAGCCAGTTAAGGAGGGA and antisense 5⬘-CTCCCGTAGCCCTCGA ATAG primers (⫺97 to 77 bp and 194 to 214 bp relative to Fig. 1). Plasmid Construction. Construct 6-bGH contains modules of the GS genomic DNA that were cloned in the pSPluc⫹ plasmid (Promega). The following fragments were placed between the HindIII and NcoI sites of the upstream polylinker: the AflIII-AflIII upstream enhancer of GS (⫺2677bp to ⫺2374bp relative to the GS transcription-start site, Fig. 1); the BglII-NcoI fragment containing the GS minimal promoter, first exon, 5⬘ and 3⬘ parts of the first intron, and the second exon till the beginning of the ORF (Fig. 4A).17,34 The 305bp bovine growth-hormone polyadenylation sequence (the XbaI–PvuII fragment from pcDNA3 (Invitrogen)) was inserted between the XbaI and EcoRV sites in the polylinker downstream of the luciferase ORF.17 Construct 6A-bGH was made by deleting the AflIII-HindIII fragment from the upstream enhancer of the 6-bGH construct. The pHNF4␣ expression plasmid that contained human HNF4␣ cDNA was kindly provided by Tanja Deurholt, AMC Liver Center, University of Amsterdam. DNA Transfection and Luciferase Assay. Plasmids used for transfection were isolated using Nucleobond G-500 columns (Macherey-Nagel). COS-1 cells were grown to 90% confluence in 6-well culture plates. Polyethylenimine (PEI) transfection was performed as described.35 Cells were transfected with 2.9 g of 6-bGH or 6A-bGH, 0.1 g of the Renilla luciferase expression vector pRL-CMV (Promega), 0.1 g of pHNF4␣, and 0.9 g of plasmid pBS (Promega). Culture medium was refreshed 24 hours after transfection. The cells were lysed 48 hours after transfection in “Passive Lysis Buffer” (Promega). Both luciferase activities were measured with the Dual-Luciferase Reporter-Assay System (Promega) and the AutoLumat plus LB953 luminometer (Berthold Technologies). The experiment was performed 3 times in duplicate. Data are presented as average ⫾ SEM. A t test was applied to test HNF4␣-dependent differences between 6-bGH and 6A-bGH construct. P less than 0.05 was considered significant. Immunohistochemistry and in Situ Hybridization. Adult mouse livers were dissected, fixed overnight in 4% formaldehyde, embedded in paraffin and sectioned at 7 m thickness. The sections were deparaffinized, hydrated in graded alcohols, heated for 10 min at 120°C, 1kPa in
436
´ ET AL. STANULOVIC
10 mM Na-citrate (pH 6.0) to retrieve antigens, blocked in Teng-T (10 mM Tris (pH 8.0), 5 mM EDTA, 150 mM NaCl, 0.25% (w/v) gelatin, 0.05% (v/v) Tween-20) and 10% FCS, and incubated overnight with the first antibody. The following antibodies were used: monoclonal anti-rat GS - 1:1,500 (Transduction Laboratories, Lexington, KY), goat anti-human HNF4␣ - 1:250 (Santa Cruz Biotechnology), rabbit anti-PEPCK - 1:500,20 rabbit anti-OAT – 1:2,000,36 rabbit anti-human TR 1:250,37 rabbit anti-Cyp3a4 1:500 (RDI, Concord, MA), monoclonal OV6 1:250,38,39 monoclonal anti--catenin 1:50 (BD Transduction Laboratories, Bradford, MA), monoclonal anti-PCNA (PC10) 1:1,000 (Santa Cruz Biotechnology). Antibody binding was visualized using ALEXA488- or ALEXA568-labeled (Molecular Probes, Breda, The Netherlands) or alkaline phosphatase-labeled antibodies (Sigma-Aldrich, Zwijndrecht, The Netherlands). Alkaline phosphatase was visualized using nitroblue tetrazolium and 5-bromo-4-choloro-3-indolylphosphate (NBT/BCIP 1:50) as substrates (Roche Molecular Biochemicals, Woerden, The Netherlands). For comparisons between H4Flox and H4LivKO sections staining reactions were performed simultaneously and for an equal time period. Fluorescence was analyzed with a BioRad MRC1024 (BioRad, Veenendal, The Netherlands) confocal laser-scanning microscope or a Leica DM RA2 microscope (Rijswijk, The Netherlands). For in situ hybridization, 4 adjacent sections were stained with digoxigenin (DIG)-labelled complementary RNA probes of glutamine synthetase (GS) and PEPCK.40 Probe bound to the section was immunologically detected by antidigoxigenin Fab fragment covalently coupled to alkaline phosphatase. NBT/BCIP was used as chromogenic substrate.41
Results In Vitro Footprinting of the GS Upstream Enhancer. The binding of transcription factors that are present in liver nuclear extracts to the upstream enhancer region of GS was visualized by DNase I footprinting. The sequence tested and primers used for generating the probes are presented in Fig. 1. On both strands, liver nuclear extract decreased DNase I accessibility to specific regions of the DNA template (Fig. 2, nt numbering according to Fig. 1). When the upper strand (F1 primer) was labeled, two footprints and five hypersensitive bands were detected (Fig. 2A). When the lower strand was labeled (R1 primer), binding of the nuclear extract protected four regions and increased sensitivity to DNase I at two positions (Fig. 2B). The protection from position 105 to 130 in the upper strand overlapped with the pro-
HEPATOLOGY, February 2007
Fig. 2. In vitro DNase I footprinting. The end-labeled DNA probe was incubated with bovine serum albumin (BSA) or liver nuclear extract (NE) for 20 minutes, followed by incubation with 10 g DNase I for 2 minutes on ice. Footprints are shown on (A) the upper DNA strand and (B) the lower strand. 10bp: 10bp ladder. Next to each panel, lines and asterisks mark protected and hypersensitive nucleotides, respectively.
tected area from nt 105 to 125 and a hypersensitivity at position 105 on the lower strand. The footprint between nt 150 and 210 on the upper strand corresponded with the protection between nt 150 and 220, and the hypersensitivity at position 150 on the lower strand. Proteins causing the hypersensitivities at positions 50, 70 and 85 on the upper strand left a footprint in the region between nt 50 and 100 on the lower strand. Finally, the hypersensitivities at positions 25 and 35 on the upper strand were accompanied by a protection between nt 20 and 30 on the lower strand. HNF4␣ Binds to the GS Upstream Enhancer. According to the MatInspector Professional database,27 the region containing hypersensitivities at position 25 and 35 on the upper strand and a protection between nt 20 and 30 on the lower strand coincides with a potential HNF4␣-binding site. Electromobility shift assays, employing rat-liver nuclear extract, were performed to test whether HNF4␣ indeed recognizes the proposed binding site (GGGGGCaAAGCTT). Addition of nuclear extract to the HNF4 probe resulted in three discrete shifts (Fig.
HEPATOLOGY, Vol. 45, No. 2, 2007
´ ET AL. STANULOVIC
437
Fig. 3. Electrophoretic mobility shift analysis of HNF4␣ binding to the GS upstream enhancer. Liver nuclear extracts were used to analyze protein binding to the HNF4 (A) or the HNF4mut probe (B). Where indicated, nuclear extract (NE), HNF4␣ antibody (HNF4 Ab) or cold competitor probes (HNF4 or HNF4mut) were added in a 10-fold, 100-fold, or 1000-fold excess. Short arrows point to the shifting and long arrows to the supershifting bands.
3A, compare lanes 1 and 2). When HNF4␣ antibody was added to the reaction mixture, the lowest band disappeared and two new bands with a lower mobility appeared (Fig. 3A, lane 3, bands 4 and 5). Addition of unlabelled intact probe in 10-, 100- and 1000-fold excess (Fig. 3A,
Fig. 4. Effect of HNF4␣ co-transfection on GS promoter/enhancer activity in COS-1 cells. (A) Schematic representation of the 6-bGH and 6A-bGH constructs. (B) Effect of co-expression of HNF4␣ on 6-bGH- and 6A-bGH-reporter gene activity into COS-1 cells. Restriction sites: A ⫽ AflIII; H ⫽ HindIII; Bg ⫽ BglII; B ⫽ BamHI; N ⫽ NcoI. Abbreviations: Luc, luciferase open reading frame; b-GH, bovine growth hormone transcription termination and polyadenylation signal; Tss, transcription start site. The activities produced by the studied constructs were normalized with the co-transfected control plasmid pRL-CMV. Reporter gene activity represents the mean ⫾ SEM of 3 independent experiments performed in duplicate. Activity of 6-bGH was significantly different from 6A-bGH with P ⬍ 0.05.
lanes 4, 5 and 6, respectively) resulted in a gradual disappearance and finally complete loss of all three shifted bands, whereas a 1000-fold excess of the mutated HNF4 oligo did not influence the shifting of the intact HNF4 oligo (Fig. 3A, lane 7). Nuclear extract and antibodies did
438
´ ET AL. STANULOVIC
HEPATOLOGY, February 2007
Fig. 5. Recruitment of HNF4␣ and HDAC1 to the GS upstream enhancer. Soluble, cross-linked chromatin from livers of HNF4 lox/lox (H4Flox) and HNF4 lox/lox, Cre⫹ (H4LivKO) mice was subjected to immunoprecipitation with anti-HNF4␣ (␣HNF4), anti-HDAC1 (␣HDAC1), or nonimmune serum, as indicated (A). The presence of GS upstream enhancer-containing DNA in the immunoprecipitates was analyzed by real-time PCR. The bars represent average values and standard errors relative to inputs from 3 experiments. (B) Autoradiogram of a representative ChIP experiment performed by radioactive PCR.
neither shift nor supershift the mutated HNF4 oligo (Fig. 3B, lanes 1-3). These results confirmed that HNF4␣ can bind to the upstream-enhancer sequence at position ⫺2658 to ⫺2645. HNF4␣ Represses GS Expression in Transient Transfections. To determine whether HNF4␣ directly regulates the expression of GS, we transfected COS-1 cells with an HNF4␣ expression plasmid and either plasmid 6-bGH (containing the putative HNF4␣-response element) or 6A-bGH (lacking the putative HNF4␣-response element). Luciferase reporter-gene activity of 6-bGH amounted to 45% of that of 6A-bGH (P ⬍ 0.05), showing that HNF4␣ suppresses GS expression via its binding site in the GS upstream enhancer element. HNF4␣ Binds the GS Upstream Enhancer in Vivo. To verify the in vivo relevance of HNF4␣ for the regulation of GS gene expression in the context of chromatin, we performed chromatin-immunoprecipitation assays using soluble cross-linked liver chromatin from a liver-specific HNF4␣ knockout mouse (H4LivKO) and its H4Flox control.13 As shown in Fig. 5, an antibody raised against HNF4␣ could efficiently immunoprecipitate GS upstream-enhancer DNA, when wild type liver (H4Flox) was used, whereas this was not the case for H4LivKO liver. Additionally, in H4Flox liver, we could demonstrate the presence of histone deacetylase 1 (HDAC1) on the GS upstream enhancer, which was lost in H4LivKO liver (Fig. 5). In contrast, antibodies directed against SMRT, HDAC3 and SHP did not precipitate the GS upstream enhancer (not shown). These findings indicate that the regulation of GS expression in hepatocytes involves HNF4␣-dependent recruitment of HDAC1-containing co-repressor complexes. Periportal Expression of GS in H4LivKO Livers. To further demonstrate how HNF4␣ regulates GS expression in vivo, in situ hybridization was performed on
H4Flox and H4LivKO liver. The histology of these livers has been reported.13 The control H4Flox liver exhibited the expected pericentral expression of GS mRNA, whereas no GS mRNA could be detected in periportal hepatocytes (Fig. 6A). In contrast, GS was present in almost all hepatocytes of a H4LivKO liver (Fig. 6C), albeit that the ectopic periportal expression of GS was less intense than the expression around the central veins. Furthermore, fewer pericentral hepatocytes expressed high-GS levels in H4LivKO liver than in H4Flox liver and at a lower level. Immunostaining confirmed the exclusive presence of GS protein in the pericentral hepatocytes of control H4Flox liver (Fig. 7A,B). As described for GS mRNA, GS protein was present in almost all hepatocytes of a H4LivKO liver, albeit that its concentration in the periportal hepatocytes was lower than that in the pericentral hepatocytes (Fig. 7C). GS-negative cells were either present as single, large hepatocytes (Fig. 7E,F) or in groups near portal veins (Fig. 7D). The presence of GS mRNA and protein in the periportal zone of the H4LivKO liver shows that HNF4␣ normally suppresses GS expression in periportal hepatocytes, whereas the decreasd expression of GS in the pericentral zone of the H4LivKO liver shows that HNF4␣ stimulates its expression in pericentral hepatocytes. Periportal HNF4␣-Positive Hepatocytes in H4LivKO Livers Do Not Express GS. Staining for HNF4␣ of control and H4LivKO livers explained the nature of the GS-negative cells in Fig. 7C-F. In the control liver, HNF4␣ showed a nuclear localization in all hepatocytes (Fig. 8A,B). As expected, H4LivKO liver contained only few HNF4␣-positive nuclei (Fig. 8C-F). Immunostaining of serial sections revealed that the HNF4␣-positive cells in H4LivKO liver did not contain detectable levels of GS, confirming that HNF4␣ suppresses GS expression in hepatocytes with a periportal phenotype (compare Fig.
HEPATOLOGY, Vol. 45, No. 2, 2007
´ ET AL. STANULOVIC
439
Like HNF4␣-positive hepatocytes, HNF4␣-negative periportal hepatocytes stained stronger for PEPCK than the corresponding pericentral hepatocytes (Fig. 8D,E and Fig. 10D,E, white arrows), suggesting that the extracellular signals that conferred zonation on PEPCK expression remained intact in H4LivKO livers. Interestingly, the very small HNF4␣- and GS-negative periportal hepatocytes (Fig. 7F; Fig. 8F) were positive for PEPCK (Fig. 10F). Taken together, these results imply that HNF4␣ does not influence porto-central gradient of PEPCK expression, but strongly affects the level of its expression. In contrast to PEPCK, carbamoylphosphate synthetase (CPS) is expressed in a very wide periportal area and is only absent in the GS-positive pericentral hepatocytes (Fig. 9C). The pattern of CPS expression was not disturbed by HNF4␣ deletion and the hepatocytes around the central vein remained CPS-negative, indicating that periportal CPS expression is not regulated by HNF4␣ (Fig. 9F). Additionally, less intense CPS staining in H4LivKO liver than in control H4Flox liver is in agreement with earlier findings.22
Fig. 6. GS and PEPCK mRNA distribution in HNF4␣-deficient liver. Serial sections were analyzed by in situ hybridization for the presence of GS (A,C) and PEPCK (B,D) mRNA. (A,B) represent control H4Flox liver, and (C,D) H4livKO liver. Abbreviations: c, central vein; p, portal vein. Bar: 100 m.
7D,E and Fig. 8D,E). Additionally, we found several clusters of very small cells near portal veins that were negative for both GS and HNF4␣ (Fig. 7F and Fig. 8F, arrows). HNF4␣ Deficiency Also Releases Periportal Expression of OAT and TR. Similar to GS, ornithine aminotransferase (OAT) and thyroid hormone receptor  (TR) are normally expressed in a narrow pericentral zone of hepatocytes (Fig. 9A,B). Again similar to GS, they become ectopically expressed in the periportal zone of H4LivKO livers (Fig. 9D,E). This finding indicates that HNF4␣ is a repressor of periportal expression for several genes that are normally pericentrally expressed. Deletion of the HNF4␣ Gene Impairs Periportal PEPCK Expression. Periportal PEPCK mRNA (Fig. 6B,D) and protein expression (Fig. 10A-E) in the H4LivKO liver was weaker than that in the control H4Flox liver. The comparison with the staining intensity in the few remaining HNF4␣-positive hepatocytes underscores this argument (Fig. 8D-F and Fig. 10D-F, black arrows). These observations are in agreement with earlier findings that HNF4␣ stimulates PEPCK expression.42,43
Fig. 7. GS protein distribution in HNF4␣-deficient liver. Immunohistochemical staining for the presence of GS in H4Flox (A,B) and H4livKO (C,F) livers. (B,D,E) are magnifications of the boxed areas in (A) and (C), whereas (F) is a magnification of the boxed area in (E). (A) and (C) present an overview. (D) shows a portal vein with adjacent small, GS-negative cells (black arrow), whereas (E) shows a central vein. Double-headed white arrows indicate the porto-central axis (D,E); black arrows indicate small (D) and very large (F) HNF4␣-positive cells; black arrowheads (F) show very small cells near vessel. Bars: 1 mm in (A) and (C) and 100 m in (B), (D-F).
440
´ ET AL. STANULOVIC
Fig. 8. Periportal HNF4␣-positive hepatocytes in H4LivKO livers do not express GS. Immunohistochemical staining for the presence of HNF4␣ in H4Flox (A,B) and H4livKO (C-F) livers. The panels are serial sections of the images shown in Fig. 7. Note that large HNF4␣-positive cells are not necessarily GS-negative (E), but that small HNF4␣-positive cells in the periportal zone are all GS-negative (D). Black arrow indicates HNF4␣positive cells (D,F) and black arrowheads show very small, HNF4␣negative cells (F). Bars: 1 mm in (A) and (C) and 100 m in (B), (D-F).
HEPATOLOGY, February 2007
Fig. 10. Deletion of the HNF4␣ gene impairs PEPCK expression. Immunohistochemical staining for the presence of phosphoenolpyruvate carboxykinase in H4Flox (A,B) and H4livKO (C-F) livers. The panels are serial sections of the images shown in Fig. 7. Note that the zonation of PEPCK expression that is seen in control liver is maintained in H4livKO liver (double-headed white arrow indicates portocentral gradient in (E). Intense PEPCK expression is only seen in large, HNF4␣positive hepatocytes (cf. Fig. 8) around the portal veins [black arrows in (D) and (F)]. The HNF4␣-positive small hepatocytes near the portal vein are also PEPCKpositive. Black arrowhead shows very small, PEPCK-negative cells. Bars: 1 mm (A,C) and 100 m in (B,D-F).
Fig. 9. OAT, TR, and CPS distribution in HNF4␣-deficient liver. Immunohistochemical staining for the presence of ornithine aminotransferase (A,D), thyroid-hormone receptor 1 (B,E) and carbamoylphosphate synthetase I (C) and (F) in H4Flox (A-C) and H4livKO (D-F) livers. Bar: 1 mm.
HEPATOLOGY, Vol. 45, No. 2, 2007
´ ET AL. STANULOVIC
441
Fig. 11. Expression pattern of GS, HNF4␣, OV6, and PCNA in H4LivKO livers. Immunofluorescent staining of serial sections for the presence of GS, HNF4␣, the oval cell marker OV-6, and PCNA (proliferating-cell nuclear antigen) in H4Flox [(A) and (B)] and H4livKO [(C) and (D)] livers. Note normal GS staining in pericental hepatocytes, the staining of all hepatocytes for HNF4␣, the weak OV-6-staining in cells near the portal tract and the weakly PCNA-positive nuclei near central veins in control liver [(A) and (B)]. The H4livKO liver shows persisting pericentral GS expression and up-regulated GS expression in the rest of the liver, whereas HNF4 disappeared except in single, big hepatocytes and in nests of small, regenerating hepatocytes [(C) and (D)] (GS and HNF4). Increased PCNA and OV-6 expression suggests DNA synthesis and regeneration in H4KOLiv livers [(C) and (D)]. The magnifications of the boxed areas in the OV-6 and PCNA subpanels of (D) show details of an oval cell-rich area. The HNF4␣-negative, OV6-positive and PCNA-positive cells were contiguous with streaks of brightly HNF4␣-positive, OV6-dim, and PCNA-dim cells [(C) and (D)]. Bars: 100 and 10 m.
HNF4␣ Deficiency Induces DNA Synthesis and Regeneration. Proliferating-cell nuclear antigen (PCNA) is a marker for DNA-synthesizing cells.44 In control liver, some cells adjacent to central veins had weakly positive nuclei, whereas the rest of the liver was PCNA-negative (Fig. 11A,B). In H4LivKO liver, however, the majority of hepatocytes were weakly PCNA-positive (Fig. 11C,D),
suggesting that HNF4␣ deficiency activates the expression of enzymes involved in DNA synthesis in hepatocytes. The OV-6 antibody, which recognizes cytokeratin-14 and -19, is a marker for oval or hepatocyte-progenitor cells.38 OV6-positive cells were not detected in control liver (Fig. 11A,B), but nests of very small (⬃10 m di-
442
´ ET AL. STANULOVIC
ameter), OV-6-positive cells were detected in H4LivKO liver (Fig. 11C,D; Fig. 7F; Fig. 8F; Fig. 10F). In agreement with earlier findings,12,14,15 these very small cells did not express HNF4␣, but were strongly positive for PCNA. The HNF4␣-negative, OV6- and PCNA-positive cells were contiguous with streaks of brightly HNF4␣-positive, OV6- and PCNA-dim cells (Fig. 11C,D). This latter group of HNF4␣-positive cells weakly expresses PEPCK, but not GS (Fig. 7D; Fig. 8D; Fig. 10D). The near absence of OV6 expression, the bright HNF4␣ expression and the emerging PEPCK expression identify these cells as newly differentiated hepatocytes45,46 that do not (yet) have their HNF4␣ alleles excised in the knockout mice. Together, these findings show that, in contrast to control mice, liver regeneration from oval cells is activated in HNF4␣deficient mice.
Discussion HNF4␣ Suppresses the Expression of a Subset of Pericentrally Expressed Enzymes in the Periportal Zone. Our study reports HNF4␣ binding to the glutamine synthetase upstream enhancer and suppression of GS expression in the periportal areas. Although we did not demonstrate HNF4␣ binding to the TR and OAT regulatory regions, the similarity in the change of their expression pattern in the H4LivKO liver suggests that HNF4␣ suppresses the expression of these and possibly other pericentral genes in the periportal region through a common mechanism. Furthermore, the expression of the periportal enzyme PEPCK was reduced in the H4LivKO liver. However, even though expression of GS, OAT and TR was induced periportally and that of PEPCK reduced, HNF4␣ deletion did not eliminate the porto-central gradient of expression of these genes. These findings demonstrate that HNF4␣ enhances the expression of PEPCK and other periportal genes (e.g., glucose-6-phosphatase21) and inhibits the expression of several pericentrally expressed genes in the periportal areas. Northern- and Western-blot quantification of gene expression in the H4LivKO mouse has revealed altered expression levels for many liver-specific genes and an impaired lipid, protein and glycogen metabolism.13,22 These biochemical studies did not report the residual HNF4␣ expression in isolated hepatocytes and periportal clusters of small cells. In apparent contrast to our findings, it was also reported that GS mRNA levels were not different between HNF4␣-null and control mice.22 Interestingly, our in situ hybridization showed that the GS mRNA concentration in the pericentral area was lower in HNF4␣ knockout than in control liver. We therefore
HEPATOLOGY, February 2007
conclude that the absence of an overall change in GS mRNA levels results from an increase in GS mRNA concentration in the periportal hepatocytes and a compensating decrease in GS mRNA in the pericentral hepatocytes. Our data also show that histochemical techniques are a very useful complement to biochemical techniques, as it produces expression data at the single-cell level and allows observation of changes in the distribution of gene expression. In this respect, the few hepatocytes in which the cre enzyme did not (yet) excise both HNF4␣ alleles,13 provided valuable tissue-intrinsic controls for the effects of HNF4␣ deficiency on the level of expression of the genes we studied. Albumin-cre mice express cre recombinase in their hepatocytes from neonatal day 10 onward.26 However, it takes until the animals are 6 weeks old before cre is expressed throughout the liver and HNF4␣ in the H4LivKO liver is decreased to non-detectable levels.13,26 The presence of HNF4␣ in the small, intensely PCNApositive cells can be understood because these cells do not (yet) express hepatocyte-specific genes and, hence, do not express cre. Although the similarity in the behavior of GS, OAT and TR in H4LivKO livers suggests a common mechanism of periportal suppression for pericentrally expressed genes by HNF4␣, we also observed that Cyp3A4 expression, which is expressed in a wide pericentral zone, was not influenced by the HNF4␣ deletion (unpublished observation). Furthermore, another member of the cytochrome P450 family of enzymes, Cyp7a, which, like GS, OAT and TR, is characterized by a very narrow pericentral expression pattern,23 is reportedly down-regulated rather than up-regulated in the HNF4␣-deficient livers.13,47 A similar dichotomy appears to exist with respect to periportal enzymes: some enzymes, like PEPCK and ornithine transcarbamoylase20,24 are up-regulated by HNF4␣, whereas others, including CPS, are not affected. These data therefore suggest that HNF4␣ is not a prime determinant of the porto-central gradient in gene expression in the liver, but affects a subgroup of hepatocytespecific genes. In agreement, we noticed that the portocentral gradient in PEPCK expression was also not affected by HNF4␣ deficiency. Mechanism of HNF4␣-Mediated Periportal Suppression of Gene Expression. HNF4␣ is present on approximately 12% of the promoters in liver, 80% of which are also occupied by RNA polymerase II,4 that is, are putatively transcribed. The common determinant of the subgroup of pericentral enzymes, of which expression in the periportal zone becomes released by HNF4␣ deficiency, remains to be determined. Our results show that HNF4␣ binds GS upstream enhancer and suppresses GS expression in the periportal
´ ET AL. STANULOVIC
HEPATOLOGY, Vol. 45, No. 2, 2007
region. The most suggestive proof for a direct mechanism can be found in the immunostainings of H4livKO livers, in which the few remaining HNF4␣-positive hepatocytes in the periportal region do not express GS. These HNF4␣-positive hepatocytes show a cell-autonomous HNF4␣ effect on GS expression in the periportal region and do not support an indirect effect due to the overall changed physiology of the H4livKO liver. HNF4␣ is mostly reported to activate transcription,7,48 but it can also act as a suppressor.6,49 Our finding that histone deacetylase 1 (HDAC1) recruitment to the upstream region of GS is dependent on the presence of HNF4␣ (Fig. 5) suggests that HNF4␣-promoted chromatin condensation could well be a potential mechanism. The orphan nuclear receptor SHP, which can directly interact with HDAC1 and the histone-methylating enzyme G9a methyltransferase,50 has been reported to mediate HNF4␣ repression of gene expression.49 The co-repressor SMRT (silencing mediator of retinoid and thyroid receptors), which interacts with histone deacetylase 3 (HDAC3), can also mediate the HNF4␣-promoted suppression of gene expression6,51 and promotes chromatin condensation.52 Since the ChIP assays with SMRT, HDAC3 and SHP antibodies did not precipitate the GS upstream enhancer, we propose the HNF4␣/HDAC1-promoted chromatin condensation, acting via a yet unidentified mediator, as a potential mechanism of the periportal suppression of the GS gene. HNF4␣ Deficiency Activates DNA Synthesis and Induces Liver Regeneration from Oval Cells. We observed an enhanced expression of the DNA-synthesis marker PCNA53 in all HNF4␣-deficient hepatocytes. We also observed a very strong PCNA expression in nests of very small (⬃10 m) OV6-positive, HNF4␣-negative cells near portal tracts that did not express hepatocytespecific enzymes. This phenotype identifies these cells as oval cells, i.e., hepatocyte-progenitor cells.54 The spatial continuity of these cells with streaks of OV6- and PCNAdim, but brightly HNF4␣-positive and weakly PEPCKpositive cells implies a steady production of hepatocytes from these hepatic stem cells.13,55,56 Altogether, these findings reveal the presence of regenerative foci and suggest de-repression of DNA synthesis in HNF4␣-deficient hepatocytes. The regenerative stimulus is unknown, but it is possible that liver failure underlies the very limited life span of liver HNF4␣-deficient mice.13,22 Acknowledgment: We wish to thank Dr. F.J. Gonzalez (Laboratory of Metabolism, National Cancer Institute, National Institutes of Health, Bethesda, Maryland) for providing the HNF4Flox animals; Dr. T. Matsuzawa (Department of Biochemistry, School of Medicine, Fujita-Gakuen Health University, Toyoake, Japan), Dr. S.
443
Sell (Department of Pathology and Laboratory Medicine, Division of Experimental Pathology, Albany, NY), Dr. B. Christ (Martin Luther Universita¨t Halle-Wittenberg, Halle, Germany) and Dr. O. Bakker (Department of Endocrinology and Metabolism, AMC, University of Amsterdam, Amsterdam, The Netherlands) for their gifts of antiserum against ornithine aminotransferase, OV-6, PEPCK and thyroid-hormone receptor , respectively.
References 1. Xanthopoulos KG, Prezioso VR, Chen WS, Sladek FM, Cortese R, Darnell JE Jr. The different tissue transcription patterns of genes for HNF-1, C/EBP, HNF-3, and HNF-4, protein factors that govern liver-specific transcription. Proc Natl Acad Sci U S A 1991;88:3807-3811. 2. Sladek FM, Zhong WM, Lai E, Darnell JE Jr. Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev 1990;4(12B):2353-2365. 3. Chen WS, Manova K, Weinstein DC, Duncan SA, Plump AS, Prezioso VR, et al. Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev 1994;8:2466-2477. 4. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, et al. Control of pancreas and liver gene expression by HNF transcription factors. Science 2004;303:1378-1381. 5. Hertz R, Magenheim J, Berman I, Bar-Tana J. Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4alpha. Nature 1998;392:512-516. 6. Ruse MD Jr, Privalsky ML, Sladek FM. Competitive cofactor recruitment by orphan receptor hepatocyte nuclear factor 4alpha1: modulation by the F domain. Mol Cell Biol 2002;22:1626-1638. 7. Malik S, Wallberg AE, Kang YK, Roeder RG. TRAP/SMCC/mediatordependent transcriptional activation from DNA and chromatin templates by orphan nuclear receptor hepatocyte nuclear factor 4. Mol Cell Biol 2002;22:5626-5637. 8. Sladek FM, Ruse MD Jr, Nepomuceno L, Huang SM, Stallcup MR. Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 4alpha1. Mol Cell Biol 1999;19:6509-6522. 9. Wang JC, Stafford JM, Granner DK. SRC-1 and GRIP1 coactivate transcription with hepatocyte nuclear factor 4. J Biol Chem 1998;273:3084730850. 10. Yoshida E, Aratani S, Itou H, Miyagishi M, Takiguchi M, Osumu T, et al. Functional association between CBP and HNF4 in trans-activation. Biochem Biophys Res Commun 1997;241:664-669. 11. Ma J. Crossing the line between activation and repression. Trends Genet 2005;21:54-59. 12. Parviz F, Matullo C, Garrison WD, Savatski L, Adamson JW, Ning G, et al. Hepatocyte nuclear factor 4alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet 2003;34:292-296. 13. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ. Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 2001;21: 1393-1403. 14. Paku S, Nagy P, Kopper L, Thorgeirsson SS. 2-acetylaminofluorene dosedependent differentiation of rat oval cells into hepatocytes: confocal and electron microscopic studies. HEPATOLOGY 2004;39:1353-1361. 15. Sell S, Osborn K, Leffert HL. Autoradiography of “oval cells” appearing rapidly in the livers of rats fed N-2-fluorenylacetamide in a choline devoid diet. Carcinogenesis 1981;2:7-14. 16. Ha¨ussinger D, Lamers WH, Moorman AFM. Hepatocyte heterogeneity in the metabolism of amino acids and ammonia. Enzyme 1992;46:72-93. 17. Garcia de Veas Lovillo RM, Ruijter JM, Labruyere WT, Hakvoort TB, Lamers WH. Upstream and intronic regulatory sequences interact in the activation of the glutamine synthetase promoter. Eur J Biochem 2003;270: 206-212.
444
´ ET AL. STANULOVIC
18. Gaunitz F, Gaunitz C, Papke M, Gebhardt R. Cis-regulatory sequences from the first intron of the rat glutamine synthetase gene are involved in hepatocyte specific expression of the enzyme. Biol Chem 1997;378:11-18. 19. Gaunitz F, Heise K, Schumann R, Gebhardt R. Glucocorticoid induced expression of glutamine synthetase in hepatoma cells. Biochem Biophys Res Commun 2002;296:1026-1032. 20. Christ B, Nath A, Bastian H, Jungermann K. Regulation of the expression of the phosphoenolpyruvate carboxykinase gene in cultured rat hepatocytes by glucagon and insulin. Eur J Biochem 1988;178:373-379. 21. Massillon D, Arinze IJ, Xu C, Bone F. Regulation of glucose-6-phosphatase gene expression in cultured hepatocytes and H4IIE cells by short-chain fatty acids: role of hepatic nuclear factor-4alpha. J Biol Chem 2003;278: 40694-40701. 22. Inoue Y, Hayhurst GP, Inoue J, Mori M, Gonzalez FJ. Defective ureagenesis in mice carrying a liver-specific disruption of hepatocyte nuclear factor 4alpha (HNF4alpha). HNF4alpha regulates ornithine transcarbamylase in vivo. J Biol Chem 2002;277:25257-25265. 23. Twisk J, Hoekman MF, Mager WH, Moorman AF, de Boer PA, Scheja L, et al. Heterogeneous expression of cholesterol 7 alpha-hydroxylase and sterol 27-hydroxylase genes in the rat liver lobulus. J Clin Invest 1995;95: 1235-1243. 24. Conway JG, Kauffman FC, Tsukada T, Thurman RG. Glucuronidation of 7-hydroxycoumarin in periportal and pericentral regions of the liver lobule. Mol Pharmacol 1984;25:487-493. 25. Massimi M, Lear SR, Williams DL, Jones AL, Erickson SK. Differential expression of apolipoprotein E messenger RNA within the rat liver lobule determined by in situ hybridization. HEPATOLOGY 1999;29: 1549-1555. 26. Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B, et al. Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci U S A 1999;96:7324-7329. 27. Quandt K, Frech K, Karas H, Wingender E, Werner T. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 1995;23:48784884. 28. Sierra F. A Laboratory Guide to in vitro Transcription. Biomethods. Basel: Birkhauser Verlag, 1990. 29. Kouskouti A, Talianidis I. Histone modifications defining active genes persist after transcriptional and mitotic inactivation. EMBO J 2005;24: 347-357. 30. Hatzis P, Talianidis I. Dynamics of enhancer-promoter communication during differentiation-induced gene activation. Mol Cell 2002;10:14671477. 31. Kouskouti A, Scheer E, Staub A, Tora L, Talianidis I. Gene-specific modulation of TAF10 function by SET9-mediated methylation. Mol Cell 2004;14:175-182. 32. Boulias K, Katrakili N, Bamberg K, Underhill P, Greenfield A, Talianidis I. Regulation of hepatic metabolic pathways by the orphan nuclear receptor SHP. EMBO J 2005;24:2624-2633. 33. Ktistaki E, Talianidis I. Modulation of hepatic gene expression by hepatocyte nuclear factor 1. Science 1997;277:109-112. 34. Lie-Venema H, Labruyere WT, van Roon MA, de Boer PA, Moorman AF, Berns AJ, et al. The spatio-temporal control of the expression of glutamine synthetase in the liver is mediated by its 5⬘-enhancer. J Biol Chem 1995; 270:28251-28256. 35. Ogris M, Steinlein P, Kursa M, Mechtler K, Kircheis R, Wagner E. The size of DNA/transferrin-PEI complexes is an important factor for gene expression in cultured cells. Gene Ther 1998;5:1425-1433. 36. Kasahara M, Matsuzawa T, Kokubo M, Gushiken Y, Tashiro K, Koide T, et al. Immunohistochemical localization of ornithine aminotransferase in normal rat tissues by Fab⬘-horseradish peroxidase conjugates. J Histochem Cytochem 1986;34:1385-1388. 37. Zandieh DB, Platvoet-ter Schiphorst M, van Beeren HC, Labruyere WT, Lamers WH, Fliers E, et al. TR1 protein is preferentially expressed in the
HEPATOLOGY, February 2007
38.
39.
40.
41.
42.
43.
44. 45.
46.
47.
48.
49.
50.
51.
52.
53.
54. 55. 56.
pericentral zone of rat liver and exhibits marked diurnal variation. Endocrinology 2002;143:979-984. Dunsford HA, Sell S. Production of monoclonal antibodies to preneoplastic liver cell populations induced by chemical carcinogens in rats and to transplantable Morris hepatomas. Cancer Res 1989;49:4887-4893. Bisgaard HC, Parmelee DC, Dunsford HA, Sechi S, Thorgeirsson SS. Keratin 14 protein in cultured nonparenchymal rat hepatic epithelial cells: characterization of keratin 14 and keratin 19 as antigens for the commonly used mouse monoclonal antibody OV-6. Mol Carcinog 1993;7:60-66. Moorman AF, de Boer PA, Ruijter JM, Hagoort J, Franco D, Lamers WH. Radio-isotopic in situ hybridization on tissue sections. Practical aspects and quantification. Methods Mol Biol 2000;137:97-115. Moorman AF, Houweling AC, de Boer PA, Christoffels VM. Sensitive nonradioactive detection of mRNA in tissue sections: novel application of the whole-mount in situ hybridization protocol. J Histochem Cytochem 2001;49:1-8. Stafford JM, Waltner-Law M, Granner DK. Role of accessory factors and steroid receptor coactivator 1 in the regulation of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. J Biol Chem 2001; 276:3811-3819. Hall RK, Sladek FM, Granner DK. The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl Acad Sci U S A 1995;92:412-416. Takasaki Y, Deng JS, Tan EM. A nuclear antigen associated with cell proliferation and blast transformation. J Exp Med 1981;154:1899-1909. Tanimizu N, Tsujimura T, Takahide K, Kodama T, Nakamura K, Miyajima A. Expression of Dlk/Pref-1 defines a subpopulation in the oval cell compartment of rat liver. Gene Expr Patterns 2004;5:209-218. Nagy P, Bisgaard HC, Thorgeirsson SS. Expression of hepatic transcription factors during liver development and oval cell differentiation. J Cell Biol 1994;126:223-233. Stroup D, Chiang JY. HNF4 and COUP-TFII interact to modulate transcription of the cholesterol 7alpha-hydroxylase gene (CYP7A1). J Lipid Res 2000;41:1-11. Malik S, Karathanasis SK. TFIIB-directed transcriptional activation by the orphan nuclear receptor hepatocyte nuclear factor 4. Mol Cell Biol 1996; 16:1824-1831. Lee YK, Dell H, Dowhan DH, Hadzopoulou-Cladaras M, Moore DD. The orphan nuclear receptor SHP inhibits hepatocyte nuclear factor 4 and retinoid X receptor transactivation: two mechanisms for repression. Mol Cell Biol 2000;20:187-195. Boulias K, Talianidis I. Functional role of G9a-induced histone methylation in small heterodimer partner-mediated transcriptional repression. Nucleic Acids Res 2004;32:6096-6103. Torres-Padilla ME, Weiss MC. Effects of interactions of hepatocyte nuclear factor 4alpha isoforms with coactivators and corepressors are promoter-specific. FEBS Lett 2003;539:19-23. Vermeulen M, Carrozza MJ, Lasonder E, Workman JL, Logie C, Stunnenberg HG. In vitro targeting reveals intrinsic histone tail specificity of the Sin3/histone deacetylase and N-CoR/SMRT corepressor complexes. Mol Cell Biol 2004;24:2364-2372. Xiong Y, Zhang H, Beach D. D type cyclins associate with multiple protein kinases and the DNA replication and repair factor PCNA. Cell 1992;71: 505-514. Alison MR, Golding MH, Sarraf CE. Pluripotential liver stem cells: facultative stem cells located in the biliary tree. Cell Prolif 1996;29:373-402. Thorgeirsson SS, Grisham JW. Overview of recent experimental studies on liver stem cells. Semin Liver Dis 2003;23:303-312. Paku S, Schnur J, Nagy P, Thorgeirsson SS. Origin and structural evolution of the early proliferating oval cells in rat liver. Am J Pathol 2001;158: 1313-1323.
