Extremophiles (2014) 18:341–349 DOI 10.1007/s00792-013-0619-4
ORIGINAL PAPER
Haloarcula marismortui archaellin genes as ecoparalogs Alexey S. Syutkin • Mikhail G. Pyatibratov • Oxana V. Galzitskaya • Francisco Rodrı´guez-Valera Oleg V. Fedorov
•
Received: 6 August 2013 / Accepted: 5 December 2013 / Published online: 25 December 2013 Ó Springer Japan 2013
Abstract The genome of haloarchaeon Haloarcula marismortui contains two archaellin genes—flaA2 and flaB. Earlier we isolated and characterized two H. marismortui strains in that archaella consisting of FlaA2 archaellin (with a minor FlaB fraction) or of FlaB only. Both the FlaA2 and FlaB strains were motile and produced functional helical archaella. Thus, it may seem that the FlaA2 archaellin is redundant. In this study we investigated the biological roles of archaellin redundancy and demonstrated that FlaA2 archaellin is better adapted to more severe conditions of high temperature/low salinity, while FlaB has an advantage with increasing salinity. We used the thermodynamic data and bioinformatics sequence analysis to demonstrate that archaella formed by FlaA2 are more stable than those formed by FlaB. Our combined data indicate that the monomer FlaA2 archaellin is more flexible and leads to more compact and stable formation of filamentous structures. The difference in response to environmental stress indicates that FlaA2 and FlaB replace each other under different environmental conditions and can be considered as ecoparalogs.
Communicated by A. Oren. A. S. Syutkin (&) M. G. Pyatibratov O. V. Galzitskaya O. V. Fedorov Institute of Protein Research, Russian Academy of Sciences, 142290 Pushchino, Moscow Region, Russia e-mail:
[email protected] F. Rodrı´guez-Valera Divisio´n de Microbiologı´a, Evolutionary Genomics Group, Universidad Miguel Herna´ndez, San Juan de Alicante, 03550 Alicante, Spain
Keywords Archaella Haloarcula marismortui Ecoparalogs Flagellin Haloarchaea
Introduction Life on Earth exists in a wide range of environmental conditions (temperature, pH, salinity, etc.). The majority of species are better adapted to the conditions of their ecological niche. However, even within the same niche, environmental conditions can fluctuate drastically. Living organisms have developed a variety of mechanisms to adapt to environmental fluctuations. One of them used at least in prokaryotes is having two or more gene copies performing the same function in different environmental conditions (Sanchez-Perez et al. 2008). These authors proposed the term ‘‘ecoparalog’’ to describe paralogous genes in a single genome that have different environmental specialization. Based on in silico analysis, these authors identified some potential ecoparalogs in the halophilic bacterium Salinibacter ruber and in other bacterial and archaeal species dealing with wide environmental variations. Some potential ecoparalogs were found in original experiments. Zilm et al. (2010) found potential ecoparalogs regulated by alkalinity among the cell envelope proteins of periodontophatic bacteria Fusobacterium nucleatum. In the case of three Haloarcula marismortui ribosomal RNA operons, it was clearly demonstrated that they were ecoparalogs (Lopez-Lopez et al. 2007). The haloarchaeon H. marismortui lives in the Dead Sea, where the temperature and salinity in the upper layers can vary significantly depending on the season. The salinity of the sea in the upper layer may vary from about 200–350 g l-1 depending on the receipt of fresh water (Steinhorn 1997; Bodaker et al. 2010), while the
123
342
temperature can range from 10 °C in winter to 50 °C in summer (Hecht and Gertman 2003). The two 16S rRNAs genes rrnA and rrnC present in chromosome I of this microbe (rrnAC) have lower thermal stability than the rrnB copy present in chromosome II (rrnB) of 288 Kbp. Furthermore, their transcription levels varied accordingly depending on the cultivation temperature, i.e., rrnB was much more expressed at high temperatures. Finally, a mutant deficient in the rrnB operon had both a lower growth rate and yield at high temperature. Based on the H. marismortui genome analysis, the authors suggested that at least 100 genes of this archaeon could be ecoparalogs (Lopez-Lopez et al. 2007). Here, we have focused our attention on the identification of potential ecoparalogs among the H. marismortui genes involved in cell motility. Archaea use rotation of helical archaella (formerly, archaeal flagella) for motility in liquid media (Alam and Oesterhelt 1984; Ng et al. 2006; Jarrell and Albers 2012). Archaellar filaments are constructed from protein subunits called archaellins (archaeal analogs to flagellins). Multiplicity of archaellin genes is widespread among archaea (Ng et al. 2006). It was shown that the multiplicity is necessary for the construction of functional helical archaella and the maintenance of normal motility (Tarasov et al. 2000; Bardy et al. 2002; Chaban et al. 2007). To date, no cases have been described when one of the archaellin paralogous genes could replace another following environmental changes. The H. marismortui genome contains two archaellin genes flaB and flaA2, encoding closely related (56 % identity) protein products; flaB (rrnAC2198) is located on chromosome I (rrnAC) near the fla-locus, while flaA2 (pNG1026) is on the pNG100 plasmid (ca. 33 Kbp) (Baliga et al. 2004). Interestingly, only two archaeal species, H. marismortui and Methanohalobium evestigatum, whose archaellin genes are located on plasmids, are known to date. Previously, two H. marismortui strains differing in archaella composition were identified (Pyatibratov et al. 2008). In the FlaA2 strain, the archaellar filaments were composed mainly of the FlaA2 archaellin, whereas the FlaB archaellin was predominant in the FlaB strain (Pyatibratov et al. 2008). It has been shown that the chromosomal archaellin gene (flaB) is sufficient for the formation of functional helical H. marismortui archaella (Syutkin et al. 2012). Thus, it may be suggested that the second, plasmid-borne archaellin is redundant. Initially, we thought that this redundancy could be related to defense against hypothetic viruses interacting with specific sites on the archaella surface (Pyatibratov et al. 2008). However, the role of the redundancy detected for the H. marismortui rRNA genes (Lopez-Lopez et al. 2007) led us to hypothesize that the flaB and flaA2 archaellin genes also could be ecoparalogs. An indirect support of this role
123
Extremophiles (2014) 18:341–349
for the two archaellins was the fact that archaella FlaB and FlaA2 differ in thermostability (Pyatibratov et al. 2008). Although H. marismortui archaellin genes were not included in the published list of potential H. marismortui ecoparalogs (Sanchez-Perez et al. 2008), the analysis carried out there was not comprehensive and was based only on protein predictions from the genome sequence. Here, we demonstrate that the H. marismortui archaellins are actually ecoparalogs that extend the range of motility at different temperatures, and the mechanism of switching between two archaellins is rather different from that for rRNA operons.
Materials and methods Bacterial strain and growth conditions Haloarcula marismortui B_1809 (ATCC 43049, DSM 3752) was obtained from the All-Russian Collection of Microorganisms (VKM), Pushchino. The culture was grown at limited aeration. The medium was prepared in the following way. Initially, the salt solution with 30 % total salinity was prepared. The composition of 30 % salt solution was (per liter): 234 g of NaCl, 29.7 g of MgSO4, 42 g of MgCl26H2O, 6 g of KCl, 1.45 g of CaCl22H2O, 0.8 g of NaBr, 0.6 g of NaHCO3. After dissolving the salts, 10 ml of 1 M Tris–HCl, pH 8.0, was added and pH was adjusted to 7.2. Salt solutions with appropriate salinities (20 % and 25 %) were prepared by dilution of 30 % stock solution with pure water. Then 10 g of the yeast extract were added and the final volume was adjusted to 1 l. The medium was sterilized by filtration through 0.2 lm membrane filters instead of autoclaving, to avoid salt precipitation. Motility of the FlaA2 and FlaB strains was tested on semisolid bacto agar plates. Preparation of DNA and polymerase chain reaction Total DNA of H. marismortui was prepared as described by Charlebois et al. (1987). The presence of the pNG100 plasmid was checked using the following oligonucleotides: pNG100_F ATGATCCAAGAAACGCTCCCGA pNG100_R CGTGTCCGCATCAGATCATGAA Hm_flaA2_F AGAAAAAAGCTTACGAGAACGAACGC Hm_flaA2_R TCCCACTTTCTAGATTTGTAATGGTAACCTC The Hm_flaA2 and pNG100 primers amplify loci pNG1026 (flaA2 gene) and pNG1005, respectively. The distance between these two loci is approximately 17 kbp (that is roughly half of the pNG100 plasmid).
Extremophiles (2014) 18:341–349
Isolation of archaellar filaments Archaellar filaments were prepared by precipitation with polyethylene glycol 6000 as described by Gerl et al. (1989). The protein preparations were dissolved in 50 mM Tris–HCl, pH 8.0, containing 20 % NaCl. SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis) was performed using 7 % acrylamide gels. The proteins were stained with Coomassie Brilliant Blue G-250.
343
trypsin (Promega), pepsin (Sigma) and V8 protease (endoproteinase Glu-C from Staphylococcus aureus V8) (Roche Applied Science) were used. MS/MS data for peptides collected by independent proteolysis for all three proteases were analyzed using the Mascot search engine (Matrix Science, UK) and the presence of the last C-terminal amino acid residues of FlaB (SGETAVQV) in TFFlaB was confirmed. Scanning microcalorimetry
Isolation of archaellin TF-FlaB fragment Limited trypsinolysis of H. marismortui archaellar filaments was performed at room temperature in 10 mM Tris– HCl, pH 7.5, containing 20 % NaCl and 10 mM MgCl2. Trypsin and soybean trypsin inhibitor (Sigma) were previously dissolved in the same buffer to a concentration of 1 mg/ml. Filament concentrations of 0.1–1 mg/ml were used. Partly unfolded archaella were obtained by incubation at 65 °C for 20 min at the archaella concentration of 0.1 mg/ml. After cooling to room temperature, trypsin was added in an amount of 1 mg per 50 mg of filaments. After 3 h, the trypsinolysis was stopped by adding an equimolar amount of an inhibitor of soybean. Then the reaction mixture was centrifuged for 30 min at 70000 rpm in a TL 100 Beckman centrifuge. The precipitated polymers contained undigested archaellin and a set of tryptic fragments. To separate the fragments the precipitate was resuspended in 10 mM Tris–HCl, pH 7.5 containing 7.5 % NaCl and 10 mM MgCl2 and centrifuged under the same conditions. The precipitate included undigested FlaB and fragments containing hydrophobic N-terminal archaellin regions, while the TF fragment remained in the supernatant. For additional purification, gel filtration chromatography on a Superose 12HR column, equilibrated with 10 mM Tris– HCl, pH 7.5, containing 20 % NaCl and 10 mM MgCl2, was used. Fractionation was performed at a flow rate of 0.2 ml/min, and the fraction volume was 0.4 ml. The selected (by SDS-PAGE) fractions containing the purest fragment TF-FlaB were concentrated, if necessary, with Amicon Ultra-4 Ultracell-3 k (Millipore) to 1–2 mg/ml and used for further experiments. N-terminal amino acid sequencing of the TF-FlaB was done at the W.M.Keck Foundation Biotechnology Resource Laboratory, Yale University, New Haven, CT, USA. Sequence TYGDPVNG matches the amino acid sequences of the H. marismortui FlaB archaellin at positions 175–182. The mass spectrometric experiments were performed on a liquid chromatograph coupled to an ion trap mass spectrometer (LCQ DecaXP, Thermo Finnigan, USA), equipped with a nanoelectrospray ion source as described by Pyatibratov et al. (2008). The isolated TFFlaB was analyzed after treatment by three proteases:
Calorimetric measurements were done on a differential scanning microcalorimeter SCAL-1 (Scal Co., Pushchino, Russia) at a heating rate of 1 °C/min. The operation volume of a gold cell was 0.3 ml. The measurements and necessary calculations were performed according to Privalov and Potekhin (1986) and described in detail by Tarasov et al. (1995). Western blotting The proteins were transferred from the polyacrylamide slab gel to the Immobilon-P membrane (Millipore) as described in the user guide. Rabbit antiserum was raised by injecting FlaB filaments, 0.1–0.3 mg of protein per injection, using the method described by Southam et al. (1990). Antibody binding was detected by incubation with an alkaline phosphatase conjugated to goat anti-rabbit immunoglobulin G (Sigma, USA) development with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Promega, USA). Search for disordered residues The analysis of the FlaA2 and FlaB archaellin sequences for searching the disordered regions was performed with the IsUnstruct program (Lobanov and Galzitskaya 2011) based on the Ising model. The parameters of the program were determined and optimized on the basis of protein structure statistics. The testing showed that the program yields reliable predictions. The program is available at http://bioinfo.protres.ru/IsUnstruct (Lobanov et al. 2012). The PONDR-FIT method was used to check the reliability of predictions; a meta-server yields a consensus prediction for ten programs (Xue et al. 2010).
Results Strain FlaB is pNG100 deficient As previously described, the FlaA2 strain when cultivated in a rich liquid medium was stable and did not revert to
123
344
Extremophiles (2014) 18:341–349
1000
500
M
1
2
3
4
Fig. 1 Presence of the pNG100 plasmid in H. marismortui cells: M, DNA marker (bp); 1 and 2, pNG100 primers, FlaA2 and FlaB strains, respectively; 3 and 4, Hm_flaA2 primers, FlaA2 and FlaB strains, respectively
FlaB production (Pyatibratov et al. 2008). Since the flaA2 archaellin gene is located on the pNG100 plasmid, we checked for the presence of this plasmid DNA in the FlaB strain. Using PCR with primers to different and situated far from each other pNG100 regions (loci pNG1026 for Hm_flaA2 pair and pNG1005 for pNG100 pair), we demonstrated that the FlaB strain does not contain the plasmid (Fig. 1). Thus, the transition from the FlaA2 to FlaB strain is a result of the loss of pNG100. This result is not consistent with earlier analysis (Pyatibratov et al. 2008), but it is likely that in this previous work the FlaB strain was contaminated with FlaA2. Therefore, the FlaA2 strain is a wild-type one, while the FlaB strain is pNG100 deficient (pNG100-). The motility of H. marismortui at different conditions The stability of most haloarchaeal proteins strongly depends on media salinity. To test our hypothesis about whether H. marismortui archaellin genes are ecoparalogs, we compared the motility of the FlaA2 and FlaB strains on a semisolid agar medium at different temperatures (40 and 50 °C) and salinities (20, 25 and 30 %). The results of the experiments are shown in Fig. 2 (except at 20 % salinity and 50 °C, a combination at which no growth was detected). The motility range of the strain containing only chromosome I encoding FlaB seems much more restricted and it failed to display this property at both high temperature (50 °C) and low salinity (20 %). The strain containing the FlaA2 plasmidic archaellin moves over the whole range of salinities and temperatures tested. Interestingly, at 30 % salt and 40 °C the motility of the FlaB containing strain was significantly higher than that containing FlaA2 (Table 1).
123
We supposed that the reduced motility of the FlaB strain at low salinity was caused by disruption of the FlaB archaella assembly. To test the hypothesis we isolated archaella from cells that grew under the same temperature and salinity conditions in a liquid medium. The resulting products were analyzed by SDS-PAGE (Fig. 3). As seen from the results, archaella cannot be isolated from liquid cell cultures under conditions when the FlaB cells are nonmotile on a semisolid agar medium. Unexpectedly, under conditions where both strains had comparable motilities on semisolid agar, the yield of FlaB archaella isolated from liquid medium was significantly lower than that of FlaA2 archaella (25 % salt and 40 °C) or reduced to zero (30 % salt and 50 °C). This result may indicate that archaellin genes are regulated differently in cells growing in liquid and semisolid media. As we have previously shown (Pyatibratov et al. 2008), the samples obtained at archaella isolation from the FlaA2 strain contain a minor amount of the FlaB archaellin which can be detected by immunoblotting. We have tested the presence of associated FlaB archaellin in archaella samples isolated from the FlaA2 strain grown at different conditions (Fig. 4). The admixture of the FlaB archaellin was not detected at the same conditions when this archaellin could not be isolated from the FlaB strain. It remained unclear whether the lack of FlaB archaellin is the result of negative regulation of its biosynthesis or the result of the FlaB archaellin inability to form archaella under certain environmental conditions. It has recently been found that the transcription level of the FlaB archaellin in the FlaA2 strain at 50 °C was threefold higher compared to that at 27 °C; the salinity in both cases was 25 % (Rodriguez-Valera, unpublished). Using immunoblotting, we demonstrated that the archaella preparations isolated from the FlaA2 strain grown at 27 °C contained associated FlaB archaellin, whereas the preparation from a culture grown at 50 °C does not contain any FlaB archaellin (Fig. 4, tracks 7 and 5). The result indicates that the absence of the FlaB archaellin in the archaella preparations is not a result of suppression of its biosynthesis, but caused by disordered polymerization properties at high temperatures/low salinities. We have already shown that FlaA2 and FlaB strains do not differ in the growth rate in liquid medium at 42 °C (Pyatibratov et al. 2008). In this work, we have not observed any significant differences in the growth rate between the FlaA2 and FlaB strains in all the conditions tested. Isolation and characterization of a thermostable domain of archaellin FlaB As we reported previously, both FlaA2 and FlaB archaellar filaments are resistant to trypsin in native salt conditions (Pyatibratov et al. 2008). However, upon heating to
Extremophiles (2014) 18:341–349
345
Fig. 2 Comparison of cell motility of H. marismortui FlaA2 and FlaB strains on semisolid media. The FlaA2 strain is in the spots on the left and right; the FlaB strain is in the top and bottom spots. Agar concentrations were: 0.25 % at 40 °C and 0.3 % at 50 °C. a 20 % salinity, 40 °C; b 25 % salinity, 40 °C; c 30 % salinity, 40 °C; d 25 % salinity, 50 °C and e 30 % salinity, 50 °C
a
b
c
d
e
Table 1 Comparison of motilities of H. marismortui FlaA2 and FlaB strains on semisolid media at different salinities (%) and temperatures (°C) Strain
Growth conditions 20 %, 40 °C
25 %, 40 °C
30 %, 40 °C
20 %, 50 °C
25 %, 50 °C
30 %, 50 °C
FlaA2
??
??
??
-
??
??
FlaB
?
??
???
-
-
??
temperatures corresponding to the first melting peaks, they lost resistance to trypsinolysis and formed a set of fragments. A large tryptic FlaB fragment resistant to further degradation (TF-FlaB) can be isolated by size exclusion chromatography (Fig. 5). For NaCl concentrations above 10 %, the TF-FlaB fragment is still integrated into the polymeric structure. At 7–8 % NaCl, it acquires the monomeric state maintaining structural integrity. According to gel filtration chromatography, the molecular weight of TF-FlaB is approximately 30 kDa. The microcalorimetric
66 M
1
2
3
4
5
6
7
8
9
10
Fig. 3 SDS-PAGE of H. marismortui archaella samples isolated from FlaA2 and FlaB strains grown in liquid media at different temperatures and salinities. Tracks: 1 FlaA2 (40 °C, 20 % salinity); 2 FlaB (40 °C, 20 % salinity); 3 FlaA2 (40 °C, 25 % salinity); 4 FlaB (40 °C, 25 % salinity); 5 FlaA2 (40 °C, 30 % salinity); 6 FlaB (40 °C, 30 % salinity); 7 FlaA2 (50 °C, 25 % salinity); 8 FlaB (50 °C, 25 % salinity); 9 FlaA2 (50 °C, 30 % salinity); 10 FlaB (50 °C, 30 % salinity); M, protein marker (kDa)
analysis (Privalov and Potekhin 1986) of the fragment revealed the presence of a single peak of heat absorption (Fig. 6). It was shown that at NaCl concentrations above
123
346
Extremophiles (2014) 18:341–349
80 M
1
2
3
4
5
6
7
Fig. 4 Presence of FlaB archaellin in samples of archaella isolated from H. marismortui cultures grown at different conditions detected by Western blotting. The primary antibody raised against the FlaB filaments was used at a dilution of 1:1000. Tracks: 1 FlaB (40 °C, 25 % salinity); 2 FlaA2 (40 °C, 20 % salinity); 3 FlaA2 (40 °C, 25 % salinity); 4 FlaA2 (40 °C, 30 % salinity); 5 FlaA2 (50 °C, 25 % salinity); 6 FlaA2 (50 °C, 30 % salinity); 7 FlaA2 (27 °C, 25 % salinity); M, protein marker (kDa)
7 %, TF-FlaB retains the tertiary structure and melts as a structural unit (data not shown). In 20 % NaCl solution its thermostability increases, but remains lower than in archaella (Fig. 6), which indicates additional stabilization of the polymer structure through cooperative interactions. Using the methods of N-terminal sequencing and mass spectrometry, we determined that TF-FlaB corresponds to the 175–454 amino acid residues of the FlaB archaellin sequence. The calculated molecular weight (28.98 kDa) is consistent with the gel filtration data. It is noticeable that the molecular weights of halophilic archaellins determined by SDS-gel electrophoresis commonly overestimate those expected from the gene sequences (Pyatibratov et al. 2008; Syutkin et al. 2012). This is due to the high content of acidic amino acids of halophilic proteins, which can decrease SDS binding and result in slower migration of proteins in gels (Matagne et al. 1991) and archaellin glycosylation (Jarrell et al. 2013). Unfortunately, we were unable to isolate a similar structural domain of FlaA2, because its products were highly aggregated after trypsinolysis. However, based on the similarity of proteolysis patterns and melting curves of FlaA2 and FlaB (Pyatibratov et al. 2008), we suppose that both archaellins have a similar domain organization. At present, crystal archaellin structures are not yet known. The archaella structures reconstructed from the analysis of cryoelectronic images have relatively low resolution. One of the problems encountered while trying to crystallize archaellins is the high tendency to aggregation because of the highly hydrophobic N-termini. As a rule, strong detergents and denaturants, destroying the tertiary structure, are used to obtain archaellins in a monomeric form (Fedorov et al. 1994; Syutkin et al. 2012). For the first time, we have been able to isolate a lengthy (about twothirds of the full molecule) archaellin fragment, which includes a domain preserving the structural organization. We consider TF-FlaB as a promising object for crystallization.
123
66
29
1
2
3
Fig. 5 SDS–PAGE of FlaB archaella after treatment with trypsin (14 % acrylamide gel). Pellet (lane 1) and supernatant (lane 2) prepared after high speed centrifugation of trypsin-treated FlaB archaella in 10 mM Tris–HCl, pH 7.5, containing 7.5 % NaCl and 10 mM MgCl2. TF-FlaB fragment isolated using gel filtration chromatography (lane 3). M, marker (kDa)
Fig. 6 Temperature dependence of partial heat capacity of the isolated tryptic fragment TF-FlaB and FlaB and FlaA2 archaellar filaments in 20 % NaCl, 10 mM MgCl2 and 50 mM Tris–HCl, pH 7.5
Bioinformatics analysis To find differences that support the notion of H. marismortui archaellin genes being ecoparalogs, we analyzed amino acid sequences of both archaellins using the ProtParam tool (Gasteiger et al. 2005). It is known that one of the characteristics of halophilic proteins is a reduced value of their isoionic points and the predominance of acidic amino acids over basic. In our case, we can see that the FlaB archaellin is more acidic and thus more adapted to the conditions of high salinity (Table 2). The aliphatic index (AI) is a characteristic which positively correlates with protein thermal stability (Ikai 1980). However, in the case
Extremophiles (2014) 18:341–349
347
of archaellins this value is even higher for FlaB archaellin, which did not agree with the microcalorimetry data. It has been demonstrated that disordered regions play an important role in the adaptation mechanism to challenging environmental conditions (Nilsson et al. 2011; Pietrosemoli et al. 2013). On the other hand, the highest propensities to move and change the packing belong to flexible/disordered residues. Therefore the consideration of disordered/flexible regions for studied proteins is very important for describing the structural characteristics of proteins. One should expect that monomers of FlaA2 and FlaB possess flexible/disordered structures allowing the formation of sufficient close stable filaments. Flexible regions will be disordered in a monomer, but will form a structure (or be ordered) upon formation of filaments. For reliable prediction of the location of flexible/disordered regions, it is better to use several programs employing different principles (Ferron et al. 2006). Here, we utilize the stand-alone software IsUnstruct (Lobanov and Galzitskaya 2011) based on the Ising model as well as meta servers PONDR-FIT (Xue et al. 2010), which combine the results of multiple disorder predictors, for analysis of the FlaA2 and FlaB sequences. All two prediction programs report very similar order/disorder Table 2 Comparison of some properties of mature (without signal peptide) FlaA2 and FlaB archaellins computed from their amino acid sequences Archaellin
AI
pI
(Asp ? Glu)/ (Arg ? Lys)
FlaA2
83.84
3.61
5
FlaB
85.09
3.39
7.9
Fig. 7 IsUnstruct (black circles) and PONDR-FIT (white circles) analysis of FlaA2 (a) and FlaB (b) sequences. Both IsUnstruct and PONDR-FIT scores run from 0 to 1 with values below 0.5 generally
trends over the entire sequence (Fig. 7). The two programs indicate that the biggest difference between FlaA2 and FlaB lies at positions 250–300; these residues are unfolded for FlaA2 and somewhat folded for FlaB sequences. This is consistent with the fact that there are highly variable regions in the central part of the considered archaellins. From this analysis, we can conclude that the FlaA2 monomer molecule is more flexible (75 % of residues are predicted as disordered/flexible) than FlaB (63 %). The comparison of the occurrence of 20 amino acids shows that the main difference is observed for glycine residues: about 9.7 % (44 residues) for the FlaB monomer and 11.9 % (55 residues) for FlaA2. Such a difference can be the reason that the FlaA2 monomer is more flexible than the FlaB monomer, and the Gly residues allow realization of a more tight packing of monomers in the filament structure than other residues. From the thermodynamic analysis, two heat absorption peaks were obtained. It has been demonstrated that the archaellar filaments (especially FlaA2) retained the distinct and characteristic helical shape when heated to 90 °C (Pyatibratov et al. 2008). Moreover, it has been demonstrated that after heating the FlaA2 filament to 75 °C and the FlaB filament to 60 °C (cooperative melting corresponding to peak 1), both archaellins lost their resistance to proteases. This means that the structure of FlaA2 filaments is more stable than that of FlaB filaments. Such transition can be compared with the transition from globular protein structure to molten globule (Ptitsyn 1995), i.e., in this state some sites of the protein are available for proteases (Ptitsyn 1995). The second peak corresponds to the melting of a globular domain of the TF-FlaB fragment.
indicating ordered/folded regions and above 0.5 intrinsically unfolded/disordered regions
123
348
Discussion The concept of prokaryotic adaptation to the fluctuating environment by ecoparalogs is relatively new and still not widely confirmed experimentally. In this paper we demonstrate that H. marismortui archaellin genes are ecoparalogs and the adaptation mechanism is rather different from that for rRNA operons. We have demonstrated that H. marismortui strains, FlaA2 and FlaB, actually are a wild-type and plasmid pNG100 deficient strain, accordingly. Since FlaB synthesis in the wild-type strain is suppressed in comparison to the plasmid-deficient strain, it is likely that some of the 36 predicted proteins encoded by the pNG100 plasmid could be negative regulators of FlaB biosynthesis. Interestingly, one of these 36 proteins (the pNG1015 gene product) is annotated as a transcriptional regulator. However, the mechanism responsible for suppression of the FlaB archaellin biosynthesis remains unknown. The analysis of cell motility on semisolid agar medium showed that the FlaA2 archaellin provides motility under conditions in which FlaB archaellin cannot (high temperature/low salinity). Moreover, no archaella could be isolated from cells growing in liquid under conditions when cells lost motility on semisolid media. We have found that this effect results from the FlaB archaellin’s inability to form archaella at these conditions. At the same time, the results of archaella isolation demonstrated that cell motility on semisolid media was not fully correlated with archaella yield from cells grown in liquid media under the same conditions. The archaella yield generally was higher for the FlaA2 strain. These facts indicate that the archaellin genes are differentially regulated. Furthermore, we have found that the FlaB cells demonstrate a significantly higher motility under medium temperature and salinity conditions (40 °C, 30 %). The data suggest that the FlaA2 cells are better adapted to more severe conditions of high temperature/low salinity, while the FlaB cells have an advantage with increasing salinity. This supports the notion that the archaellin genes are ecoparalogs. Unlike the previously described mechanism for H. marismortui rRNA operons, when the transcription level gradually changed depending on external conditions, in the case of archaellin there are two ultimate situations when archaella are formed either from FlaA2 or FlaB archaellin. Thus, the pNG100 plasmid carrying the flaA2 gene acts as a ‘‘switch’’. This difference may be explained by the fact that the archaellum is an extracellular structure and is exposed to the environment, while the molecules functioning within the cell are in more stable homeostatic conditions. In this connection, it is interesting to consider another major H. marismortui surface protein-S-layer glycoprotein. The genome of closely related Haloarcula hispanica contains
123
Extremophiles (2014) 18:341–349
only one gene encoding S-layer glycoprotein (Hah 1601), while in H. marismortui there are two S-layer glycoprotein genes: one of them (rrnAC0971) is located on the chromosome and is homologous to Hah 1601, and the other is located on the pNG500 plasmid (pNG5138). It was shown that pNG5138 was the major cell wall protein of H. marismortui (Calo et al. 2011). Based on this, we propose that H. marismortui S-layer proteins may be two ecoparalogs such as archaellins. Recent studies have shown that horizontal gene transfer is fairly widespread among halophilic archaea (Williams et al. 2012). It was revealed that under natural conditions, haloarchaea are capable of both intraspecific and interspecific gene exchange leading to the formation of recombinant hybrids (Naor et al. 2012). It is likely that in natural environment, different coexisting H. marismortui strains can lose the plasmid or transmit it to each other. Under certain circumstances related to the seasonal cycles of temperature and salinity in the Dead Sea (Bodaker et al. 2010), the advantage is given to one or the other strain. As already mentioned above, the H. marismortui archaellins were not included in the list of possible candidates for ecoparalogs (Sanchez-Perez et al. 2008), possibly due to the fact that the multiple archaellin genes are a key feature for Archaea. Earlier it was shown that for some archaea, at least two archaellins encoded by different genes are necessary to form a functional helical filament (Tarasov et al. 2000; Bardy et al. 2002; Chaban et al. 2007). At the same time, recently it was shown that some of the archaea retain normal motility and functional archaella after knockout of one of the two archaellin genes (Tripepi et al. 2013). Here, we show for the first time that the multiplicity of archaellin genes may also be associated with the adaptation to changing environmental conditions. Acknowledgments The reported study was partially supported by RFBR, research projects N°. 14-04-31621 mol_a and N°. 14-0400517-a . A. S. S. was supported by a FEBS Collaborative Experimental Scholarship for Central & Eastern Europe, O. V. G. was supported by the Russian Academy of Sciences (programs ‘‘Molecular and Cell Biology’’ (Grant no. 01201353567) and ‘‘Fundamental Sciences to Medicine’’). The authors are grateful to A. K. Surin for mass spectrometry and E. I. Tiktopulo for microcalorimetric measurements. The authors confirm that all performed experiments comply with the current laws of the country in which they were performed. Conflict of interest of interest.
The authors declare that they have no conflict
References Alam M, Oesterhelt D (1984) Morphology, function and isolation of halobacterial flagella. J Mol Biol 176:459–475 Baliga NS, Bonneau R, Facciotti MT, Pan M, Glusman G, Deutsch EW, Shannon P, Chiu Y, Weng RS, Gan RR, Hung P, Date SV,
Extremophiles (2014) 18:341–349 Marcotte E, Hood L, Ng WV (2004) Genome sequence of Haloarcula marismortui: a halophilic archaeon from the Dead Sea. Genome Res 14:2221–2234 Bardy SL, Mori T, Komoriya K, Aizawa S, Jarrell KF (2002) Identification and localization of flagellins FlaA and FlaB3 within flagella of Methanococcus voltae. J Bacteriol 184:5223–5233 Bodaker I, Sharon I, Suzuki MT, Feingersch R, Shmoish M, Andreishcheva E, Sogin ML, Rosenberg M, Maguire ME, Belkin S, Oren A, Be´ja` O (2010) Comparative community genomics in the Dead Sea: an increasingly extreme environment. ISME J 4:399–407 Calo D, Guan Z, Naparstek S, Eichler J (2011) Different routes to the same ending: comparing the N-glycosylation processes of Haloferax volcanii and Haloarcula marismortui, two halophilic archaea from the Dead Sea. Mol Microbiol 81:1166–1177 Chaban B, Ng SY, Kanbe M, Saltzman I, Nimmo G, Aizawa S, Jarrell KF (2007) Systematic deletion analyses of the fla genes in the flagella operon identify several genes essential for proper assembly and function of flagella in the archaeon, Methanococcus maripaludis. Mol Microbiol 66:596–609 Charlebois RL, Lam WL, Cline SW, Doolittle WF (1987) Characterization of pHV2 from Halobacterium volcanii and its use in demonstrating transformation of an archaebacterium. Proc Natl Acad Sci USA 84:8530–8534 Fedorov OV, Pyatibratov MG, Kostyukova AS, Osina NK, Tarasov VY (1994) Protofilament as a structural element of flagella of haloalkalophilic archaebacteria. Can J Microbiol 40:45–53 Ferron F, Longhi S, Canard B, Karlin D (2006) A practical overview of protein disorder prediction methods. Proteins 65:1–14 Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, Bairoch A (2005) Protein identification and analysis tools on the ExPASy server. In: Walker JM (ed) The proteomics protocols handbook, Humana Press, Totowa, NJ, pp 571–607 Gerl L, Deutzmann R, Sumper M (1989) Halobacterial flagellins are encoded by a multigene family. Identification of all five gene products. FEBS lett 244:137–140 Hecht A, Gertman I (2003) Dead Sea meteorological climate. In: Nevo E, Oren A, Wasser SP (eds) Fungal life in the Dead Sea. A.R.G. Gantner, Ruggell, pp 68–114 Ikai A (1980) Thermostability and aliphatic index of globular proteins. J Biochem 88:1895–1898 Jarrell KF, Albers SV (2012) The archaellum: an old motility structure with a new name. Trends Microbiol 20:307–312 Jarrell KF, Ding Y, Nair DB, Siu S (2013) Surface appendages of archaea: structure, function, genetics and assembly. Life 31:86–117 Lobanov MYu, Galzitskaya OV (2011) The Ising model for prediction of disordered residues from protein sequence alone. Phys Biol 8:035004 Lobanov MY, Sokolovskiy IV, Galzitskaya OV (2013) IsUnstruct: prediction of the residue status to be ordered or disordered in the protein chain by a method based on the Ising model. J Biomol Struct Dyn 31:1034–1043 Lopez-Lopez A, Benlloch S, Bonfa M, Rodriguez-Valera F, Mira A (2007) Intragenomic 16S rDNA divergence in Haloarcula marismortui is an adaptation to different temperatures. J Mol Evol 65:687–696
349 Matagne A, Joris B, Frere JM (1991) Anomalous behavior of a protein during SDS/PAGE corrected by chemical modification of carboxylic groups. Biochem J 280:553–556 Naor A, Lapierre P, Mevarech M, Papke RT, Gophna U (2012) Low species barriers in halophilic archaea and the formation of recombinant hybrids. Curr Biol 22:1444–1448 Ng SY, Chaban B, Jarrell KF (2006) Archaeal flagella, bacterial flagella and type IV pili: a comparison of genes and posttranslational modifications. J Mol Microbiol Biotechnol 11:167–191 Nilsson J, Grahn M, Wright AP (2011) Proteome-wide evidence for enhanced positive Darwinian selection within intrinsically disordered regions in proteins. Genome Biol 12:R65 Pietrosemoli N, Garcı´a-Martı´n JA, Solano R, Pazos F (2013) Genome-wide analysis of protein disorder in Arabidopsis thaliana: implications for plant environmental adaptation. PLoS One 8:e55524 Privalov PL, Potekhin SA (1986) Scanning microcalorimetry in studying temperature-induced changes in proteins. Methods Enzymol 131:4–51 Ptitsyn OB (1995) Molten globule and protein folding. Adv Protein Chem 47:83–229 Pyatibratov MG, Beznosov SN, Rachel R, Tiktopulo EI, Surin AK, Syutkin AS, Fedorov OV (2008) Alternative flagellar filament types in the haloarchaeon Haloarcula marismortui. Can J Microbiol 54:835–844 Sanchez-Perez G, Mira A, Nyiro G, Pasic´ L, Rodriguez-Valera F (2008) Adapting to environmental changes using specialized paralogs. Trends Genet 24:154–158 Southam G, Kalmokoff ML, Jarrell KF, Koval SF, Beveridge TJ (1990) Isolation, characterization, and cellular insertion of the flagella from two strains of the archaebacterium Methanospirillum hungatei. J Bacteriol 172:3221–3228 Steinhorn I (1997) Evaporation estimate for the Dead Sea: essential considerations for saline lakes. In: Niemi TM, Ben-Avraham Z, Gat J (eds) The Dead Sea. The lake and its setting. Oxford University Press, Oxford, NY, pp 122–132 Syutkin AS, Pyatibratov MG, Beznosov SN, Fedorov OV (2012) Various mechanisms of flagella helicity formation in haloarchaea. Microbiology Russ 81:573–581 Tarasov VY, Kostyukova AS, Tiktopulo EI, Pyatibratov MG, Fedorov OV (1995) Unfolding of tertiary structure of Halobacterium halobium flagellins does not result in flagella destruction. J Prot Chem 14:27–31 Tarasov VY, Pyatibratov MG, Tang SL, Dyall-Smith M, Fedorov OV (2000) Role of flagellins from A and B loci in flagella formation of Halobacterium salinarum. Mol Microbiol 35:69–78 Tripepi M, Esquivel RN, Wirth R, Pohlschro¨der M (2013) Haloferax volcanii cells lacking the flagellin FlgA2 are hypermotile. Microbiology 159:2249–2258 Williams D, Gogarten JP, Papke RT (2012) Quantifying homologous replacement of loci between haloarchaeal species. Genome Biol Evol 4:1223–1244 Xue B, Dunbrack RL, Williams RW, Dunker AK, Uversky VN (2010) PONDR-FIT: a meta-predictor of intrinsically disordered amino acids. Biochim Biophys Acta 1804:996–1010 Zilm PS, Mira A, Bagley CJ, Rogers AH (2010) Effect of alkaline growth pH on the expression of cell envelope proteins in Fusobacterium nucleatum. Microbiology 156:1783–1794
123
