Guidelines of Clinical Biochemistry Practical Manual

Clinical Biochemistry Practical Manual
College of Medicine






Al Imam Mohammad Ibn Saud Islamic University
King Abdullah City for Female Students












Contents

S.No.
Title
1.
General lab safety
2.
Working with Concentrated acids and bases
3.
Working with electrical equipments
4
Qualitative test for the detection of carbohydrates
5
Glucose estimation
6
Cholesterol estimation
7.
Protein estimation
8.
Urea estimation
9
Detection of Cytokines in serum using ELISA
10
Polyacrylamide gel electrophoresis for determining molecular weight of protein
(SDS-PAGE)














Introduction
Safety in the biochemistry laboratory involves a cautious attitude and an awareness of potential hazards. Usually potential accidents can be anticipated and prevented. If safety precautions are followed, fewer accidents will occur. The number of laboratory accidents can be reduced if every student follows all of the directions given for the experiment and by the instructor. Special note should be taken of specific instructions that are given in an experiment to eliminate recognized potential hazards.

Guidelines for Lab safety

Locate the safety equipment. Find the eyewash, safety shower, fireextinguishers, first-aid kit and all exits that are to be used in an emergency
Protect your eyes. Eye protection (safety goggles) is to be worn at all timeswhile working in the laboratory room.
Long hair needs to be pulled back.
Shoes worn to lab must cover your feet completely. Since broken glass and spilled chemicals are all too common occurrences in lab, your feet will need moreprotection than that afforded by open-toed shoes or sandals. No open- toed shoes,
no crocs.
Students must be dressed properly for lab. Wear clothes that will provide you with the maximum protection and coverage as possible. Wearing white lab coat is recommended while you are working in the lab.Wearing shorts is not allowed.
Food and drinks are not allowed in the laboratory room.
Do not taste any chemical. To prevent the entry of any chemical substance intoyour mouth, it is best not to put any object in your mouth such as pens, pencils or fingers in the laboratory room. After lab is finished, hands should be washed with soap before leaving the lab.
Do not smell chemicals directly. Use your hand to waft the odor to yournose if you are directed to note an odor in an experimental procedure.
When dealing with any biological material or chemical, take all necessary precautions toavoid skin contact, use adequate equipment and ventilation, and treat all samples withextreme care.
Wear gloves when working with the samples and chemicals.
Report all chemical spills to your laboratory instructor.clean up all solid and liquid spills immediately.
Do not pour any chemicals into the sink or dispose of anychemicals in the trash without prior authorization.
Beakers should be used to obtain stock materials. If, whendispensing stock solutions you obtain too much, do not return excessstock solutions back into the stock solution containers. This willcontaminate the stock solution.
Read the label on all stock solutions and chemicals carefully.
Do not insert a dropper or pipet into a stock solution container.Pour a small amount of the stock solution into a beaker and then insert your dropper or pipetinto the beaker.
Take no more of a chemical than the experimental procedure requires. Carefully read the procedure and determine the quantity of each stock solutionand/or chemical you need. Obtain only that amount. If you take too much, share it with yourneighbor. Never return the excess to the stock chemical bottle.
Do not put paper or solid waste into the sinks.
Material safety data sheets (MSDS) are available for all chemicals used in the laboratory. Read them carefully
Report any injury, no matter how slight, to your instructor.
If you have any health conditions, which may impact your presence or work in the lab, inform the instructor.







Working with concentrated Acids and Bases
Concentratedacids and bases can provoke burns of skin, mucousmembranes and eyes. Therefore if you use concentrated acids and bases (NaOH, KOH,H2SO4, HNO3, Acetic acid etc.), you should observe the following rules:
Do not measure solutions of the bases and acids with a mouth pipette. Do itonly with a measuring test tube or a burette.
Do not keep a vessel with the base or acid near your eyes.
Do not pour water to acid (especially to H2SO4) when you prepare an acid solution instead pour acid to water slowly in a fume hood.
If base or acid gets on your skin, mucous membrane or especially eyesyou should bathe the affected place in running water for 10 - 15 minutes and then see a physician.

Working with electrical equipment and apparatus

Be careful when you work with electric equipment to avoid an electric shock. Observe the following rules:
Do not touch the naked electric wires.
Do not work with unearthed apparatus.
Do not pull out an electric wire, when you switch off an electric apparatusfrom the electric network. Do it only with an electric plug.
Do not touch a water pipe, a tap, and a heating radiator when you work withelectric apparatus.
If somebody gets an electric shock you should immediately switch offelectric power and only after that help him.






How you write your Laboratory Reports
Laboratory reports are not written in the style of popular literature, or a review article -- they are written to convey complex information in a direct, unambiguous way. If you read a scientific paper based on original research, you will be struck by the number of short, simple, declarative statements which are intended to convey complex information in a way which will not be misunderstood.
If you feel you must ask a question in your report reword it into a statement. Use past tense when writing since everything that you write about has already occurred. When a scientific term exists use it in place of a colloquial term or scientific jargon. When in doubt use numbers to describe things. Assume your reader knows very little about the work that you did, since you will never know the backgrounds of the people that want to read about your work.
Parts of the Paper
I) The TITLE and your name
II) ABSTRACT - Describe the results and significance of the laboratory in 300 words or less.
III) INTRODUCTION - What is the biological problem that you researched, and why is this problem important? This should be brief.
IV) MATERIALS AND METHODS - What living things, chemical reagents, apparatus, and techniques did you use? Do Not make lists of materials and/or methods, but Do write this section in Paragraph Form. Do Not write about every detail, but Do write enough so that the reader can understand what you did.
Briefly answer the question; What techniques did I use? For instance say "I precipitated protein by adding solid ammonium acetate to make the solution 250 mM in acetate." rather than "We measured the volume of our solution and added XYZ g of solid ammonium acetate as referenced in Table 31 'precipitation of proteins with ammonium sulfate' of Dr. Doolittle's Book of Tables for Protein Chemistry (5)." Notice that the important thing about the above example is that the procedure "...by adding solid ammonium acetate to make the solution 250 mM in acetate." and the purpose of the procedure "I precipitated protein..." were both included.
V) RESULTS (What data was generated from the experiment(s) or what are THE FACTS) - No part of your report is as important as YOUR DATA! I WILL BE PICKY IN THIS SECTION! All figures and tables are referred to in this section. All mention of measured or calculated values should have units unless unitless. This is the only section which can contain tables and graphs. I will be especially diligent in this section! Below is a checklist.
___Figures are pictures, diagrams or graphs. Tables list alphanumeric data in rows and columns. Tables and Figures are not the same thing!
___Metric Units will be used in figures, tables and the text.
___All tables and figures will be cited in the text of the results section and numbered in the order in which they are discussed. For example... Table 1 shows the results of the Bradford protein assay of the liver tissue extracts, and table 2 shows the molecular weights of the more abundant proteins of these extracts.
___Each figure should be labeled with a title and number below the figure and a figure legend in the figure.
___You will draw all graphs (figures) by hand to show me that you understand how to make a graph.
___Every graph axis will be labeled.
___Each table should be labeled with a title, and number above the data in the table.
___Each table column and row will be labeled.
___Every graph axis should be linear unless labeled as nonlinear.
___Every graph axis should be divided into labeled units.
___No data analysis is allowed in this section!
Examples of figures
vege1 ATGCATGCATGCATGCATGCATGCATTTCGGC
lubdub1 ATGCATGCGAGAGAGCATGCATGCATGCATGC
Figure 1. Sequence comparison of celery heart cDNA clone vege1 and human myocardium cDNA clone lubdub1. Regions of homology between the two sequences
VI) Discussion (Conclusion) - This is the place for you to analyze (contemplate) what your data means. What did the experiments ultimately show? Analyze your data whether you expected the results you obtained or not. Do Not restate the data but Do explain what you believe the data means. This is the final statement concerning the experiment(s) performed and analyzed, and you will explain the significance of the work! For example... The data from the mutagen experiment shows that UV light is a more effective mutagen than an equal amount of visible light. A discussion and a conclusion are the same thing (don't have both).
VII) Citations (Works Cited) - List all written works that helped you to write the report. For your reports, there should be very few of these. Cite the works in the body of the report. I will except any format for citations as long as they are complete [author(s), Title, Source, Year, Publisher].
Technical points
All the major parts of the paper [Intro., Mater. & Methods, Results, Discussion and Citations] will have a labeled heading.
Assume the reader of your paper is unfamiliar with the subject and must be introduced to the basic research problem and methodology of the paper. [If you were to give your report to an intelligent person and have them read it, would they be able to "follow along" or would they be "lost"? You may be amused that this writing problem is common among scientists who assume "Everyone knows this already".]
When in doubt, use a scientific term instead of a common English term.
Remove all questions from your report, or reword them as declarative statements.
All adjectives which have vague meanings Will Not be used in the report.
Slang and jargon (professional slang) Will Not be used in the report.
Abbreviations Will Not be used Unless they are commonly used in biology, such as oC, hr, min, kg, KD, bp, OD, etc.
The report should be long enough to explain the purpose, methods, data and analysis of the experiment(s), approximately 3 to 5 pages of 12 point double spaced text not counting figures and tables.