Parasite Immunology, 2007, 29, 445– 453
DOI: 10.1111/j.1365-3024.2007.00961.x
GRA7 provides protective immunity in cocktail DNA vaccines against Toxoplasma gondii
Immunogenicity ORIGINAL ARTICLES in a low Blackwell Publishing Ltddose cocktail DNA vaccine
E. JONGERT,1 S. DE CRAEYE,2 J. DEWIT1 & K. HUYGEN3 1
Toxoplasma Research Unit, 2Toxoplasma Diagnostic Unit, Laboratory for Toxoplasmosis, 3Laboratory of Mycobacterial Immunology, WIV-Pasteur Institute of Brussels (Federal Service of Public Health), Brussels, Belgium
SUMMARY
INTRODUCTION
In a previous study, single-gene vaccination with GRA1, GRA7 or ROP2 was shown to elicit partial protection against Toxoplasma gondii. In this study, the contribution of each antigen in the evoked humoral and cellular immune responses was evaluated after vaccination with plasmid mixtures containing GRA1, GRA7 and ROP2. Cocktail DNA vaccinated mice developed high antibody titers against the antigens from twogene DNA vaccine cocktails, but lower titres when immunized with the three-gene cocktail. High numbers of IFN-γ secreting splenocytes were generated predominantly against GRA7. Brain cyst burden was reduced by 81% in mice vaccinated with the three-gene mixture and they were completely protected against acute toxoplasmosis. Similar high levels of brain cyst reductions were obtained after vaccination with cocktails composed of GRA1 and GRA7 (89% reduction), or GRA7 and ROP2 (79% reduction), but not with the cocktail composed of GRA1 and ROP2. In low dose single-gene vaccinations, IFN-γ and strong protection could only be elicited by GRA7. Hence, the presence of GRA7 in the DNA vaccine formulation was important for optimal protection and this was correlated with GRA7-specific IFN-γ production. We propose GRA7 as a main component in cocktail DNA vaccines for vaccination against T. gondii.
The protozoan parasite Toxoplasma gondii is the causative agent of a worldwide zoonosis and it is estimated that onethird of the human world population is infected with this parasite (1). In humans, resolution of the infection occurs through the induction of strong and persistent cell mediated immunity that results in the control of T. gondii (2,3). However, as the immune system is able to control the parasite but not eliminate it from its host, this benign asymptomatic infection may reactivate under conditions of immunosuppression resulting in Toxoplasma encephalitis and other complications. The most important group of individuals at risk are pregnant women, in whom a primary infection during pregnancy leads to infection of the foetus and congenital toxoplasmosis. In recent years, visual impairment caused by toxoplasmic retinochoroiditis has been gaining importance in the pathologies induced by T. gondii, either as a consequence of congenital or acute infection (4). The major sources of T. gondii infection in humans are through oral contact with shedded parasite oocysts from cats or through consumption of infected meat (5). Reports have indicated that a high proportion of meat products were contaminated with T. gondii (6), and that a major risk of infection is associated with meat from animal-friendly production systems (7). Consumption of undercooked meat is perceived by pregnant women as a major source of infection (8). The fact that in humans a primary infection with the parasite before pregnancy provides complete protection against congenital toxoplasmosis has been the basis for the development of vaccines against T. gondii. Plasmid DNA vaccination against T. gondii is a potent strategy for the induction of protective cellular immune responses. The family of candidate vaccine antigens now includes T. gondii membrane associated surface antigen SAG1 (9,10), excreted–secreted dense granule proteins GRA1 (11,12), GRA4 (13) and GRA7 (12), rhoptry proteins ROP1 (14) and ROP2 (12,15) and micronemal proteins (16). In chronically infected individuals, T-cell responses can be observed against GRA1, GRA7 and ROP2
Keywords cocktail DNA vaccine, GRA1, GRA7, interferon-γ, protection, ROP2, Toxoplasma gondii
Correspondence: E. Jongert, Toxoplasma Research Unit, WIV-Pasteur Institute of Brussels (Federal Service of Public Health), Engelandstraat 642, 1180 Brussels, Belgium (e-mail:
[email protected]). Received: 29 January 2007 Accepted for publication: 14 June 2007 © 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd
445
E. Jongert et al.
Parasite Immunology
(17–19), and human B-cell epitopes have also been identified for these three antigens (20 –22). Both CD4+ and CD8+ T cells play an important role in protection against the parasite, which is correlated to the production of the cytokine interferon-γ (IFN-γ) and a class I major histocompatibility complex restricted cytolytic CD8+ T-cell response both in mice and humans (11,23–25). We have previously reported that single-gene DNA vaccination with GRA1, GRA7 or ROP2 could induce partial protective immunity in C3H/ HeN mice, and that these responses were associated with a Th 1 type profile (12). In this study, we evaluated the elicited immune responses and protective efficacy of low dose mixtures of plasmid DNA encoding GRA1, GRA7 or ROP2. In order to identify the contribution of each antigen in protection, the threegene mixture was compared to combinations of two-genes and low dose single-gene DNA vaccines. We show here that twogene cocktail DNA vaccines are superior to single- and three-gene combinations in eliciting immune responses and that the presence of GRA7-specific IFN-γ production is important for protection.
MATERIALS AND METHODS Purification of DNA and preparation of DNA vaccine cocktails Empty vector VR1020, and plasmids VR1020-GRA1 (pGRA1), VR1020-GRA7 (pGRA7) and VR1020-ROP2 (pROP2), encoding the mature proteins of GRA1, GRA7 and ROP2 were produced in E. coli TOP10F′ and purified with the EndoFree Plasmid Giga kit (Qiagen GmbH, Hilden, Germany), as described previously (12). The formulation of the three-gene cocktail DNA vaccine was obtained by mixing 25 µg of each encoding plasmid, and bringing the volume to 100 µL with endotoxin-free PBS. The amount of DNA in the control formulation was 75 µg VR1020/100 µL. The single-gene and two-gene DNA vaccine mixtures, with 25 µg of each encoding plasmid DNA, were normalized for putative CpG motifs using empty control vector to achieve a total amount of 75 µg DNA/100 µL.
Quantitative real-time reverse transcription PCR Quantitative real-time reverse transcription PCR (QRT-PCR) was performed to determine transcription levels for selected genes in human embryo kidney cells (HEK 293T fibroblasts, purchased from ECACC) after transfection with cocktail DNA vaccine mixtures. HEK cells were grown in DMEM supplemented with 10% FCS, glutamine, essential amino acids and sodium pyruvate. All media and supplements were acquired from Gibco Invitrogen Life-Technologies (Paisley,
446
UK). The cells were transfected at 30%–40% confluency with 2 µg total DNA of single-gene-, two-gene- or three-gene DNA vaccine mixtures (as described above) using Lipofectamine (Invitrogen Life-Technologies, Paisley, UK) as instructed by the manufacturer. Two days after transfection, RNA was isolated with RNAeasy kit (QIAGEN GMBH, Hilden, Germany). Reverse transcription was performed with 500 ng total RNA, using specific reverse primers: GRA1 with primer RTG1R (GGGTTGCCTGTGGGTCT), GRA7 with RTG7R (CCGTCTCCAATGGCTCTCTT), ROP2 with RTR2R (GAGCATTCGTTCCGCTGTA) and ribosomal 18S with primer 18UR (GATAGTCAAGTTCGACCGTCTT), and the RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas GMBH, St Leon Rot, Germany). Obtained cDNA was diluted 500 times for amplification in a 25 µL mixture of iQ™ SYBR® Green Supermix (BIO-RAD, Hercules, CA) with specific primers: GRA1 was amplified with primers RTG1F (CGGGCGTCTCTCTTTGGTTT) and RTG1R, GRA7 with RTG7F (CCCGTTGACAGTCTCAGA) and RTG7R, ROP2 with RTR2F (GCGTGGTGGCGTGTTTTT) and RTR2R, and ribosomal 18S with 18UF (GTTGATTAAGTCCCTGCCCTTT) and 18UR. All reactions were performed in triplicate, and nontemplate reactions were included in the runs. For each sample, the target gene was amplified in parallel with the r18S nonregulated housekeeping control gene in separate wells. Amplification reactions were performed on an iCycler system (BIO-RAD, Hercules, CA). After completion of the amplification cycle, primer–dimers were excluded by melt curve analysis. QRTPCR data were analysed using a mathematical model described by Pfaffl (26), based on the PCR efficiencies and the mean threshold value (Ct) deviation between sample and control group where the ratio (R) = (Etarget)∆Ct target(control-sample)/(Eref) ∆Ct target(control-sample). The quantification was done relative to r18S transcripts.
Immunization of mice Female inbred C3H/HeN mice (H-2k) were purchased from Harlan (Horst, the Netherlands). All mice were kept under specific pathogen-free conditions in compliance with the Animal Care Committee from the Institute. From 7 weeks of age onwards, mice received three injections of 75 µg DNA (with a 3-week interval), divided over both tibialis anterior muscles. To obtain chronically infected mice, C3H/HeN mice were fed a sublethal dose of 20 brain cysts of T. gondii 76K, and used in the experiments 2–3 months after infection.
Challenge experiments Protection against chronic toxoplasmosis was evaluated by feeding a brain homogenate from Swiss mice containing 20
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445–453
Volume 29, Number 9, September 2007
T. gondii 76K cysts, to vaccinated C3H/HeN mice. From a 1·5 mL brain homogenate, at least three aliquots of 8 µL were taken. Each aliquot was counted for cysts (double blind) in a phase-contrast microscope. In unvaccinated C3H/HeN mice chronically infected with T. gondii 76K, brain cyst burden ranges from 2000 to 3000 cysts per brain. Protection against acute toxoplasmosis was evaluated by feeding a brain homogenate from Swiss mice containing 100 T. gondii 76K cysts. Survival was monitored for 30 days.
Immunogenicity in a low dose cocktail DNA vaccine
3, the culture supernatants were removed and kept at –20°C until the time of assay. IFN-γ production was measured by ELISA, as previously described (12). The level of IFN-γ obtained in ELISA was reflected in a Cytometric Bead Array kit (BD Pharmingen, Erembodegem, Belgium) on the supernatants of re-stimulation cultures. Production of other cytokines (IL-2, IL-4, IL-5 and TNF-α) could not be detected (data not shown).
IFN-γγ ELISPOT assay Purification of recombinant proteins and of toxoplasma lysate antigen Recombinant T. gondii proteins were purified by metal chelate affinity chromatography. The cloning and expression of his-tagged recombinant (r) GRA1, rGRA7 or rROP2 has been described elsewhere (27–29). The removal of endotoxin was performed as described elsewhere (27). After elution with imidazol, the rGRA1 eluate was dialyzed against endotoxin-free PBS (Cambrex, Verviers, Belgium). The rGRA7 and rROP2 proteins were dialyzed against endotoxinfree PBS, 0·01% SDS, 0·1 urea. Protein concentrations were determined with RC-DC Protein assay (Bio-Rad, Hercules, CA). Endotoxin levels were analysed with the QCL-1000 Chromogenic LAL Test Kit (Cambrex, Verviers, Belgium), and shown to be < 0·05 EU/µg for all obtained recombinant proteins. Recombinant proteins were checked by SDS-PAGE Silverstaining for purity. Antigenic validation was performed by Western blot against a pool of sera from five T. gondii-infected C3H/HeN mice (data not shown). Toxoplasma lysate antigen (TLA) was prepared from tachyzoites of the highly virulent T. gondii RH strain, which were obtained from the peritoneal fluid of infected Swiss mice, as described previously (11,12).
Antibody ELISA For determination of antibody isotype titres, rGRA1, rGRA7 or rROP2 were coated overnight at 4°C at 10 µg/mL in bicarbonate buffer in NUNC Immunosorb 96-well plates (Nunc, Roskilde, Denmark). ELISA was performed as described previously (27). Endpoint titres were defined as the dilution where the optical density (OD) exceeded the OD of the preimmune serum by a factor of 3.
IFN-γγ ELISA Splenocytes (3 × 106 cells/mL) were re-stimulated with recombinant GRA1, rGRA7 or rROP2 (5 µg/mL), TLA(20 µg/mL) or ConA (2·5 µg/mL) and cultured in 24-well plates (Nunc, Roskilde, Denmark). Three mice were sacrificed per group and individually re-stimulated. On day
Three mice were euthanized per group, 4 weeks after the last immunization, single-cell splenocyte suspensions were prepared and individually re-stimulated with rGRA1, rGRA7, rROP2, TLA or ConA. IFN-γ ELISPOT was performed as described elsewhere (30). Data are represented as spotforming cells per million splenocytes (SFC/106 cells).
Statistical analysis For evaluation of transcript ratios in QRT-PCR, IFN-γ ELISA and ELISPOT data or differences in brain cyst burden, statistical analysis was performed with one-way and Bonferroni post-tests. Differences in survival curves were calculated with the Log-rank test. Statistical analysis and graphics were carried out with P 4 software (GraphPad, San Diego, California).
RESULTS Expression of GRA1, GRA7 and ROP2 from cocktail DNA vaccines in mammalian cells To evaluate antigen production from the various cocktail DNA vaccines, HEK cells were transfected with these mixtures and their mRNA levels were determined by QRTPCR. Compared to transcript levels of the r18S gene, transcription of GRA1, GRA7 and ROP2 was 103–104 fold higher (Figure 1). Transcription of GRA1 remained unchanged in any combination, except when combined with ROP2 where it increased sixfold. Compared to the GRA7 transcript from the single-gene DNA vaccine, transcription of GRA7 was significantly lower in combination with GRA1 (16-fold lower), in combination with ROP2 (eightfold lower) or in the three-gene combination (fivefold lower). Transcription of GRA7 was not significantly different between two-gene or three-gene mixtures. For ROP2 an increase in transcription was observed when combined with GRA1 (13-fold) or GRA7 (fivefold), but these increases did not reach statistical significance. Additional two-way analysis with Bonferroni post tests showed that transcript levels of target genes within a given mixture were not significantly different from each
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445– 453
447
E. Jongert et al.
Parasite Immunology
cocktail DNA vaccine, the pGRA1 and pGRA7 single-gene DNA vaccines, or infection with T. gondii. When the 3 genes were combined, obtained antibody titers were lower than those from infection with T. gondii. Titers elicited by pROP2 declined when combined with one- or two-genes in a cocktail vaccine. Combination of pGRA1 with another gene enhanced antibody responses to rGRA1. Presence of pGRA7 seemed to have a positive influence on titers against the antigen it was combined with. In contrast, when pROP2 was combined with pGRA7, this seemed to have a negative influence on titers against rGRA7. The combination of pGRA1 + pGRA7 elicited the strongest antibody responses. For single-gene vaccines with 25 µg encoding DNA, a high IgG2a/IgG1 ratio indicating a Th1 response was observed, corroborating earlier results with 100 µg single-gene vaccines (12). Combining DNA vaccines resulted in high or mixed IgG2a/IgG1 ratios against the vaccine antigens included in a formulation. Figure 1 Relative expression of GRA1, GRA7 or ROP2 in comparison to ribosomal 18S reference gene in QRT-PCR. Expression of antigens was assessed after transient transfection of HEK cells with the indicated DNA vaccine cocktails. Data represent the mean ratio of selected target gene transcript over r18S transcript from three independent experiments with SD. Statistical analysis was performed with a one-way with Bonferroni post tests (*P < 0·05, **P < 0·01) to compare transcript levels of a target antigen between multiple formulations.
other, except in the pGRA1 + pROP2 formulation (P < 0·05). In general, no significant differences in transcription could be observed between single-gene, two-gene or three-gene cocktail DNA vaccines. Expression of GRA1 and GRA7 protein could be confirmed by Western blotting of lysates from the transfected HEK cells with sera from a mouse infected with T. gondii 76K (data not shown). ROP2 could not be detected by Western blot. Others have reported difficulties to detect ROP2 protein (15).
Strong antibody responses are elicited by two-gene cocktail DNA vaccines To evaluate the immunogenicity of the cocktail DNA vaccines, C3H/HeN mice were immunized with a low dose single-gene, two-gene or a three-gene cocktail DNA vaccine, the empty vector, or were chronically infected with T. gondii 76K. One month after the last vaccination, mice were bled and antibodies against rGRA1, rGRA7 and rROP2 were determined in ELISA (Table 1). Overall, immunization with two-gene cocktail DNA vaccines elicited higher endpoint titers than the three-gene
448
IFN-γγ producing cells are mainly elicited against GRA7 To evaluate cellular immune responses, mice were immunized with low dose single-gene, two-gene or three-gene cocktail DNA vaccines or the empty vector, and euthanized 1 month after the last vaccination. Splenocytes were harvested for restimulation. Production of IFN-γ was measured by ELISA and IFN-γ producing cells were quantified by ELISPOT assay. Mice immunized with two-gene cocktail DNA vaccines containing pGRA7 produced moderate amounts of IFN-γ against rGRA7 and higher against TLA (Figure 2a). pGRA1 elicited low IFN-γ production only in the three-gene combination. Low IFN-γ responses against rROP2 were elicited by the pGRA1 + pROP2 mixture and by the 3-gene cocktail DNA vaccine, but not with pGRA7 + pROP2. Large numbers of IFN-γ producing cells were observed against rGRA7 and TLA in ELISPOT (Figure 2b). Here, the magnitude of the IFN-γ response against rGRA7 elicited by these cocktail DNA vaccines was undistinguishable from the response against the parasite lysate. No significant difference was found between numbers of IFN-γ producing cells in mice immunized with vaccine cocktails that contained pGRA7. Moderate numbers of IFN-γ producing cells were observed against rGRA1 in the pGRA1 + pGRA7 and three-gene combinations, and a weak response against TLA in the pGRA1 + pROP2 combination. Combination of pGRA1, pGRA7 and pROP2 in a three-gene cocktail DNA vaccine lowered somewhat the strength of the induced cellular immune response to rGRA7 and TLA in ELISPOT. With low dose single-gene vaccines, a weak IFN-γ production was only observed against rGRA7 and TLA in pGRA7 vaccinated mice (Figure 3). No IFN-γ producing cells could be detected in ELISPOT (data not shown).
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445–453
Volume 29, Number 9, September 2007
Immunogenicity in a low dose cocktail DNA vaccine
Table 1 IgG endpoint titers determined by ELISA against rGRA1, rGRA7 and rROP2 Endpoint titer against recombinant T. gondii antigens rGRA1 Groups of C3H/HeN mice immunized with:
DNA vaccinesd
a
T. gondii 76K pGRA1 + pGRA7 + pROP2b pGRA1 + pGRA7a pGRA1 + pROP2a pGRA7 + pROP2a pGRA1a pGRA7a pROP2a
rGRA7
rROP2
IgG2a
IgG1
Rc
IgG2a
IgG1
Rc
IgG2a
IgG1
Rc
9 600 2 160 72 960 26 880 0 14 900 0 0
600 16 800 18 240 12 480 n.d. 10 000 n.d. n.d.
16 0·1 4·0 2·2 – 1·5 – –
52 800 8 280 145 920 0 52 800 0 140 800 0
1 050 2 520 188 640 n.d. 15 660 n.d. 28 800 n.d.
50 3·3 0·8 – 3·4 – 4·9 –
1 350 900 0 3 000 11 640 0 0 21 200
375 960 n.d. 480 300 n.d. n.d. 2 000
3·6 0·9 – 6·3 38·8 – – 10·6
a
Data represent the average endpoint titer of five mice per group; bData represent the average endpoint titer from three independent experiments, with five mice per group; cR, ratio of IgG2a/IgG1 endpoint titers. n.d. = not determined; dAll mice seroconverted to the antigens they were vaccinated with. Naïve mice or mice vaccinated with the empty vector VR1020 did not develop antibodies to the recombinant antigens.
Mice chronically infected with T. gondii 76K were included in these assays as a positive control group and here a significant number of IFN-γ secreting cells and strong IFN-γ production was observed against rGRA1, rGRA7 or TLA, but less against rROP2.
Presence of GRA7 in the cocktail DNA vaccine is required for strong protection In a first set of challenge experiments, mice immunized with two-gene, three-gene cocktail DNA vaccines or the empty vector were challenged 1 month after the last vaccination by feeding a sublethal dose of 20 T. gondii 76K cysts. Brain cyst burden was evaluated 4 – 6 weeks after infection (Figure 4a). Parasite load dropped from 2288 ± 620 cysts per brain (cpb) (n = 7) in the control-vaccinated group to 440 ± 91 cpb (n = 7) in the three-gene cocktail DNA vaccinated group, a reduction of 81%. Mice vaccinated with pGRA1 + pGRA7 (n = 6) showed a brain cyst reduction of 89% resulting in 250 ± 77 cpb, and mice vaccinated with pGRA7 + pROP2 (n = 6) showed a brain cyst reduction of 79% resulting in 484 ± 66 cpb. No significant difference was observed between the average brain cyst burdens from mice that were immunized with cocktail DNA vaccines containing pGRA7. Mice vaccinated with pGRA1 + pROP2 (n = 7) showed a brain cyst reduction of only 57% and this reduction did not reach statistical significance compared to control vaccinated mice. A second set of experiments aimed at determining the protective capacity of each individual antigen at these low doses of encoding DNA vaccine. Protection of C3H/HeN mice vaccinated with the three-gene cocktail vaccine was compared to protection with a corresponding dose of singlegene DNA vaccine. Mice were challenged orally with a
sublethal dose of T. gondii 76K, and their brain cyst load was evaluated 4–6 weeks later (Figure 4b). Parasite load dropped from 3338 ± 692 cpb (n = 5) in the control vaccinated group to 522 ± 147 cpb (n = 7) in the three-gene cocktail DNA vaccinated group, a reduction of 84%. Mice vaccinated with pGRA7 showed a brain cyst reduction of 80%, resulting in 750 ± 160 cpb (n = 5). Mice vaccinated with pGRA1 or pROP2 showed brain cyst reductions of 31% (2295 ± 437 cpb, n = 7) and 43% (1906 ± 323 cpb, n = 6), respectively, but these reductions were not significant compared to control vaccinated mice. In a preliminary lethal challenge experiment, mice vaccinated with the three-gene DNA vaccine cocktail showed complete protection (P < 0·01), whereas 56% of control vaccinated mice succumbed to acute toxoplasmosis with a median survival time of 12 days. Mice chronically infected with T. gondii 76K were included as a positive control and in this group, 89% survived acute toxoplasmosis (P < 0·05). No significant difference in survival rate was observed between cocktail DNA vaccinated and chronically infected mice (data not shown).
DISCUSSION To further improve anti-Toxoplasma DNA vaccines the combination of antigens that stimulates both humoral and cellular immune responses, to achieve protective immunity against the natural route of infection, has to be found. An important question raised by such multicomponent vaccines is the relative contribution of each antigen to the protection that is obtained. In this study, we have addressed this issue by evaluating the individual contribution of antigens GRA1, GRA7 and ROP2 in protection and immune responses,
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445– 453
449
E. Jongert et al.
Parasite Immunology
Figure 3 IFN-γγ production elicited after vaccination with single-gene and three-gene cocktail DNA vaccines. Splenocytes from vaccinated and infected mice were re-stimulated with recombinant antigens or a parasite lysate. Data represent the average IFN-γ production measured by ELISA, from splenocytes from three mice individually tested per condition, with SD. Three independent experiments were performed and data from one representative experiment is shown. Statistical analysis was performed using one-way with Bonferroni post tests (**P < 0·01, ***P < 0·001) to compare antigen-specific IFN-γ production between vaccinated, infected and control mice.
Figure 2 IFN-γγ production elicited after vaccination with two-gene and three-gene cocktail DNA vaccines. Splenocytes from vaccinated and infected mice were re-stimulated with recombinant antigens or a parasite lysate. (a) IFN-γ production by ELISA. Data represent the average IFN-γ production by splenocytes from three mice individually tested per condition, with SEM. Three independent experiments were performed and data from one representative experiment are shown. Statistical analysis was performed using one-way with Bonferroni post tests (**P < 0·01, ***P < 0·001) to compare antigen-specific IFN-γ production between vaccinated, infected and control mice. (b) Detection of IFN-γ secreting cells by ELISPOT. Data represent the average SFC/106 splenocytes from three mice individually tested per condition, with SEM. Three independent experiments were performed and data from one representative experiment are shown. Statistical analysis was performed using one-way with Bonferroni post tests (*P < 0·05, **P < 0·01, ***P < 0·001) to compare antigen-specific SFC levels between vaccinated, infected and control mice.
elicited by cocktail DNA vaccines against T. gondii. In order to do so, mice were vaccinated with low dose single-gene, twogene DNA vaccine cocktails or the three-gene formulation. In general, an enhancement of antibody responses was obtained by the combination of GRA1 and GRA7, but
450
not ROP2, in a cocktail DNA vaccine. Reduced antibody responses were observed with the three-gene cocktail DNA vaccine. A similar effect of reduced immunogenicity was reported for a malaria DNA vaccine cocktail (31). Analysis by QRT-PCR showed that combining our plasmids did not interfere with the transcription of the antigens, and that variations in transcription were not reflected in the elicited humoral and cellular immune responses. Cellular responses were mainly directed against GRA7 when this gene was present in the vaccine mixture and were enhanced when combined with GRA1 or ROP2. Low IFN-γ responses were observed against GRA1 and ROP2 when used in a mixture. However, antibody and cellular immune responses to recombinant ROP2 protein, consisting of the 335 C-terminal amino acids, may be an underestimation of what is actually induced by the 535 codons from pROP2. The observation of strong antibody and in particular IFN-γ responses against GRA7 raises the question whether GRA7 has an immunodominant character. As cellular and antibody responses against GRA1 or ROP2 were not significantly higher in the absence than in the presence of GRA7, we have to conclude for now that GRA7 is simply a more immunogenic protein, at least at the low doses of encoding plasmid DNA used in the cocktail formulations. Evaluations of cocktail DNA vaccines against other protozoa have
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445–453
Volume 29, Number 9, September 2007
Figure 4 Protection levels against toxoplasmosis elicited after immunization with single-gene, two-gene or three-gene cocktail DNA vaccines. Mice were challenged with 20 cysts of T. gondii 76K 1–2 months after the last vaccination. Brain cyst burden was determined 4–5 weeks later. Data represent the average brain cyst burden with SE. Data were compared to brain cyst burden from control-vaccinated mice using one-way with Bonferroni post tests (*P < 0·05, **P < 0·01, *P < 0·001). (a) Protection obtained after immunization with two-gene cocktail DNA vaccines. Two independent experiments were performed and data from one experiment is shown. (b) Protection obtained after immunization with low dose single-gene DNA vaccines. Two independent experiments were performed and data from one experiment is shown.
indicated that cellular immune responses may be skewed to one or more components of a vaccine mixture. This was reported for a vaccine against Plasmodium falciparum (32) and a cocktail DNA vaccine against Leishmania (33). In these studies, not all antigens elicited both cellular and humoral immune responses. In addition to the IFN-γ responses against GRA7, ROP2specific antibodies and/or GRA1-specific CD8+ cytotoxic T-lymphocytes may also have contributed to protection. Previously, a report has shown that antibodies against
Immunogenicity in a low dose cocktail DNA vaccine
ROP2 may inhibit parasite internalization in vitro (34). We showed previously that protective CD8+ CTLs are elicited against GRA1, and it is possible that these contributed to protection when GRA1 was included in the vaccine formulation (11). Antibodies against GRA7 have been detected in mouse cerebrospinal fluid during chronic infection and GRA7 was shown to be on the surface of infected cells – indicating GRA7 might be a target antigen of the intracerebral immune response (35). Whether antibodies against T. gondii also protect during chronic toxoplasmosis and therefore eliminate infected cells through antibody mediated cytotoxicity or opsonization remains to be elucidated. Sublethal challenge experiments showed that GRA7 was required for strong protection against brain cyst formation. In general, combining genes enhanced protection, and the combination of GRA1 and GRA7 could reduce brain cyst burden up to 89%. So far, this is the highest protection reported against chronic toxoplasmosis. It was recently demonstrated that a cocktail DNA vaccine with five microneme protein fragments reduced cyst burden by 84% (36), and a mixture of bradyzoite antigens BAG1 and MAG1 reduced cyst burden by 62% (37). Preliminary results on protection against acute toxoplasmosis showed that our three-gene cocktail could induce complete protection against the natural route of infection – equivalent to the protection level elicited by a primary infection with the parasite. Partial protection against acute toxoplasmosis was reported for cocktail DNA vaccines combining SAG1 with ROP2 (38) or GRA4 (39), increasing survival time and rate, respectively. It is well known that IFN-γ production by T cells plays a central role in immune responses against T. gondii in both acute and chronic phases of infection, and that production of IFN-γ is correlated with protection (40–42). In this study, we show that this correlation is also valid for components of cocktail DNA vaccines against T. gondii. We showed that the presence of GRA7 within a cocktail DNA vaccine was important for optimal protection against T. gondii in the context of the three parasite genes examined and that this was correlated to strong IFN-γ responses against this antigen. We therefore propose GRA7 as a main component of cocktail DNA vaccines against T. gondii.
ACKNOWLEDGEMENTS This work was partially funded by the Fonds voor Wetenschappelijk Onderzoek Vlaanderen, grant G.O405·98. We thank “Les Amis de l’Institut Pasteur de Bruxelles” a.s.b.l. for their support. We are grateful to S. Angel for providing pQE-31-GRA7 and pQE-31-ROP2. We thank R. Laali and B. Stijlemans for the quantification of endotoxin levels. We gratefully acknowledge A. Laeremans and F. Crabbé for
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445– 453
451
E. Jongert et al.
Parasite Immunology
valuable contributions in maintaining the T. gondii strains and mice care. We are indebted to R. Zaugg (Vical, Inc.) for allowing us to work with the VR1020 plasmid.
REFERENCES 1 Montoya JG & Liesenfeld O. Toxoplasmosis. Lancet 2004; 363: 1965–1976. 2 Denkers EY & Gazzinelli RT. Regulation and function of T-cellmediated immunity during Toxoplasma gondii infection. Clin Microbiol Rev 1998; 11: 569 – 588. 3 Yap GS & Sher A. Cell-mediated immunity to Toxoplasma gondii: initiation, regulation and effector function. Immunobiology 1999; 201: 240–247. 4 Gilbert R, Tan HK, Cliffe S, Guy E & Stanford M. Symptomatic toxoplasma infection due to congenital and postnatally acquired infection. Arch Dis Child 2006; 91: 495 – 498. 5 Tenter AM, Heckeroth AR & Weiss LM. Toxoplasma gondii: from animals to humans. Int J Parasitol 2000; 30: 1217 – 1258. 6 Aspinall TV, Marlee D, Hyde JE & Sims PF. Prevalence of Toxoplasma gondii in commercial meat products as monitored by polymerase chain reaction – food for thought? Int J Parasitol 2002; 32: 1193–1199. 7 Kijlstra A, Eissen OA, Cornelissen J, Munniksma K, Eijck I & Kortbeek T. Toxoplasma gondii infection in animal-friendly pig production systems. Invest Ophthalmol Vis Sci 2004; 45: 3165–3169. 8 Cook AJ, Gilbert RE, Buffolano W, et al. Sources of toxoplasma infection in pregnant women: European multicentre case-control study. European Research Network on Congenital Toxoplasmosis. BMJ 2000; 321: 142 – 147. 9 Angus CW, Klivington-Evans D, Dubey JP & Kovacs JA. Immunization with a DNA plasmid encoding the SAG1 (P30) protein of Toxoplasma gondii is immunogenic and protective in rodents. J Infect Dis 2000; 181: 317 – 324. 10 Couper KN, Nielsen HV, Petersen E, Roberts F, Roberts CW & Alexander J. DNA vaccination with the immunodominant tachyzoite surface antigen (SAG-1) protects against adult acquired Toxoplasma gondii infection but does not prevent maternofoetal transmission. Vaccine 2003; 21: 2813 – 2820. 11 Scorza T, D’Souza S, Laloup M, et al. A GRA1 DNA vaccine primes cytolytic CD8(+) T cells to control acute Toxoplasma gondii infection. Infect Immun 2003; 71: 309 – 316. 12 Vercammen M, Scorza T, Huygen K, et al. DNA vaccination with genes encoding Toxoplasma gondii antigens GRA1, GRA7, and ROP2 induces partially protective immunity against lethal challenge in mice. Infect Immun 2000; 68: 38 – 45. 13 Desolme B, Mevelec MN, Buzoni-Gatel D & Bout D. Induction of protective immunity against toxoplasmosis in mice by DNA immunization with a plasmid encoding Toxoplasma gondii GRA4 gene. Vaccine 2000; 18: 2512 – 2521. 14 Guo H, Chen G, Lu F, Chen H & Zheng H. Immunity induced by DNA vaccine of plasmid encoding the rhoptry protein 1 gene combined with the genetic adjuvant of pcIFN-γ against Toxoplasma gondii in mice. Chin Med J (Engl) 2001; 114: 317 – 320. 15 Leyva R, Herion P & Saavedra R. Genetic immunization with plasmid DNA coding for the ROP2 protein of Toxoplasma gondii. Parasitol Res 2001; 87: 70 – 79. 16 Ismael AB, Sekkai D, Collin C, Bout D & Mevelec MN. The MIC3 gene of Toxoplasma gondii is a novel potent vaccine candidate against toxoplasmosis. Infect Immun 2003; 71: 6222 – 6228.
452
17 Fatoohi AF, Cozon GJ, Greenland T, et al. Cellular immune responses to recombinant antigens in pregnant women chronically infected with Toxoplasma gondii. Clin Diagn Lab Immunol 2002; 9: 704 – 707. 18 Jacquet A, Daminet V, Haumont M, et al. Expression of a recombinant Toxoplasma gondii ROP2 fragment as a fusion protein in bacteria circumvents insolubility and proteolytic degradation. Protein Expr Purif 1999; 17: 392 – 400. 19 Saavedra R, Becerril MA, Dubeaux C, et al. Epitopes recognized by human T lymphocytes in the ROP2 protein antigen of Toxoplasma gondii. Infect Immun 1996; 64: 3858 – 3862. 20 Beghetto E, Pucci A, Minenkova O, et al. Identification of a human immunodominant B-cell epitope within the GRA1 antigen of Toxoplasma gondii by phage display of cDNA libraries. Int J Parasitol 2001; 31: 1659 – 1668. 21 Jacobs D, Vercammen M & Saman E. Evaluation of recombinant dense granule antigen 7 (GRA7) of Toxoplasma gondii for detection of immunoglobulin G antibodies and analysis of a major antigenic domain. Clin Diagn Lab Immunol 1999; 6: 24 – 29. 22 van Gelder P, Bosman F, de Meuter F, van Heuverswyn H & Herion P. Serodiagnosis of toxoplasmosis by using a recombinant form of the 54-kilodalton rhoptry antigen expressed in Escherichia coli. J Clin Microbiol 1993; 31: 9 – 15. 23 Kasper LH, Khan IA, Ely KH, Buelow R & Boothroyd JC. Antigen-specific (p30) mouse CD8+ T cells are cytotoxic against Toxoplasma gondii-infected peritoneal macrophages. J Immunol 1992; 148: 1493 – 1498. 24 Subauste CS, Koniaris AH & Remington JS. Murine CD8 + cytotoxic T lymphocytes lyse Toxoplasma gondii-infected cells. J Immunol 1991; 147: 3955 – 3959. 25 Montoya JG, Lowe KE, Clayberger C, et al. Human CD4+ and CD8+ T lymphocytes are both cytotoxic to Toxoplasma gondiiinfected cells. Infect Immun 1996; 64: 176 – 181. 26 Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acids Res 2001; 29: e45. 27 Bivas-Benita M, Laloup M, Versteyhe S, et al. Generation of Toxoplasma gondii GRA1 protein and DNA vaccine loaded chitosan particles: preparation, characterization, and preliminary in vivo studies. Int J Pharm 2003; 266: 17 – 27. 28 Nigro M, Gutierrez A, Hoffer AM, et al. Evaluation of Toxoplasma gondii recombinant proteins for the diagnosis of recently acquired toxoplasmosis by an immunoglobulin G analysis. Diagn Microbiol Infect Dis 2003; 47: 609 – 613. 29 Nigro M, Martin V, Kaufer F, Carral L, Angel SO & Pszenny V. High level of expression of the Toxoplasma gondii-recombinant Rop2 protein in Escherichia coli as a soluble form for optimal use in diagnosis. Mol Biotechnol 2001; 18: 269 – 273. 30 Romano M, Denis O, D’Souza S, et al. Induction of in vivo functional Db-restricted cytolytic T cell activity against a putative phosphate transport receptor of Mycobacterium tuberculosis. J Immunol 2004; 172: 6913 – 6921. 31 Sedegah M, Charoenvit Y, Minh L, et al. Reduced immunogenicity of DNA vaccine plasmids in mixtures. Gene Ther 2004; 11: 448 – 456. 32 Sedegah M, Charoenvit Y, Aguiar J, et al. Effect on antibody and T-cell responses of mixing five GMP-produced DNA plasmids and administration with plasmid expressing GM-CSF. Genes Immun 2004; 5: 553 – 561. 33 Iborra S, Soto M, Carrion J, Alonso C & Requena JM. Vaccination with a plasmid DNA cocktail encoding the nucleosomal histones of Leishmania confers protection against murine cutaneous leishmaniosis. Vaccine 2004; 22: 3865 – 3876.
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445–453
Volume 29, Number 9, September 2007
34 Mishima M, Xuan X, Yokoyama N, et al. Recombinant feline herpesvirus type 1 expressing Toxoplasma gondii ROP2 antigen inducible protective immunity in cats. Parasitol Res 2002; 88: 144–149. 35 Neudeck A, Stachelhaus S, Nischik N, Striepen B, Reichmann G & Fischer HG. Expression variance, biochemical and immunological properties of Toxoplasma gondii dense granule protein GRA7. Microbes Infect 2002; 4: 581 – 590. 36 Beghetto E, Nielsen HV, Del Porto P, et al. A combination of antigenic regions of Toxoplasma gondii microneme proteins induces protective immunity against oral infection with parasite cysts. J Infect Dis 2005; 191: 637 – 645. 37 Nielsen HV, Di Cristina M, Beghetto E, Spadoni A, Petersen E & Gargano N. Toxoplasma gondii: DNA vaccination with bradyzoite antigens induces protective immunity in mice against oral infection with parasite cysts. Exp Parasitol 2006; 112: 274–279. 38 Fachado A, Rodriguez A, Angel SO, et al. Protective effect of a
Immunogenicity in a low dose cocktail DNA vaccine
39
40
41
42
naked DNA vaccine cocktail against lethal toxoplasmosis in mice. Vaccine 2003; 21: 1327 – 1335. Mevelec MN, Bout D, Desolme B, et al. Evaluation of protective effect of DNA vaccination with genes encoding antigens GRA4 and SAG1 associated with GM-CSF plasmid, against acute, chronical and congenital toxoplasmosis in mice. Vaccine 2005; 23: 4489 – 4499. Gazzinelli RT, Hakim FT, Hieny S, Shearer GM & Sher A. Synergistic role of CD4+ and CD8+ T lymphocytes in IFN-γ production and protective immunity induced by an attenuated Toxoplasma gondii vaccine. J Immunol 1991; 146: 286–292. Suzuki Y, Orellana MA, Schreiber RD & Remington JS. Interferon-γ: the major mediator of resistance against Toxoplasma gondii. Science 1988; 240: 516 – 518. Gazzinelli RT, Wysocka M, Hayashi S, et al. Parasite-induced IL-12 stimulates early IFN-γ synthesis and resistance during acute infection with Toxoplasma gondii. J Immunol 1994; 153: 2533 – 2543.
© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Parasite Immunology, 29, 445– 453
453
