Golgi UDP-GlcNAc:Polypeptide O--N-Acetyl-DGlucosaminyltransferase

Golgi UDP-GlcNAc:Polypeptide O-α-N -Acetyl-d-Glucosaminyltransferase 2 (TcOGNT2) Regulates Trypomastigote Production and Function in Trypanosoma cruzi

Updated information and services can be found at: http://ec.asm.org/content/13/10/1312 These include: SUPPLEMENTAL MATERIAL REFERENCES

CONTENT ALERTS

Supplemental material This article cites 92 articles, 34 of which can be accessed free at: http://ec.asm.org/content/13/10/1312#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

Carolina M. Koeller, Hanke van der Wel, Christa L. Feasley, Fernanda Abreu, Juliana Dutra Barbosa da Rocha, Fabrício Montalvão, Patrícia Fampa, Flávia C. G. dos Reis, Georgia C. Atella, Thaís Souto-Padrón, Christopher M. West and Norton Heise Eukaryotic Cell 2014, 13(10):1312. DOI: 10.1128/EC.00165-14. Published Ahead of Print 1 August 2014.

Golgi UDP-GlcNAc:Polypeptide O-␣-N-Acetyl-DGlucosaminyltransferase 2 (TcOGNT2) Regulates Trypomastigote Production and Function in Trypanosoma cruzi Carolina M. Koeller,a Hanke van der Wel,b Christa L. Feasley,b Fernanda Abreu,c Juliana Dutra Barbosa da Rocha,a Fabrício Montalvão,a Patrícia Fampa,d Flávia C. G. dos Reis,a Georgia C. Atella,e Thaís Souto-Padrón,c Christopher M. West,b Norton Heisea

All life cycle stages of the protozoan parasite Trypanosoma cruzi are enveloped by mucin-like glycoproteins which, despite major changes in their polypeptide cores, are extensively and similarly O-glycosylated. O-Glycan biosynthesis is initiated by the addition of ␣GlcNAc to Thr in a reaction catalyzed by Golgi UDP-GlcNAc:polypeptide O-␣-N-acetyl-D-glucosaminyltransferases (pp␣GlcNAcTs), which are encoded by TcOGNT1 and TcOGNT2. We now directly show that TcOGNT2 is associated with the Golgi apparatus of the epimastigote stage and is markedly downregulated in both differentiated metacyclic trypomastigotes (MCTs) and cell culture-derived trypomastigotes (TCTs). The significance of downregulation was examined by forced continued expression of TcOGNT2, which resulted in a substantial increase of TcOGNT2 protein levels but only modestly increased pp␣GlcNAcT activity in extracts and altered cell surface glycosylation in TCTs. Constitutive TcOGNT2 overexpression had no discernible effect on proliferating epimastigotes but negatively affected production of both types of trypomastigotes. MCTs differentiated from epimastigotes at a low frequency, though they were apparently normal based on morphological and biochemical criteria. However, these MCTs exhibited an impaired ability to produce amastigotes and TCTs in cell culture monolayers, most likely due to a reduced infection frequency. Remarkably, inhibition of MCT production did not depend on TcOGNT2 catalytic activity, whereas TCT production was inhibited only by active TcOGNT2. These findings indicate that TcOGNT2 downregulation is important for proper differentiation of MCTs and functioning of TCTs and that TcOGNT2 regulates these functions by using both catalytic and noncatalytic mechanisms.

T

rypanosoma cruzi is a protozoan parasite that causes Chagas disease, a debilitating condition that affects millions of humans in the American continents (1). T. cruzi traverses a complex life cycle that involves extracellular proliferation and differentiation in the digestive tract of an insect vector (2) and intracellular proliferation and differentiation in a wide range of vertebrate hosts (3). In the insect, noninfective epimastigote forms colonize the digestive tract and Malpighian tubes, attach to the cuticle of the rectal epithelium (4), and differentiate into nondividing infective metacyclic trypomastigotes (MCTs), in a process known as metacyclogenesis (5). During a blood meal, MCTs detach and are expelled together with epimastigotes within feces and urine, where they can gain access to internal body fluids via a skin discontinuity or a mucosal surface and invade host cells (6). In addition, because MCTs can also invade the gastric mucosal epithelium, T. cruzi is an emerging food-borne parasite responsible for frequent outbreaks of acute, orally contracted cases of Chagas disease that are characterized by high mortality (7). The surfaces of all life cycle stages of T. cruzi are covered by a dense array of heavily glycosylated glycoproteins and glycolipids attached to the membrane via glycosylphosphatidylinositol anchors (8, 9). Major glycoproteins of insect-derived stages are the 35- to 50-kDa mucin-like glycoproteins, NETNES, mucin-associated surface proteins (MASPs), active and inactive trans-sialidases, and peptidases, including gp63-like metalloprotease and isoforms of the cysteine proteinase cruzipain (10–16). The mucin-

1312

ec.asm.org

Eukaryotic Cell

like glycoproteins are extensively modified by O-glycans attached via a GlcNAc␣1-Thr linkage (17–19), whose formation is under the control of UDP-GlcNAc:polypeptide N-acetyl-␣-glucosaminyltransferases (pp␣GlcNAcTs) (20, 21). The N-acetyl-␣-D-glucosamine (␣GlcNAc) residue is extended, depending on the parasite strain, at its O-6 and/or O-4 position by ␤-galactopyranose and/or ␤-galactofuranose residues, respectively, which are themselves subject to extension by other ␤Gal residues before capping by terminal ␣Gal or ␣2,3-sialic acid (22). GlcNAc and Gal residues are likely added conventionally in the Golgi apparatus (23), but sialic acids are transferred from host glycans (24) by cell surface trans-sialidases (13, 16). Glycosylation is protein specific, as evidenced by cruzipain, which transits the Golgi-endosomal pathway, accumulates in late endosomes referred to as lysosome-related organelles or reservosomes (25), and contains unmodified

p. 1312–1327

Received 8 July 2014 Accepted 30 July 2014 Published ahead of print 1 August 2014 Address correspondence to Christopher M. West, [email protected], or Norton Heise, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /EC.00165-14. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/EC.00165-14

October 2014 Volume 13 Number 10

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazila; Department of Biochemistry and Molecular Biology, Oklahoma Center for Medical Glycobiology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma, USAb; Instituto de Microbiologia Paulo de Góes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazilc; Instituto de Biologia, Universidade Federal Rural do Rio de Janeiro, Seropédica, Rio de Janeiro, Brazild; Instituto de Bioquímica Médica, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazile

T. cruzi TcOGNT2 and Metacyclogenesis

October 2014 Volume 13 Number 10

tive enzyme downregulation and impaired formation of MCTs and TCTs, indicating an importance of downregulation for both pathways of trypomastigote production. Detailed analysis indicated that MCT formation was inhibited by sustained TcOGNT2 expression after substratum adhesion and downstream of cAMP signaling, did not involve cruzipain inhibition, and did not depend on the catalytic activity of TcOGNT2. TCT formation appeared to be inhibited at the cell invasion step by a mechanism that, in contrast, did depend on the catalytic activity of TcOGNT2 and O-glycan remodeling. These findings imply multiple functions for TcOGNT2 and highlight an important role of the Golgi apparatus in developmental transitions critical for T. cruzi pathogenesis. MATERIALS AND METHODS Epimastigote growth and metacyclogenesis. The wild-type (wt) T. cruzi clone Dm28c (29), obtained from Fundação Oswaldo Cruz (FIOCRUZ; Rio de Janeiro, Brazil), was cultured at 28°C in 3.7% (wt/vol) brain heart infusion (BHI) (Difco) medium supplemented with 5% (vol/vol) fetal bovine serum (FBS) (Gibco), 5 ␮g ml⫺1 hemin (Sigma), and 20 ␮g ml⫺1 folic acid (20). Genetically modified parasites were maintained in the presence of 500 ␮g ml⫺1 Geneticin (G418) (U.S. Biologicals). Cultures were routinely split 1:10 in T25 flasks every 6 days. For scale-up, parasites were inoculated at 0.5 ⫻ 106 to 1 ⫻ 106 cells ml⫺1 in the same medium in Erlenmeyer flasks on a gyratory shaker at ⬃200 rpm and 27°C and grown until stationary phase (0.5 ⫻ 108 to 1 ⫻ 108 cells ml⫺1). Proliferation studies were initiated with 105 parasites ml⫺1 in standard medium (with or without G418) in 24-well plates, and cell density was quantitated daily in a Neubauer chamber. Three independent experiments were performed in triplicate. Metacyclogenesis was induced as previously described (29). Briefly, epimastigotes in transition from logarithmic to stationary phase were adjusted to 5 ⫻ 108 parasites ml⫺1 in triatomine artificial urine (TAU) medium (190 mM NaCl, 17 mM KCl, 2 mM MgCl2, 2 mM CaCl2, 0.035% sodium bicarbonate, 8 mM phosphate, pH 6.0). After 2 h at 28°C, cultures were diluted 100-fold in 10 ml TAU medium supplemented with 10 mM L-proline (TAU-P) and 500 ␮g ml⫺1 G418 and transferred to a T25 flask kept on its side at 28°C. As indicated, the TAU-P medium was supplemented with 25 mM or 250 mM glucose (Glc), glucosamine (GlcN), or N-acetylglucosamine (GlcNAc) or 2 mM dibutyryl-cAMP (db-cAMP) (Sigma-Aldrich) to promote metacyclogenesis. After 3 to 5 days, parasite numbers were quantified in a Neubauer chamber, and the percentage of MCTs was estimated by morphology after Giemsa staining and/or resistance to lysis by the alternative pathway of complement (39). At least three independent experiments were performed in duplicate, and the results were analyzed in GraphPad Prism. TCTs. TCTs were obtained from infected monkey kidney epithelial (LLCMK2) cells as described previously (44). Prior to infection, LLCMK2 cells were plated at 5 ⫻ 104 cells ml⫺1 in RPMI 1640 medium containing 2% FBS in T25 flasks (Corning) and grown for 18 h at 37°C in a humidified atmosphere of 7% CO2. Cells were initially infected with MCTs obtained from TAU-P medium (see below) at a ratio of 40 cell⫺1 by incubation for 18 h at 37°C. Cultures were then washed with RPMI 1640, and after about 2 weeks, TCTs were collected from culture supernatants and used to infect new LLCMK2 cell cultures (4 h of interaction at a ratio of 20 TCTs cell⫺1). TCTs first appeared in the culture supernatant after 4 days, and their continuous release was quantified by direct counting. TCT attachment/invasion was assayed as previously described (45). Briefly, LLCMK2 cells attached to glass coverslips in 24-well plates were incubated with TCTs (at a ratio of 50 cell⫺1) for 1 h at 37°C, washed 5 times with phosphate-buffered saline (PBS) to remove extracellular parasites, fixed with Bouin’s solution (71.4% saturated picric acid, 23.8% formaldehyde, and 4.8% acetic acid), washed with 70% ethanol (EtOH), and stained with InstantProv hematological stain (NewProv, Brazil). The number of cells per field and the number of infected cells per field were estimated by direct

ec.asm.org 1313

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

O-linked GlcNAc residues and sialic acid-terminated N-linked glycan chains (26). The coat formed by glycoproteins and glycoinositolphospholipids protects epimastigotes from proteases in the insect vector intestinal tract (27) and supports survival of MCTs during vector-borne transmission and penetration of the gastric mucosa of the mammalian host (7). Metacyclogenesis is usually analyzed in vitro by using axenic media that allow initial epimastigote proliferation (28) followed by transformation into MCTs (29, 30). Nutritional stress is a major factor both in vitro and in vivo and prompts initial substratum adhesion of epimastigotes, followed by release and morphological transformation associated with nuclear structure changes and migration of the kinetoplast to the anterior end of the cell (14, 31, 32). Pharmacological and biochemical studies indicate the involvement of increased cyclic AMP (cAMP) and activation of protein kinase A (PKA) (33–35). Cruzipain expression initially increases upon adhesion (36), followed by a decrease and reduced reservosome volume as metacyclogenesis proceeds (37). Additional changes include a sharp decrease in the amount of glycoinositolphospholipids (38) and induction of stage-specific antigens, such as gp90 and gp82, that mediate adhesion to and infection of vertebrate host cells (7). MCTs do not divide and are resistant to antibody-independent complement-mediated lysis (39), owing to a surface glycoprotein that inhibits the formation of the alternative and classical C3 convertase (40). MCTs are infective toward mammalian cells, following which they proliferate intracellularly as amastigotes prior to emergence as infective tissue culture-derived trypomastigotes (TCTs). We previously identified two genes (TcOGNT1 and TcOGNT2) predicted to encode Golgi pp␣GlcNAcTs, as well as a third, divergent gene, that are conserved throughout the trypanosomatids. TcOGNT2 was heterologously expressed in Leishmania tarentolae as an N-terminally truncated secreted protein, purified to near homogeneity, and found to possess peptide-dependent pp␣GlcNAcT activity and peptide-independent UDP-GlcNAc hydrolytic activity (21). TcOGNT2 evolved from an ancient lineage of polypeptide ␣HexNAc transferases that also provided cytoplasmic hydroxyproline pp␣GlcNAcTs in other protists and the well-known pp␣GalNAcT family in animals (41) but was specific for Thr as the amino acid acceptor and UDP-GlcNAc as the donor. As expected for this lineage, both activities depended on a DxD-like DxH sequence motif and a divalent cation (21). In comparison to the single Golgi pp␣GlcNAcT (DdGnt2) from Dictyostelium (42, 43), however, the T. cruzi enzyme was not expressed well and exhibited low in vitro specific activity and high hydrolysis activity. These differences, observed using several peptide substrates, imply that other factors may be important for TcOGNT2 function in the cell, such as its transmembrane anchor, posttranslational modifications, or availability of a limiting factor, such as TcOGNT1 or TcOGNTL (21). Little is known about the regulation of O-glycosylation in T. cruzi. The prediction that the initial step involves only two enzyme isoforms, in contrast to the myriad subsequent processing glycosyltransferases (GTs), implies a potential gatekeeper role which can now be analyzed owing to identification of the genes (21). Here we show that in comparison to proliferating insect-form epimastigotes, differentiated infective MCTs and TCTs downregulate their Golgi-associated pp␣GlcNAcT activities, which is explained at least in part by reduced levels of the TcOGNT2 protein. Forced overexpression of TcOGNT2myc overcame the na-

Koeller et al.

1314

ec.asm.org

MAbs 3F6 (to gp82) and 1G7 (to gp90) (7), anti-␣-tubulin (54), and the anti-myc MAb 9E10. Immunofluorescence microscopy. Three- to four-day epimastigotes or metacyclics from TAU-P medium were washed 3 times with PBS, and the suspension was fixed in 4% paraformaldehyde in PBS for 1 h at room temperature, washed twice with PBS, allowed to adhere to poly-L-lysinecoated coverslips for 15 min, permeabilized using 0.4% saponin for 15 min in PGN (PBS, pH 7.2, 0.2% gelatin, and 0.1% NaN3), and blocked using 50 mM NH4Cl for 30 min, followed by PBS-3% bovine serum albumin (BSA) for 30 min. Samples were probed with preimmune or immune murine anti-TcOGNT2cat (1:50), affinity-purified anti-TcOGNT2 (1:100), anti-gp90 (1:100), or anti-cruzipain (1:200) in PGN with 0.1% saponin and incubated overnight at 4°C. After washing with PGN, samples were incubated with Alexa Fluor 546- or 488-conjugated goat antimouse and/or Alexa Fluor 568-conjugated goat anti-rabbit (Molecular Probes) diluted 1:500 in PGN for 1 h at room temperature. For Golgi complex labeling (55), 1 ⫻ 107 (4-day) epimastigotes were washed and resuspended in 150 ␮l of cold BHI medium without FBS. BODIPY FL C5-ceramide (Avanti Polar Lipids, Inc.) complexed to fatty acid-free BSA (5 ␮M) was added. After 1 h of incubation on ice, the cells were washed with cold BHI medium without FBS and suspended in 150 ␮l of the same 37°C prewarmed medium, followed by 30 min of incubation at 37°C to allow dye uptake. Cells were then washed, fixed, and processed for fluorescence microscopy as described above. Coverslips were washed in PBS and mounted on slides by use of Vectashield mounting medium with 4=,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories). Images were obtained using a Zeiss Axioplan 2 fluorescence microscope (Zeiss, Jena, Germany) coupled to a charge-coupled device (CCD) color video camera or a Leica TCS NT confocal microscope and processed with Leica confocal software. Flow cytometry. Flow cytometry was performed as described by Bourguignon et al. (56). Briefly, 5 ⫻ 106 epimastigotes or 2 ⫻ 106 TCTs were washed 3 times in PBS and incubated in a final volume of 200 ␮l of PBS plus 0.1 mM CaCl2 and 0.1% sodium azide, with or without 5 ␮g ml⫺1 wheat germ agglutinin (WGA), 5 ␮g ml⫺1 Canavalia ensiformis agglutinin (ConA), or 30 ␮g ml⫺1 isolectin GS-IB4 from Griffonia simplicifolia, each conjugated with Alexa 488 (Molecular Probes, Invitrogen), 20 ␮g/ml⫺1 Maackia amurensis agglutinin (MAA) conjugated with fluorescein isothiocyanate (FITC) (E-Y Laboratories), or 10 ␮g/ml⫺1 Arachis hypogaea agglutinin (PNA) conjugated with tetramethyl rhodamine isocyanate (TRITC) (E-Y Laboratories), for 30 min on ice. After washing twice in PBS, parasites were fixed in 4% paraformaldehyde in PBS for 15 min at 4°C and kept on ice until data acquisition with a FACSCalibur flow cytometer (Becton-Dickinson Biosciences) and analysis with Summit (Dako Cytomation). Five thousand events were acquired in the region previously established to correspond to the parasites. Data were obtained from 3 independent experiments. Cloning and overexpression of TcOGNT2 in T. cruzi. The fulllength TcOGNT2 coding region (GeneDB accession no. Tc00.1047053511 309.70) was amplified from CL-Brener gDNA by use of primers E5S (5=-TA GGATCCAGCCATGGATAAAAAGAAGC) and E5AS (5=-TAGATATCT CCAACTGTTGCCTTTTCGC) as described previously (21), cloned into pCR4TOPO (Invitrogen), released by digestion with BamHI and EcoRV (sites underlined above), and ligated into similarly digested pTEXTcDJ1-c-myc (57), yielding the expression plasmid pTEX-TcDJ11–91TcOGNT2(DSH)myc. The TcOGNT2(DSH)myc fragment was then transferred to pTEX (58) by use of BamHI and XhoI, giving rise to pTEXTcOGNT2(DSH)myc. Other enzymes of this family tolerate a C-terminal myc tag (59). All sequences matched the GeneDB models (http://www .genedb.org/). One hundred micrograms of EtOH-precipitated plasmid DNA was dissolved in 100 ␮l of electroporation buffer (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4, 25 mM HEPES, 2 mM Na2EDTA, 5 mM MgCl2, pH 7.6) (60) and mixed in ice-cold 0.2-cm electroporation cuvettes (BioAgency) with 300 ␮l of epimastigotes at 108 cells ml⫺1, prepared in the same buffer from cells growing at 5 ⫻ 106 cells ml⫺1. Elec-

Eukaryotic Cell

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

counting of at least 200 fields. Assays comparing the proliferation of intracellular amastigotes were performed similarly, after an interaction of 4 h (20 parasites cell⫺1) followed by 48 h of culture before fixation and staining (46). The numbers of total and infected LLCMK2 cells per field and the number of amastigotes per infected cell were estimated by direct counting of at least 300 fields. Rhodnius prolixus midgut binding and in vivo assays. R. prolixus insects were reared as described previously (47), following the guidelines of the CCS-UFRJ Animal Care Ethics Committee. Adult females in their third feeding cycle were used at 2 weeks postfeeding. Binding assays were performed as previously described (48). In summary, epimastigotes were washed 3 times with BHI medium without FBS and suspended in the same medium at 107 parasites ml⫺1. Posterior midguts dissected and longitudinally sectioned to expose their luminal surfaces (5 group⫺1) were placed in excavated slides together with 200 ␮l of the above-described suspension of parasites and incubated for 1 h at room temperature in a humidified chamber. Midguts were washed 5 times with PBS, individually transferred to Eppendorf microcentrifuge tubes containing 50 ␮l of PBS, and homogenized. Released epimastigotes were counted in a Neubauer chamber. The in vivo infection assay was modified from the work of Mello et al. (49), using fifth-instar larvae starved for 30 days after the last ecdysis. Briefly, groups of 30 insects were infected orally with epimastigotes diluted in complement-inactivated rabbit blood (1.5 ⫻ 108 parasites ml⫺1) by use of an artificial apparatus (50). After intervals of 3, 10, 17, and 24 days, 5 to 7 insects were dissected, the whole digestive tract was removed and homogenized in 0.2 to 1 ml PBS, and the number of parasites was quantified by phase-contrast optical microscopy using a Neubauer chamber. Antibodies. Antibodies against the bacterially expressed catalytic domain of TcOGNT2 were raised in mice. Escherichia coli Rosetta(DE3) harboring pET15TEVTcOGNT2cat (21) was induced with 0.75 mM isopropyl-1-thio-␤-D-galactopyranoside for 18 h at 18°C, centrifuged at 4,000 ⫻ g for 10 min at 4°C, suspended in 300 ␮g ml⫺1 lysozyme in 50 mM Tris-HCl (pH 7.5), 200 mM NaCl, 5% (wt/vol) glycerol, 1 mM dithiothreitol (DTT), and protease inhibitors (1 mM phenylmethylsulfonyl fluoride [PMSF] and 1 ␮g ml⫺1 leupeptin), and stirred for 30 min on ice. The suspension was brought to 1 ␮g ml⫺1 DNase and 5 mM MgCl2 for 30 min on ice, lysed by probe sonication, and centrifuged at 30,000 ⫻ g for 40 min at 4°C. The TcOGNT2cat-rich inclusion bodies were washed 4 times with 2% (wt/vol) Triton X-100, 2 M urea, 100 mM Tris-HCl (pH 7.5), 5 mM Na2EDTA, 5 mM DTT, 1 mM PMSF, and 1 ␮g ml⫺1 leupeptin, centrifuged at 22,000 ⫻ g for 30 min at 4°C, washed a final time in the same buffer lacking Triton X-100, and resuspended in 8 M urea in 100 mM Tris-HCl (pH 7.5) and 0.5 M NaCl (solubilization buffer). After centrifugation at 100,000 ⫻ g for 1 h at 10°C, the supernatant was adjusted to a final concentration of 5 mM imidazole and applied twice to a 1-ml HisTrap HP column (GE Healthcare) preequilibrated with the same buffer. TcOGNT2cat, which eluted in the 0.25 M and 0.5 M imidazole fractions, was precipitated with 9 vol of ice-cold EtOH, collected by centrifugation, and suspended in phosphate-buffered saline. Five female BALB/c mice (10 to 12 weeks old) were immunized by subcutaneous injection with 100 ␮g of TcOGNT2cat in a 1:1 emulsion with Freund’s complete adjuvant (Sigma) twice within a 1-week interval and then boosted by intraperitoneal injection at 2-week intervals with a similar preparation using Freund’s incomplete adjuvant. The immunization protocol was approved by the Ethics Committee of the Centro de Ciências da Saúde of UFRJ (protocol number IBCCF-085). Crude antisera were affinity purified by adsorption to recombinant TcOGNT2cat purified from the culture supernatant of L. tarentolae (21) and coupled to CNBr-activated Sepharose-4B (Sigma) according to the manufacturer’s instructions. Anti-TcOGNT2 was eluted with 0.1 M glycine, pH 2.4, neutralized with 1 M Tris-HCl, and frozen at ⫺80°C until use. The following other antibodies were described previously: polyclonal rabbit anti-cruzipain (51), mouse monoclonal antibodies (MAbs) J01 and 212 (to cruzipain) (52), MAbs 10D8 and 2B10 (to gp35/50 mucin) (53),

T. cruzi TcOGNT2 and Metacyclogenesis

October 2014 Volume 13 Number 10

Washed blots were incubated with 1:1,000 alkaline phosphatase-conjugated anti-mouse IgG secondary antibody (KPL), 1:10,000 Alexa 680labeled anti-mouse IgG secondary antibody (Invitrogen), or IRDye-800labeled anti-rabbit IgG secondary antibody (Li-Cor) and diluted in TBS with 3% BSA for 1 h at room temperature. Alkaline phosphatase was detected with 0.03% 5-bromo-4-chloro-3-indolylphosphate (BCIP)– 0.02% nitroblue tetrazolium (NBT) reagent (Fermentas) in 100 mM TrisHCl, pH 9.5, 150 mM NaCl, 5 mM MgCl2, and 0.05% Tween 20. Fluorescence was imaged using an Odyssey infrared scanner (Li-Cor Inc.). Blots were scanned and processed using ImageJ software. pp␣GlcNAc transferase and UDP-GlcNAc hydrolysis assays. Enzyme assays were performed as previously described (21), using Trismaleate buffer (pH 8.3), the T16 acceptor peptide (TYPPTQPPTQPPTY PP), 150 ␮g membrane protein, and 30-min incubations at 28°C. Results from 3 independent experiments conducted in duplicate were analyzed using GraphPad Prism. Cruzipain assays. Cruzipain activity in extracts was assayed using the fluorogenic synthetic peptide carboxybenzoxy-phenylalanyl-arginyl-7-amido-4-methylcoumarin (CBZ-FR-AMC; Sigma-Aldrich) in 50 mM Na2HPO4 (pH 6.5), 100 mM NaCl, 5 mM EDTA, 5% dimethyl sulfoxide (DMSO), and 2.5 mM DTT at 37°C as described previously (51). Substrate hydrolysis was monitored continuously based on fluorescence (380 nm excitation, 440 nm emission) in a model F4500 (Hitachi) fluorimeter. Initial velocities were calculated by linear regression, and the specificity of the reaction was evaluated by comparison with parallel reactions conducted in the presence of the inhibitor E-64 [trans-epoxysuccinyl-L-leucylamido-(4-guanidino)-butane]. Extraction of mucin-like glycoproteins. Glycoconjugates were extracted based on the method of Almeida et al. (17). Briefly, 5-day epimastigotes (1 ⫻ 109) grown in BHI without FBS for 1 day were washed 5 times in PBS and freeze-dried. Samples were extracted 3 times by suspension in 1.9 ml of chloroform-methanol-water (1:2:0.8 [vol/vol/vol]) for 4 h at room temperature, followed by centrifugation (12,000 ⫻ g for 20 min). The supernatants were pooled, concentrated in a Speed-Vac, and freezedried to produce fraction F1. The pellet was dried under N2 and extracted 3 times with 1 ml of water saturated with butan-1-ol for 4 h at room temperature. Fraction F1 was dissolved in 500 ␮l of water saturated with butan-1-ol and extracted 3 times with 1 ml of butan-1-ol saturated with water. The mucin-like glycoprotein-containing aqueous phases were pooled and dried under N2. Glycomic studies. N-Glycans were released from mucin-like glycoproteins from 5 ⫻ 108 cells by use of PNGase A according to the method of Feasley et al. (64). O-Glycans were released by reductive ␤-elimination as described by Dell et al. (65). The mucin-like glycoprotein sample was suspended in 100 ␮l of 0.1 M NaOH before addition of 200 ␮l freshly made 2 M NaBH4. After incubation for 18 h at 45°C, samples were neutralized with acetic acid, desalted in 0.5 ml of Dowex-50 (H⫹) resin (Sigma), and subjected to borate removal. N- and O-glycans were analyzed in their native state or after permethylation with iodomethane by use of a solid-phase spin column as described by Kang et al. (66) and were then analyzed by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) on an Ultraflex II mass spectrometer (Bruker Daltonics, Billerica, MA) operated in reflector positiveion mode, using 2,5-dihydroxybenzoic acid as the matrix (64). Statistical analyses. Data significance was evaluated by one-way analysis of variance (ANOVA) in GraphPad Prism 5.0, using Bonferroni’s posttest to compare all pairs of columns. P values are indicated in the figure legends.

RESULTS

Overexpression of TcOGNT2 in epimastigotes. To investigate the function of TcOGNT2, a C-terminally myc-tagged version was overexpressed using the pTEX expression system. The scheme is outlined in Fig. S1 in the supplemental material, and all transformants were verified by PCR (data not shown). Using a newly pre-

ec.asm.org 1315

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

troporation was performed in two pulses (10-s intervals) in a Bio-Rad gene pulser set at 0.45 kV and 500 ␮F; time constants were between 3.5 and 4.2. After 48 h of culture in standard medium, 500 ␮g ml⫺1 of G418 (U.S. Biologicals) was added. Non-DNA control cells were killed in 3 to 4 weeks. Cultures were split 1:5 into fresh G418-containing medium after 5 to 10 days. Site-directed mutagenesis of TcOGNT2. The amino acid sequence of TcOGNT2 was altered by site-directed mutagenesis of pTEXTcOGNT2(DSH)myc as previously described (21). The D234A and D234N substitutions were generated as described before, and the H236D mutation was generated using primers TcE5H236Dfor (5=-GTGATTGA CAGCGATTCTAGATTTTGTGCCTGAGTGG) and TcE5H236Drev (5=-CACAAATCTAGAATCGCTGTCAATCACCATATAGTAATCC), which yielded a C706G mutation and a novel XbaI restriction site. Subcellular fractionation of epimastigotes. Subcellular fractionation was performed by sucrose differential centrifugation as described previously (61). Briefly, epimastigotes (⬃4 ⫻ 1010) were collected at 5,860 ⫻ g for 20 min at 4°C, washed twice in TES buffer (50 mM Tris-HCl, pH 7.4, 5 mM Na2EDTA, and 250 mM sucrose), and lysed to ⬎98% (based on microscopy) by abrasion in a chilled mortar with an equal volume of Carborundum (Fluka). The homogenate was suspended in 5 ml TES buffer with a 1:50 dilution of protease inhibitors (GE Healthcare), and unbroken cells and nuclei were removed by 3 cycles of centrifugation at 1,500 ⫻ g for 10 min at 4°C and resuspension. The supernatants (S1.5) were combined and diluted to 20 ml in the same buffer. The S1.5 sample was centrifuged at 5,000 ⫻ g for 10 min at 4°C to produce a large granular fraction pellet (P5.0), and the resulting supernatant was centrifuged at 12,350 ⫻ g for 10 min at 4°C to produce a small granular pellet (P12). A final centrifugation at 105,000 ⫻ g for 1 h at 4°C yielded the microsomal fraction (P100) and the cytosolic fraction, or S100. Each pellet was resuspended in 3 ml of TES buffer with protease inhibitors and stored at ⫺80°C. The amount of protein was quantified using the Bradford method (62), with BSA as the standard. Enzymatic deglycosylation. Microsomal fractions (100 ␮g of protein) were adjusted to 0.5% SDS, 40 mM DTT, in a final volume of 10 ␮l and heated at 100°C for 10 min. For endo-␤-N-acetylglucosaminidase H (endo H) treatment, samples were adjusted to 100 ␮l containing 5 mM citrate buffer (pH 5.5) and 250 mU of active or heat-inactivated (75°C for 10 min) endo H (New England BioLabs Inc.). For peptide N-glycosidase F (PNGase F) treatment, samples were adjusted to 100 ␮l with 5 mM sodium phosphate buffer (pH 7.5) containing 1% NP-40 and 150 mU of active or heat-inactivated peptide N-glycosidase F (New England BioLabs Inc.). After 1 h at 37°C, proteins were precipitated with 90% cold ethanol and centrifuged at 10,000 ⫻ g for 10 min at 4°C, and the pellets were dried in a SpeedVac concentrator. TCTs (2 ⫻ 106) from the culture supernatant of LLCMK2 cells were collected by centrifugation, washed 3 times with PBS, and suspended in 100 ␮l of PBS containing 100 U of recombinant neuraminidase from Clostridium perfringens (New England BioLabs). After 1 h at 37°C, cells were washed twice with PBS at 4°C and directly subjected to flow cytometry as described above. SDS-PAGE and Western blotting. SDS-PAGE and Western blotting were performed as described before (63). Briefly, samples were prepared using 50 mM DTT, and typically 5 ⫻ 106 cell equivalents lane⫺1 were separated in 4 to 12% NuPAGE Novex Bis-Tris (Invitrogen) or 12% gels. Novex Sharp prestained Mr standards were from Life Technologies, and PageRuler molecular mass markers were from Fermentas. Nitrocellulose membranes were blocked in 5% nonfat dried milk in TBS (100 mM NaCl, 50 mM Tris-HCl, pH 7.5) and washed 3 times with TBS containing 0.05% Tween 20 (TBS-T) and once with TBS at room temperature. The following primary antibodies were diluted as indicated in TBS with 3% BSA0.05% NaN3 for 18 h at 4°C: polyclonal anti-cruzipain (1:1,000), antiTcOGNT2cat polyclonal monospecific antibody (1:500), monoclonal antibodies 9E10 (1:400), 10D8 (1:400), 2B10 (1:400), J01 (1:500), 212 (1:500), 3F6 (1:200), and 1G7 (1:200), and anti-␣-tubulin (1:4,000).

Koeller et al.

pared affinity-purified murine anti-TcOGTN2 antibody, substantial expression of a novel protein was observed in Western blots of whole-cell extracts of epimastigotes, at the expected apparent Mr position of 56,500 (Fig. 1A). This band was not seen using preimmune serum (not shown). The expected endogenous protein was not detected under these conditions (Fig. 1A, lane 3). The 56.5kDa band was labeled by MAb 9E10 against the myc epitope, confirming it to be encoded directly by the transgene. Strains were also prepared that expressed similar levels of mutant TcOGNT2myc proteins (Fig. 1A) expected to be catalytically inactive owing to a conservative point mutation in the DSH motif: D234A (ASH), D234N (NSH), or H236D (DSD) (see Fig. S1). The canonical DXD motif characteristic of most superfamily A glycosyltransferases changed to DXH in CAZy GT27 and GT60 family members, and similar point mutations in this motif inactivated other GT60 (pp␣GalNAcTs) and GT27 (pp␣GlcNAcTs) family members (42, 67). Endogenous TcOGNT2. Cell fractionation revealed that TcOGNT2myc was enriched in the P100 (microsomal) fraction (Fig. 1B), as previously described for pp␣GlcNAcT activity (20,

1316

ec.asm.org

23). A direct comparison of the microsomal fractions from normal TcOGNT2myc (DSH) and control (empty pTEX) strains revealed a slightly more rapidly migrating band corresponding to endogenous TcOGNT2 (Fig. 1C). To validate its identity as TcOGNT2, its N-glycosylation status was analyzed by treatment with PNGase F or endo H, each of which is expected to release the high-mannose N-glycans typically formed by T. cruzi. TcOGNT2 possesses 2 predicted N-glycosylation sites (21), and as expected, treatment with either enzyme shifted TcOGNT2myc to a slightly more rapidly migrating position (Fig. 1D). The indistinguishable effects of these enzyme treatments on the endogenous band strongly support its identity as TcOGNT2. Densitometric studies showed that TcOGNT2 is overexpressed 7-fold in the transgenic strain. Enzymatic activity of overexpressed TcOGNT2. Microsomes were analyzed as a means to assess the impact of TcOGNT2myc protein expression on catalytic activity in cells. As shown in Fig. 2A, control (empty pTEX) cells exhibited substantial pp␣GlcNAcT activity using the previously described T16 peptide substrate. Cells expressing TcOGNT2myc exhibited 50% in-

Eukaryotic Cell

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 1 Western blot analysis of TcOGNT2 expression. (A) Epimastigotes transfected with pTEX (lanes 3) or wt (lanes 4) or mutant (lanes 5 to 7) versions of TcOGNT2myc were subjected to SDS-PAGE, Western blotted using affinity-purified anti-TcOGNT2, MAb 9E10 against the myc tag, or anti-tubulin (as a loading control), and detected using alkaline phosphatase-coupled secondary antibodies. A previously characterized (21) culture supernatant from L. tarentolae secreting ⌬TcOGNT2, which is subject to partial proteolytic cleavage, and a naive culture supernatant are shown in lanes 2 and 1, respectively. (B) Subcellular fractionation. TcOGNT2myc-expressing epimastigotes were mechanically disrupted, fractionated by differential centrifugation, and Western blotted using anti-TcOGNT2 and anti-myc antibodies. Fractions are labeled according to the supernatant (S) or pellet (P) formed at the indicated centrifugation speed (⫻ g [⫻ 10⫺3]). ⌬TcOGNT2 was included as a control. (C) P100 fractions from TcOGNT2myc-expressing and pTEX control epimastigotes were compared using affinity-purified anti-TcOGNT2. (D) N-Glycosylation analysis. P100 fractions (100 ␮g of protein) from TcOGNT2myc-expressing and pTEX control epimastigotes were analyzed after treatment with active (⫹) or heat-inactivated (⫺) PNGase F or endo H, using anti-TcOGNT2 as described above. ⌬TcOGNT2 (lanes 5) was included as a control.

T. cruzi TcOGNT2 and Metacyclogenesis

creased activity, and as expected, cells expressing the mutant proteins did not exhibit any change. Enzyme activity was distributed among the cell fractions (Fig. 1B) in proportion to the TcOGNT2myc levels (data not shown). The TcOGNT2myc extracts also exhibited a 5-fold increase in peptide-independent UDP-GlcNAc hydrolysis activity relative to pTEX extracts (Fig. 2B), an activity that was previously associated with ⌬TcOGNT2 (N-terminally truncated to remove the membrane anchor) expressed in L. tarentolae (21). As expected, extracts of mutant TcOGNT2-expressing cells did not exhibit increased hydrolysis activity. Thus, 7-fold-increased protein expression of TcOGNT2 was accompanied by 5-fold-increased hydrolysis activity but only 1.5-fold-increased transferase activity, indicating that some other factor is limiting for pp␣GlcNAcT activity in these extracts. Compartmentalization of endogenous and overexpressed TcOGNT2. Affinity-purified antiserum was used to compare the localization of TcOGNT2 and overexpressed TcOGNT2myc in cells. Analysis of pTEX control cells revealed a single major locus of accumulation of TcOGNT2 (Fig. 3A) that always colocalized with the Golgi apparatus (Fig. 3B), based on labeling with a BODIPY-labeled C5-ceramide-BSA complex (55). This punctate labeling was not observed using preimmune serum (Fig. 3A). Sim-

October 2014 Volume 13 Number 10

ec.asm.org 1317

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 2 Enzymatic activities of TcOGNT2myc expression strains. pp␣GlcNAcT (A) and UDP-GlcNAc hydrolysis (B) activities in epimastigote microsomal (P100) fractions from the TcOGNT2myc expression and pTEX control strains were measured using UDP-[3H]GlcNAc. As indicated, assays were performed in the absence (⫺) or presence (⫹) of the T16 peptide acceptor substrate. Experiments were performed 3 times in triplicate, and the results are expressed as means and standard errors of the means (SEM). Significant increases relative to the pTEX control are indicated as follows: *, P ⬍ 0.05; and ***, P ⬍ 0.001.

ilar findings were observed for overexpressed TcOGNT2myc, though most of the cells (⬃70%; n ⫽ 200) exhibited multiple sites of accumulation (Fig. 3C) that were dissimilar to the rough endoplasmic reticulum (rER), whose resident proteins, such as BiP and calreticulin, exhibit a punctate pattern throughout the cell body and around the nucleus (68, 69). Simultaneous localization of cruzipain, a marker for the reservosome, shows that these compartments also appear independent of this organelle. The localization pattern of the ASH mutant was similar (data not shown). The unexpectedly low transferase activity of microsomes from TcOGNT2myc-overexpressing cells (Fig. 2) might be due to the extra-Golgi localization of some of the protein. The predominant Golgi association of the endogenous protein is consistent with previous cell fractionation results (Fig. 1B) (20, 23). Developmental regulation of TcOGNT2 expression in insect-stage parasites. Epimastigotes were subjected to nutritional stress in TAU-P medium to induce metacyclogenesis. Efficient metacyclogenesis was confirmed by a reduction in the total cruzipain level (Fig. 4A, bottom panel, compare lanes 3 and 4). The resulting MCT preparation was analyzed for TcOGNT2 expression and total pp␣GlcNAcT activity in comparison with epimastigotes and TcOGNT2myc-expressing epimastigotes. As shown by Western blotting of total cell membranes using the affinity-purified antiserum, TcOGNT2 protein levels decreased to undetectable levels in the MCT preparation (Fig. 4A, top panel, compare lanes 3 and 4). Analysis of crude membranes from these preparations showed a 40% reduction in pp␣GlcNAcT activity in the MCT preparation compared to that in epimastigotes, in contrast to the increased activity in the TcOGNT2-overexpressing cells (Fig. 4B). The remaining activity may have been contributed by non-MCTs remaining in the preparation and by the other predicted pp␣GlcNAcT, TcOGNT1. In addition, TcOGNT2 was not observed in MCTs by immunofluorescence assay (data not shown). Thus, in vitro metacyclogenesis is associated with a major downregulation of the TcOGNT2 protein and associated pp␣GlcNAcT activity. Inhibition of metacyclogenesis by TcOGNT2 overexpression. The proliferation of TcOGNT2myc-expressing cells was indistinguishable from that of wild-type or pTEX cells in standard medium (Fig. 5A). In contrast, these cells were highly deficient in the ability to undergo metacyclogenesis in aged cultures, based on cell morphology (Fig. 5B). To examine the generality of this finding, metacyclogenesis was also induced in TAU-P medium (29) and monitored not only by morphology but also by resistance to complement killing at multiple times and by MCT stage-specific marker expression. As shown in Fig. 5C to F, similar inhibitions of metacyclogenesis were recorded at two times in TAU-P medium. In addition, the metacyclic stage-specific surface antigens gp90 and gp82 (70) failed to be induced detectably in the population (Fig. 6A). However, immunofluorescence analysis showed that the MCTs that did differentiate from cells expressing either active or mutant TcOGNT2myc expressed gp90 normally (data not shown). Furthermore, as also presented in Fig. 5 and 6, similar findings were observed for the mutant TcOGNT2myc-expressing strains, indicating that the effect of TcOGNT2 overexpression was independent of its enzymatic activities. Parallel cultures transfected with the empty pTEX vector differentiated normally. Metacyclogenesis is a multistep process in which initial substratum adhesion is followed by release and subsequent morphological and biochemical differentiation (see the introduction).

Koeller et al.

preimmune sera applied to wt epimastigotes and analyzed by standard epifluorescence microscopy. Arrows indicate single Golgi-like localizations near DAPIlabeled nuclei and kinetoplasts. Control (pTEX) (B) or TcOGNT2myc-expressing (C) epimastigote forms were colabeled with affinity-purified anti-TcOGNT2 and rabbit anti-cruzipain (reservosome marker) or the BODIPY FL C5-ceramide-BSA complex (Golgi marker), as indicated. Maximum projection images collected by confocal microscopy are shown. DAPI staining is shown in blue.

Adhesion was monitored using both tissue culture flask plastic (29) and preparations of insect midgut mucosa (27). As shown in Fig. 6B, no significant change in the capacity for attachment to plastic was observed among the different transfected parasites, since the same numbers of unattached epimastigotes were found in the supernatants. Furthermore, all strains were equally able to attach to freshly dissected posterior midgut epithelia from the vector R. prolixus (Fig. 6C), whereas only the overexpression strains were unable to transform into MCTs after contact with R. prolixus in vivo (see Fig. S2B in the supplemental material). Since high intracellular cAMP levels inhibit cell proliferation (14) and, after adhesion, increased cAMP is accompanied by increased transformation of epimastigotes into MCTs (33), we considered whether cAMP production might be inhibited. Thus, we supple-

1318

ec.asm.org

mented the TAU-P medium with a stable and cell-permeative cAMP analogue (dibutyryl-cAMP) that is a well-known stimulator of metacyclogenesis (33). Metacyclogenesis was not stimulated in the TcOGNT2-overexpressing strains (see Fig. S2A), indicating that the blockade occurred downstream of cAMP signaling. Interestingly, the overexpressing strains showed a modest metacyclogenic response to a high concentration of GlcNAc (250 mM), which was not observed with Glc. Thus, the overexpressors retained a hidden ability to transform, and the blockade appeared to occur upstream of the intersection of GlcNAc signaling with intrinsic regulation, though the nature of this intersection is unknown. Impact of TcOGNT2 overexpression on O-glycosylation. Cellular O-glycosylation levels were examined by multiple ap-

Eukaryotic Cell

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 3 Immunofluorescence localization of endogenous and overexpressed TcOGNT2myc. (A) Comparison of non-affinity-purified anti-TcOGNT2 and

T. cruzi TcOGNT2 and Metacyclogenesis

proaches. Probing of Western blots of whole epimastigotes with MAbs 2B10 and 10D2, directed toward highly O-glycosylated major 35/50-kDa mucin populations (24), failed to detect a change in either mucin glycoprotein mobility during SDS-PAGE or labeling intensity (Fig. 7A). These MAbs preferentially react with galactopyranose (7) and galactofuranose (53) residues, respectively, consistent with little or no change in natively Gal-rich O-glycans. Similarly, no effect of MAbs J01 and 212 was observed on cruzipain (52) (Fig. 7B), which is alternatively compartmentalized in the reservosome, flagellar pocket, and plasma membrane (71, 72) and expresses truncated O-glycans (see the introduction). To test for more subtle changes in O-glycome profiles, O-glycans were released from a mucin-enriched preparation by ␤-elimination and derivatized by permethylation to facilitate analysis by MALDI-TOF MS. Except for the larger amount of sialic acidcontaining oligosaccharides, O-glycans detected here matched those described previously for the Dm28c strain (73). As shown in Fig. 7B and in Fig. S3 in the supplemental material, quantitation failed to detect a statistically different change in O-glycan class compositions between TcOGNT2-overexpression and normal strains. Finally, normal and TcOGNT2-overexpressing epimastigotes were incubated with fluorescent lectins, and labeling was quantitated by flow cytometry. Initial correlation of forward- and sidescattered light measurements recognized a single, though hetero-

October 2014 Volume 13 Number 10

ec.asm.org 1319

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 4 Downregulation of TcOGNT2 and pp␣GlcNAcT activities during metacyclogenesis. (A) Western blot detection of TcOGNT2. Total membrane extracts prepared from wt epimastigotes (lanes 3) or parasites induced in TAU-P (MCT enriched; lanes 4) were sequentially probed with affinity-purified anti-TcOGNT2 (top) and rabbit anti-cruzipain (bottom) and separately imaged using distinct Alexa Fluor-coupled secondary Abs. Blots also contained a similar extract from TcOGNT2myc-expressing epimastigotes (lanes 5) and ⌬TcOGNT2-positive (lanes 2) and -negative (lanes 1) conditioned media from L. tarentolae, as controls. The migration positions of endogenous TcOGNT2 expressed by epimastigotes (closed arrowhead) and metacyclic trypomastigotes (MCTs) (open arrowhead) are indicated, together with overexpressed TcOGNT2myc (closed arrow) and ⌬TcOGNT2 and its N-terminal proteolytic fragment (open arrows). The position of intact membrane-associated cruzipain (arrow) is shown in the bottom panel. (B) pp␣GlcNAcT activities in crude membrane extracts obtained from wt epimastigotes, MCT-enriched cultures, and epimastigotes overexpressing wt TcOGNT2(DSH)myc. Samples (5 ⫻ 106 cell equivalents reaction mix⫺1) from panel A were assayed as described in the legend to Fig. 2A, in the absence or presence of the T16 peptide. Values are means and SEM (n ⫽ 3). Asterisks indicate statistical significance as follows: **, P ⬍ 0.01; and ***, P ⬍ 0.001. The percentages of metacyclic forms (⫾ SEM) were determined by morphology.

dispersed, population of parasites, based on their cell surface area, size, or cell granularity (not shown). However, plots of forward versus side scatter did not show any significant change in comparing populations of parasites transfected with the different pTEX versions (not shown). After proper gating around the population of interest, flow cytometric analyses were performed with fixed epimastigotes that were labeled with fluorescent WGA, ConA, and GS-IB4 lectins. The percentage of labeled cells and the mean values of peak fluorescence intensities were indistinguishable among the strains (see Fig. S4 in the supplemental material). Taken together, the data show no evidence that the presence of ectopic TcOGNT2 proteins in the Golgi apparatus or other compartments had an impact on Golgi glycosylation functions in epimastigotes. Cruzipain status. Previous studies showed that inhibition of cruzipain pharmacologically (74) or by overexpression of the natural endogenous inhibitor chagasin (75) arrested parasite differentiation in vitro. To address the potential that TcOGNT2myc might act by such a mechanism, the localization of TcOGNT2myc was investigated by confocal immunomicroscopy. As shown in Fig. 3C, little colocalization with cruzipain, which normally accumulates in the reservosome, was observed. To address this further, whole-parasite extracts (see Fig. S5 in the supplemental material) and P100 fractions (not shown) were assayed to compare cysteinespecific protease activities by using the fluorogenic protease substrate CBZ-FR-AMC and the E-64 inhibitor (51). However, no evidence of an effect of TcOGNT2 overexpression on cruzipain activity was detected (see Fig. S5). Impact of TcOGNT2 overexpression in cell-derived trypomastigote forms of T. cruzi. Although metacyclogenesis was inhibited in the TcOGNT2-overexpressing strains, occasional MCTs differentiated, based on morphology and resistance to lysis by the alternative pathway of complement (Fig. 5; see Fig. S2A in the supplemental material). Immunofluorescence observations using MAb 1G7 confirmed gp90 surface labeling equivalent to that of wt MCTs (not shown). To test their infectivity, scaled-up preparations were presented to cultured LLCMK2 cells at a multiplicity of infection (MOI) of 40. After 4 h of infection, TcOGNT2(DSH)myc TCTs infected fewer LLCMK2 cells than TcOGNT2(DSD)myc and control TCTs (Fig. 8A and B), but once they were infected, cells harbored similar numbers of amastigotes (Fig. 8C). Over time, this difference was reflected in a substantial delay in TCT accumulation and reduced overall numbers of TCTs in cells infected with TcOGNT2(DSH)myc relative to the other strains (Fig. 8D). When the TCTs that appeared were allowed to revert to proliferative epimastigotes and retested for metacyclogenesis, the frequency of conversion of TcOGNT2(DSH)myc-overexpressing cells remained low (Fig. 8E and F), showing that impaired MCT differentiation did not simply reflect selection for previously competent cells. TCTs downregulated endogenous TcOGNT2 protein (Fig. 9A) and activity (Fig. 9B) levels relative to those in epimastigotes, as observed above for MCTs (Fig. 4). In contrast, TcOGNT2myc expression was not reduced, suggesting that downregulation of endogenous TcOGNT2 was not posttranslational. To test the impact of forced TcOGNT2-myc overexpression on surface glycosylation, TCTstransfectedwithpTEX,pTEX-TcOGNT2(DSH)myc,orpTEXTcOGNT2(DSD)myc were incubated with fluorescent WGA, ConA, GS-IB4, and MAA lectins and analyzed by flow cytometry (see Fig. S6 in the supplemental material). Notably, TCTs overexpressing active TcOGNT2 presented significantly more labeling with WGA, based on the percentage of labeled cells and the mean

Koeller et al.

values of fluorescence intensities (Fig. 9C and D). No difference was seen in cells overexpressing mutant TcOGNT2(DSD)myc. Treatment of cells with neuraminidase caused only a slight decrease in WGA labeling and an increase in PNA labeling (not shown), suggesting that increased labeling was due to the other WGA ligand, GlcNAc, rather than sialic acid. No labeling difference was observed for the other lectins, including MAA, specific for ␣2,3-linked sialic acid. The cell surface remodeling of O-glycans as a result of forced overexpression of active TcOGNT2 may explain the reduced infectivity of these cells toward epithelial cells. DISCUSSION

We report here that as T. cruzi differentiates into either metacyclic or tissue culture trypomastigotes, endogenous TcOGNT2, which initiates O-glycosylation, is downregulated (at least 3-fold) to undetectable levels (Fig. 4 and 9A). To address the significance of this change, TcOGNT2myc was constitutively expressed from an alternative promoter. As a result, epimastigote differentiation into MCTs was dramatically inhibited and host cell invasion by TCTs

1320

ec.asm.org

was reduced, resulting in substantially reduced TCT production by monolayers. Mechanistic studies showed that inhibition of TCT production depended on the O-glycosylation function of TcOGNT2, whereas inhibition of metacyclogenesis was, in contrast, independent of its pp␣GlcNAcT activity and any evidence of perturbed O-glycosylation. The findings suggest that TCT O-glycosylation is regulated by changes in the protein level of this gatekeeper pp␣GlcNAcT and that the protein has important enzymatic and nonenzymatic roles in TCT differentiation and MCT function, respectively. TcOGNT2 protein downregulation. The TcOGNT2 protein was monitored by use of a new affinity-purified murine antiserum generated against recombinant TcOGNT2, because a previous rabbit antiserum proved too insensitive. The specificity of the new antibody was established based on (i) predominant reactivity with a cellular protein that migrates slightly more rapidly than transgenic TcOGNT2myc expressed in the same cells (Fig. 1C), near the expected 55-kDa position; (ii) N-glycosylation that is very similar to that of TcOGNT2myc (Fig. 1D); (iii) enrichment in a biochem-

Eukaryotic Cell

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 5 Metacyclogenic competence of TcOGNT2myc-expressing strains. (A) Proliferation of epimastigotes transfected with pTEX (control; open squares) or pTEX containing wt TcOGNT2myc (DSH; black squares) or mutant TcOGNT2myc (ASH, blue squares; NSH, light blue squares; and DSD, green squares) was assessed by daily counting in a Neubauer chamber. (B) Percentages of metacyclic forms in aged BHI medium cultures (16 days) were estimated by morphology. (C to F) Metacyclogenesis was induced in TAU-P medium, and the percentage of MCTs was evaluated by morphology (C and D) or resistance to lysis by the alternative pathway of complement (E and F) after 3 (C and E) or 5 (D and F) days of culture. Results are means and SEM from three independent experiments performed in triplicate. Asterisks indicate statistical significance compared to controls, as follows: *, P ⬍ 0.05; **, P ⬍ 0.01; and ***, P ⬍ 0.001.

T. cruzi TcOGNT2 and Metacyclogenesis

(A) Expression of mucin-like glycoproteins by parasites transfected with the different pTEX constructs (color coded as indicated) was examined by Western blotting after 3 days of differentiation in TAU-P medium, using MAb 10D8 (anti-gp35/50), MAb 1G7 (anti-gp90), and MAb 3F6 (antigp82). Anti-␣-tubulin served as a loading control. (B) Transfected epimastigotes were maintained for 3 days in TAU-P medium, and the number of parasites in each culture supernatant was estimated by direct counting using a Neubauer chamber. (C) Epimastigotes (2 ⫻ 106) were incubated with the surfaces of dissected posterior midguts of Rhodnius prolixus insects for 1 h, and the number of attached parasites was estimated by direct counting. Results are from 4 independent experiments with 5 replicates each and are expressed as means and SEM. No statistically significant differences were observed.

October 2014 Volume 13 Number 10

ec.asm.org 1321

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 6 Metacyclic markers and activities after metacyclogenic induction.

ically generated microsomal fraction; and (iv) microscopic colocalization with the Golgi apparatus (Fig. 3A and B), the compartment of its function, based on previous pp␣GlcNAcT activity studies (23). This antiserum showed reductions of the native TcOGNT2 protein to near undetectable levels, which was corroborated by reduced pp␣GlcNAcT activity in extracts (Fig. 4 and 9). The decline in TcOGNT2 level was not, however, observed in a recent study employing a different rabbit antiserum (76). That antiserum was raised against a TcOGNT2 fragment representing ⬍30% of the full protein and was not affinity purified. Other than its apparent Mr and microsomal enrichment, the reactive protein antigen was not validated and, in fact, accumulated more in the reservosome than in the Golgi apparatus. Our target antigen, as expected, was observed to be strictly Golgi associated and N-glycosylated, like transgenic TcOGNT2myc, and it was observed to migrate slightly behind TcOGNT2, as expected based on the myc tag. We concluded from this comparison that TcOGNT2 is a Golgi apparatus resident that declines during trypomastigote differentiation and that an alternative protein recognized by the other antiserum (76) increases during differentiation and preferentially resides in the reservosome. The decline in MCT TcOGNT2 observed with our murine Ab does not correlate with expression of the core proteins (69) but is consistent with reduced biosynthetic needs of noncycling MCTs, whose O-glycosylation needs might instead be supported by TcOGNT1, the only other predicted pp␣GlcNAcT (21). The existence of only two pp␣GlcNAcT proteins contrasts with the multitudes of mucin protein cores (10) and predicted ␤GalT and trans-sialidase enzymes that modify them (77) and implies that TcOGNT2 and TcOGNT1 might together serve a gatekeeper function to regulate the extent of mucin-type O-glycosylation, especially in TCTs (Fig. 9). Further studies on TcOGNT1 are needed to investigate this possibility. Constitutive overexpression of TcOGNT2. Expression from the pTEX construct yielded constitutive TcOGNT2myc levels in epimastigotes that were 7-fold higher than endogenous protein levels (Fig. 1C). These values are comparable to those from other studies using pTEX or pTEX-derived vectors to overexpress proteins in the cytosol (78, 79), mitochondria (80), glycosomes (81), endosomal/lysosomal system and reservosomes (75, 82), ER (68), flagellar pocket (83), or plasma membrane (69, 84–86) of T. cruzi. The protein was stable, with no indication of a C-terminal proteolytic cleavage event observed when expressed in L. tarentolae (21), and it appeared to be inserted into the rER and N-glycosylated normally (Fig. 1D). A catalytically active status of the expressed enzyme was indicated by the corresponding 5-fold increase in UDP-[3H]GlcNAc hydrolysis activity relative to that of controls (Fig. 2). However, pp␣GlcNAcT activity was increased only 1.5-fold (Fig. 2). These increases were directly attributed to TcOGNT2, since they were not induced by the catalytically dead variants tested. The difference between activity and protein levels suggests a normally tight physiological regulation of transferase activity. This was consistent with the failure to detect increased O-glycosylation based on analysis of mucins by use of anti-mucin or anti-cruzipain antibodies or mass spectrometry (Fig. 7), or by lectin flow cytometry of cells (see Fig. S4 in the supplemental material), though the alternative explanation, that O-glycosylation is normally already saturated, cannot be excluded. Immunofluorescence studies indicated that though the majority of overexpressed TcOGNT2 was localized normally in the Golgi apparatus,

Koeller et al.

some protein was distributed in nearby compartments other than the ER and reservosomes (Fig. 3B), which might not support activity. Alternatively, TcOGNT2 transferase activity might be regulated by another factor. For example, the glycosyltransferases EXT1 and EXT2 must be coexpressed for heparan sulfate biosynthesis (87), and similarly, POMT1 and POMT2 are mutually required for mammalian protein O-mannosylation (88). In other cases, less closely related proteins are required, such as fukutin for POMGnT1 to glycosylate ␣-dystroglycan (89), Cosmc for the mammalian core 1 ␤3-GalT (90), and a Drosophila DHHC protein family-related protein for ␤4GalNAcTB (91). Interestingly, Cosmc and GnT1IP, an inhibitor of murine GnT1 (92), are distantly related to the glycosyltransferases that they regulate, which is reminiscent of the distant similarity of TcOGNTL, which lacks important catalytic residues, to TcOGNT2 (and TcOGNT1).

1322

ec.asm.org

Thus, the potential roles of TcOGNTL and TcOGNT1 in controlling TcOGNT2 activity deserve further investigation. The possibility of a positive rather than a negative regulator is implied by the inactivity of TcOGNT2 when expressed in another protist, i.e., Dictyostelium (21). Constitutive TcOGNT2 expression inhibits metacyclogenesis. Cells that constitutively overexpressed TcOGNT2myc were severely deficient in the ability to differentiate into MCTs, using either of three methods of induction, including introduction into the insect host (Fig. 5B to D; see Fig. S2B in the supplemental material). Further studies showed that inhibition occurred at a stage after initial adhesion to the insect vector midgut substratum (Fig. 6B and C) but prior to induction of complement resistance (Fig. 5E and F) or the metacyclic mucins gp90 and gp82 (Fig. 6A). Interestingly, metacyclogenesis was enhanced by high concentra-

Eukaryotic Cell

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 7 O-Glycosylation studies. (A and B) Expression of mucin-like glycoproteins (lanes 1 to 5) and cruzipain (lanes 7 to 9) in epimastigotes transfected with the different pTEX constructs was monitored by Western blotting as described in the legend to Fig. 1, using the indicated MAbs. Lanes 6 contain purified recombinant cruzipain as a positive control. (C) O-Glycomic studies. Mucin-like glycoproteins from epimastigotes transfected with pTEX (control; white bars) or expressing wt TcOGNT2 (black bars) or mutant TcOGNT2 (DSD; green bars) were subjected to ␤-elimination, and the released glycans were permethylated and profiled by MALDI-TOF MS in positive-ion mode. Examples of spectra are shown in Fig. S2 in the supplemental material. O-Glycan classes are labeled according to their hexose (H), N-acetylhexosamine (N), and N-acetylneuraminic acid (Sa) compositions, and their abundances were quantified as ratios relative to a standard N-glycan (H5N2) ion used as an internal reference. Data (means and SEM) are results from 5 independent experiments (n ⫽ 5).

T. cruzi TcOGNT2 and Metacyclogenesis

TcOGNT2(DSD)myc (green bars) were isolated from the culture medium of LLCMK2 cells (monkey kidney epithelial cells) infected with MCTs induced in vitro from epimastigotes. (A to C) LLCMK2 cells plated on glass coverslips in 24-well plates were incubated with TCTs at an MOI of 20 parasites per cell. After 4 h, wells were washed 5 times, and the coverslips were fixed and stained with InstantProv hematological stain. The numbers of total (A) and infected (B) epithelial cells per field and the number of amastigotes per infected cell (C) were estimated by direct counting of ⱖ300 fields. (D) LLCMK2 cells were incubated with TCTs at an MOI of 20. After 4 h, each culture flask was washed 5 times, followed by incubation for 11 days. TCT density was determined by direct counting. (E and F) Epimastigotes derived from TCT forms were transferred to TAU-P and incubated at 28°C to induce metacyclogenesis. After 3 days, parasite density (E) was determined by direct counting, and the percentage of MCTs was estimated by resistance to lysis by the alternative pathway of complement (F). Results are means ⫾ SD from three independent experiments (n ⫽ 2). Asterisks indicate statistical significance (***, P ⬍ 0.001).

tions of free GlcNAc, in a sugar-specific fashion (see Fig. S2A), suggesting that signaling is involved. cAMP is involved in the induction of metacyclogenesis through activation of adenylate cyclase and PKA (14, 33), but db-cAMP was unable to overcome inhibition (see Fig. S2A), suggesting that TcOGNT2 renders its effects downstream. There was no evidence for effects on cruz-

ipain (Fig. 3B; see Fig. S5), whose inhibition can also inhibit metacyclogenesis. The inhibition of metacyclogenesis by TcOGNT2 overexpression was far stronger than in the case of cruzipain inhibition by chagasin overexpression (75), and it did not involve intermediary forms or death as observed with overexpression of the Ras-related GTP-binding protein TcRjl (83). The reduced

FIG 9 Biochemical analysis of TcOGNT2myc-expressing TCTs. (A) TCTs or epimastigotes from strains transfected with pTEX (⫺) or wt TcOGNT2(DSH)myc (⫹) were subjected to SDS-PAGE and Western blotted using anti-TcOGNT2 (top) or anti-tubulin (bottom). Protein standards are indicated on the right, in kDa. (B) pp␣GlcNAcT activity in crude membrane extracts obtained from TCTs transfected with pTEX vector (white bars), pTEXTcOGNT2myc-DSH (black bars), or pTEX-TcOGNT2myc-DSD (green bars). Samples (5 ⫻ 106 cell equivalents reaction mix⫺1) were assayed as described in the legend to Fig. 2A, in the absence (⫺) or presence (⫹) of the T16 peptide. Values are means and SD (n ⫽ 3). (C and D) TCTs (5 ⫻ 106) were incubated with fluorescent WGA, ConA, GS-IB4, or MAA lectin and analyzed by flow cytometry as shown in Fig. S6 in the supplemental material. Graphs summarize the percentages of labeled cells (C) and the mean fluorescence intensities (D) for each lectin. Bars represent the means and SEM from at least 3 independent experiments (n ⫽ 3). Asterisks indicate statistical significance compared to control cells transfected with empty pTEX or pTEX-TcOGNT2(DSD)myc, as follows: *, P ⬍ 0.05; and ***, 0.001.

October 2014 Volume 13 Number 10

ec.asm.org 1323

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

FIG 8 Cell culture-derived trypomastigotes (TCTs). TCTs transfected with pTEX (white bars), pTEX-TcOGNT2(DSH)myc (black bars), or pTEX-

Koeller et al.

1324

ec.asm.org

dogenous untagged protein, similar N-glycosylation, predominant Golgi localization, increased enzyme activity in extracts, and altered lectin reactivity of cells. The protein detected in the other strain, whose Mr was not described, by an antiserum with uncertain specificity (see above) may not have been active or might represent another protein induced by the transformation. In conclusion, TcOGNT2 overexpression was found to be inhibitory to T. cruzi cells only at those stages where its expression is normally downregulated—MCTs and TCTs. But the mechanisms were distinct: nonenzymatic for MCT production and enzymatic for TCT production. TcOGNT2 has thus far been intractable to gene disruption studies to extend these findings, but inducible expression approaches directed toward TcOGNT2, TcOGNT1, and TcOGNTL are expected to provide additional insights into the underlying mechanisms of control. ACKNOWLEDGMENTS We acknowledge Nobuko Yoshida (UNIFESP, São Paulo, Brazil) for providing MAbs 10D8, 2B10, 3F6, and 1G7, Ana Paula Cabral de Araújo Lima (IBCCF-UFRJ, Rio de Janeiro, Brazil) for providing an aliquot of purified recombinant cruzipain, the rabbit polyclonal antibody, and MAbs J01 and 212 against cruzipain, and Paula Bittencourt-Cunha for helpful assistance with the in vivo Rhodnius prolixus infections. This work was supported by grants from FIRCA-NIH (grant 1R03TW008725-01 to C.M.W. and N.H.), Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). N.H. was the beneficiary of a short ESN-CsF fellowship from CNPq (grant 202407/2011-0). C.M.K. was a partial CNPq Ph.D. fellow, was the recipient of a FAPERJ Ph.D./Sandwich fellowship (grant E-26/101.707/2011) from December 2011 to November 2012, and is now a “Bolsista Doutorado Nota 10” of FAPERJ (2013 to 2014).

REFERENCES 1. Leslie M. 2011. Drug developers finally take aim at a neglected disease. Science 333:933–935. http://dx.doi.org/10.1126/science.333.6045.933. 2. Azambuja P, Ratcliffe NA, Garcia ES. 2005. Towards an understanding of the interaction of Trypanosoma cruzi and T. rangeli within the reduviid insect host Rhodnius prolixus. An. Acad. Bras. Ci. 77:397– 404. http://dx .doi.org/10.1590/S0001-37652005000300004. 3. Fernandes MC, Andrews NW. 2012. Host cell invasion by Trypanosoma cruzi: a unique strategy that promotes persistence. FEMS Microbiol. Rev. 36:734 –747. http://dx.doi.org/10.1111/j.1574-6976.2012.00333.x. 4. Carvalho-Moreira CJ, Spata MCD, Coura JR, Garcia ES, Azambuja P, Gonzalez MS, Mello CB. 2003. In vivo and in vitro metacyclogenesis tests of two strains of Trypanosoma cruzi in the triatomine vectors Triatoma pseudomaculata and Rhodnius neglectus: short/long-term and comparative study. Exp. Parasitol. 103:102–111. http://dx.doi.org/10.1016/S0014 -4894(03)00072-9. 5. Dias E. 1934. Estudos sobre o Schyzotrypanum cruzi. Mem. Inst. Oswaldo Cruz 28:1–110. 6. Butler CE, Tyler KM. 2012. Membrane traffic and synaptic cross-talk during host cell entry by Trypanosoma cruzi. Cell. Microbiol. 14:1345– 1353. http://dx.doi.org/10.1111/j.1462-5822.2012.01818.x. 7. Yoshida N, Tyler KM, Llewellyn MS. 2011. Invasion mechanisms among emerging food-borne protozoan parasites. Trends Parasitol. 27:459 – 466. http://dx.doi.org/10.1016/j.pt.2011.06.006. 8. Cardoso de Almeida ML, Heise N. 1993. Proteins anchored via glycosylphosphatidylinositol and solubilizing phospholipases in Trypanosoma cruzi. Biol. Res. 26:285–312. 9. McConville MJ, Ferguson MAJ. 1993. The structure, biosynthesis and function of glycosylated phosphatidylinositols in parasitic protozoa and higher eukaryotes. Biochem. J. 294:305–324. 10. Buscaglia CA, Campo VA, Frasch AC, Di Noia JM. 2006. Trypanosoma cruzi surface mucins: host-dependent coat diversity. Nat. Rev. Microbiol. 4:229 –236. http://dx.doi.org/10.1038/nrmicro1351. 11. MacRae JI, Acosta-Serrano A, Morrice NA, Mehlert A, Ferguson MAJ.

Eukaryotic Cell

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

ability of cells to differentiate in the presence of sustained levels of TcOGNT2 suggests that TcOGNT2 is an important regulator of metacyclogenesis. Remarkably, inhibition did not depend on the catalytic activities of TcOGNT2myc. This was most conclusively indicated by introduction of either of 3 different inactivating point mutations (21) into the active site of the TcOGNT2myc transgene (Fig. 5 and 6). Thus, the inhibitory effect of the overexpressed proteins depended on a second function that is apparently unrelated to even indirect effects on protein glycosylation, based on the analysis of mucin O-glycosylation and cell level lectin flow cytometry (Fig. 7; see Fig. S4 in the supplemental material). Although it is difficult to exclude the possibility that the 7-fold overexpression of a single protein, such as TcOGNT2, inhibits metacyclogenesis by a nonspecific stress effect, it is notable that proliferation and TCT production were not affected (Fig. 8 and 9) and that overexpression of other proteins failed to inhibit this process (58, 68, 69, 78–82, 84–86). The protein burden of 7-fold accumulation of a single enzyme is not anticipated to be great, and indeed, overexpression of a truncated N-terminal fragment of the TcOGNT2 homolog TbOGNT2 in Trypanosoma brucei did not affect Golgi replication (93). However, overexpressed TcOGNT2s were also ectopically partially localized to an unknown compartment, which must be considered an alternative site of action of the overexpressed protein. The Golgi apparatus is an organelle of many functions, some of which are likely still undiscovered. Constitutive TcOGNT2 expression inhibits TCT production in host cells. Metacyclogenesis was not abolished by TcOGNT2, and the MCTs that appeared were normal, based on morphology, resistance to lysis by the alternative pathway of complement, gp90 stage-specific surface expression (Fig. 5; see Fig. S2 in the supplemental material; data not shown), and the general ability to infect cultured epithelial (LLCMK2) cells (Fig. 8A to C). Epimastigotes derived from these TCTs continued to overexpress TcOGNT2myc (Fig. 9A) and, again inefficiently, differentiated into MCTs (Fig. 8F). Therefore, TcOGNT2myc overexpression did not block metacyclogenesis, and breakthrough cells did not represent a resistant subpopulation. However, the TcOGNT2 cells were deficient in generating TCTs, which manifested both as a 2-day delay in TCT production and a 3-fold reduction in maximal numbers produced (Fig. 8D). Analysis of 4-h postinfection monolayers revealed a lower percentage of infected cells but nearly normal numbers of proliferating amastigotes per infected cell (Fig. 8A to C), suggesting that one deficit is initial cell infection. Cell surface glycosylation was affected in the TcOGNT2-overexpressing cells (Fig. 9C), which might inhibit the parasite-host interaction. A necessity for altered O-glycosylation was indicated by the lack of inhibition of TCT production by catalytically inactive TcOGNT2. Further studies are needed to determine the role of parasite cell surface glycosylation in infection. Recently, an independent strain of T. cruzi Dm28c was modified to overexpress TcOGNT2 by use of the pTEX plasmid system (76). This strain was described to yield increased amastigote numbers in Vero cells at a single time point of 3 days. The consequence of this on TCT production was not examined, and no reference was made to a deficit in metacyclogenesis. It is not clear why the impact of TcOGNT2 overexpression was so different in our strain. In our study, we validated that active TcOGNT2myc was overexpressed in TCTs by Mr determination relative to that of the en-

T. cruzi TcOGNT2 and Metacyclogenesis

12.

13. 14.

16. 17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

October 2014 Volume 13 Number 10

28. 29.

30.

31. 32.

33.

34.

35. 36.

37.

38.

39. 40. 41.

42.

43.

44.

45.

soma cruzi with the intestinal tract of the vector Triatoma infestans. Acta Trop. 70:127–141. http://dx.doi.org/10.1016/S0001-706X(97)00117-4. Camargo EP. 1964. Growth and differentiation of Trypanosoma cruzi. I. Origin of metacyclic trypomastigotes in liquid media. Rev. Inst. Med. Trop. São Paulo 6:93–100. Contreras V, Salles J, Thomas N, Morel C, Goldenberg S. 1985. In vitro differentiation of Trypanosoma cruzi under chemically defined conditions. Mol. Biochem. Parasitol. 16:315–327. http://dx.doi.org/10.1016 /0166-6851(85)90073-8. Heise N, Raper J, Buxbaum L, Peranovich TMS, Cardoso de Almeida ML. 1996. Identification of complete precursors of glycosylphosphatidylinositol protein anchors of Trypanosoma cruzi. J. Biol. Chem. 271:16877– 16887. http://dx.doi.org/10.1074/jbc.271.28.16877. Bonaldo MC, Souto-Padrón T, De Souza W, Goldenberg S. 1988. Cell-substrate adhesion during Trypanosoma cruzi differentiation. J. Cell Biol. 106:1349 –1358. http://dx.doi.org/10.1083/jcb.106.4.1349. Elias MC, da Cunha JP, de Faria FP, Mortara RA, Freymuller E, Schenkman S. 2007. Morphological events during Trypanosoma cruzi cell cycle. Protist 158:147–157. http://dx.doi.org/10.1016/j.protis.2006.10 .002. Gonzales-Perdomo M, Romero P, Goldenberg S. 1988. Cyclic AMP and adenylate cyclase activators stimulate Trypanosoma cruzi differentiation. Exp. Parasitol. 66:205–212. http://dx.doi.org/10.1016/0014-4894 (88)90092-6. Fraidenraich D, Peña C, Isola EL, Lammel EM, Coso O, Añel AD, Pongor S, Barrale F, Torres HN, Flawia MM. 1993. Stimulation of Trypanosoma cruzi adenylyl cyclase by an ␣-D-globin fragment from Triatoma hindgut. Effect of differentiation of epimastigotes to trypomastigotes forms. Proc. Natl. Acad. Sci. U. S. A. 90:10140 –10144. Bao Y, Weiss LM, Braunstein VL, Huang H. 2008. Role of protein kinase A in Trypanosoma cruzi. Infect. Immun. 76:4757– 4763. http://dx.doi.org /10.1128/IAI.00527-08. Bonaldo MC, Scharfstein J, Murta AC, Goldenberg S. 1991. Further characterization of Trypanosoma cruzi GP57/51 as the major antigen expressed by differentiating epimastigotes. Parasitol. Res. 77:567–571. http: //dx.doi.org/10.1007/BF00931014. Sant’Anna C, Parussini F, Lourenço D, De Souza W. 2008. All Trypanosoma cruzi developmental forms present lysosomal-related organelles. Histochem. Cell Biol. 130:1187–1198. http://dx.doi.org/10.1007/s00418 -008-0486-8. Golgher DB, Colli W, Souto-Padrón T, Zingales B. 1993. Galactofuranose-containing glycoconjugates of epimastigotes and trypomastigotes of Trypanosoma cruzi. Mol. Biochem. Parasitol. 60:249 –264. http://dx.doi .org/10.1016/0166-6851(93)90136-L. Nogueira N, Bianco C, Cohn Z. 1975. Studies on the selective lysis and purification of Trypanosoma cruzi. J. Exp. Med. 142:224 –229. http://dx .doi.org/10.1084/jem.142.1.224. Norris KA, Schrimpf JE, Szabo MJ. 1997. Identification of the gene family encoding the 160-kilodalton Trypanosoma cruzi complement regulatory protein. Infect. Immun. 65:349 –357. West CM, van der Wel H, Sassi S, Gaucher EA. 2004. Cytoplasmic glycosylation of protein-hydroxyproline and its relationship to other glycosylation pathways. Biochim. Biophys. Acta 1673:29 – 44. http://dx.doi .org/10.1016/j.bbagen.2004.04.007. Wang F, Metcalf T, van der Wel H, West CM. 2003. Initiation of mucin-type O-glycosylation in Dictyostelium is homologous to the corresponding step in animals and is important for spore coat function. J. Biol. Chem. 278:51395–51407. http://dx.doi.org/10.1074/jbc.M308756200. Ercan A, West CM. 2005. Kinetic analysis of a Golgi UDP-GlcNAc: polypeptide-Thr/Ser N-acetyl-␣-glucosaminyltransferase from Dictyostelium. Glycobiology 15:489 –500. http://dx.doi.org/10.1093/glycob /cwi034. Bisaggio DFR, Campanati L, Pinto RCV, Souto-Padron T. 2006. Effect of suramin on trypomastigote forms of Trypanosoma cruzi: changes on cell motility and on the ultrastructure of the flagellum-cell body attachment region. Acta Trop. 98:162–175. http://dx.doi.org/10.1016/j.actatropica .2006.04.003. Aguiar PHN, Furtado C, Repolês BM, Ribeiro GA, Mendes IC, Peloso EF, Gadelha FR, Macedo AM, Franco GR, Pena SDJ, Teixeira SMR, Vieira LQ, Guarneri AA, Andrade LO, Machado CR. 2013. Oxidative stress and DNA lesions: the role of 8-oxoguanine lesions in Trypanosoma cruzi cell viability. PLoS Negl. Trop. Dis. 7:e2279. http://dx.doi.org/10 .1371/journal.pntd.0002279.

ec.asm.org 1325

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

15.

2005. Structural characterization of NETNES, a novel glycoconjugate in Trypanosoma cruzi epimastigotes. J. Biol. Chem. 280:12201–12211. http: //dx.doi.org/10.1074/jbc.M412939200. De Pablos LM, González GG, Parada JS, Hidalgo VS, Lozano IMD, Samblás MMG, Bustos TC, Osuna O. 2011. Differential expression and characterization of a member of the mucin-associated surface protein family secreted by Trypanosoma cruzi. Infect. Immun. 79:3993– 4001. http://dx.doi.org/10.1128/IAI.05329-11. Schenkman S, Eichinger D, Pereira ME, Nussenzweig V. 1994. Structural and functional properties of Trypanosoma trans-sialidase. Annu. Rev. Microbiol. 48:499 –523. Goldenberg S, Avilla AR. 2011. Aspects of Trypanosoma cruzi stage differentiation. Adv. Parasitol. 75:285–305. http://dx.doi.org/10.1016/B978 -0-12-385863-4.00013-7. Alvarez VE, Niemirowicz GT, Cazzulo JJ. 2012. The peptidases of Trypanosoma cruzi: digestive enzymes, virulence factors, and mediators of autophagy and programmed cell death. Biochim. Biophys. Acta 1824:195– 206. http://dx.doi.org/10.1016/j.bbapap.2011.05.011. Giorgi ME, de Lederkremer RM. 2011. Trans-sialidase and mucins of Trypanosoma cruzi: an important interplay for the parasite. Carbohydr. Res. 346:1389 –1393. http://dx.doi.org/10.1016/j.carres.2011.04.006. Almeida IC, Ferguson MAJ, Schenkman S, Travassos LR. 1994. Lytic anti-alpha-galactosyl antibodies from patients with chronic Chagas’ disease recognize novel O-linked oligosaccharides on mucin-like glycosylphosphatidylinositol-anchored glycoproteins of Trypanosoma cruzi. Biochem. J. 304:793– 802. Previato JO, Jones C, Gonçalves LP, Wait R, Travassos LR, MendonçaPreviato L. 1994. O-Glycosidically linked N-acetylglucosamine-bound oligosaccharides from glycoproteins of Trypanosoma cruzi. Biochem. J. 301:151–159. Serrano AA, Schenkman S, Yoshida N, Mehlert A, Richardson JM, Ferguson MAJ. 1995. The lipid structure of the glycosylphosphatidylinositol-anchored mucin-like sialic acid acceptors of Trypanosoma cruzi changes during parasite differentiation from epimastigotes to infective metacyclic trypomastigotes. J. Biol. Chem. 270:27244 –27253. http://dx .doi.org/10.1074/jbc.270.45.27244. Previato JO, Sola-Penna M, Agrellos OA, Jones C, Oeltmann T, Travassos LR, Mendonça-Previato L. 1998. Biosynthesis of O-Nacetylglucosamine-linked glycans in Trypanosoma cruzi. Characterization of the novel uridine diphospho-N-acetylglucosamine:polypeptide Nacetylglucosaminyltransferase-catalyzing formation of N-acetylglucosamine-␣1¡O-threonine. J. Biol. Chem. 273:14982–14988. Heise N, Singh D, van der Wel H, Sassi SO, Johnson JM, Feasley CM, Koeller CM, Previato JO, Mendonça-Previato L, West CM. 2009. Molecular analysis of a UDP-GlcNAc:polypeptide ␣-N-acetylglucosaminyltransferase implicated in the initiation of mucin-type O-glycosylation in Trypanosoma cruzi. Glycobiology 19:918 –933. http://dx.doi.org/10.1093 /glycob/cwp068. Mendonça-Previato L, Penha L, Garcez TC, Jones C, Previato JO. 2013. Addition of ␣-O-GlcNAc to threonine residues defines the posttranslational modification of mucin-like molecules in Trypanosoma cruzi. Glyconj. J. 30: 659 – 666. http://dx.doi.org/10.1007/s10719-013-9469-7. Morgado-Diaz JA, Nakamura CV, Agrellos OA, Dias WB, Previato JO, Mendonça-Previato L, De Souza W. 2001. Isolation and characterization of the Golgi complex of the protozoan Trypanosoma cruzi. Parasitology 123:33– 43. http://dx.doi.org/10.1017/S0031182001007946. Schenkman S, Ferguson MAJ, Heise N, Cardoso de Almeida ML, Mortara RA, Yoshida N. 1993. Mucin-like glycoproteins linked to the membrane by glycosylphosphatidylinositol anchor are the major acceptors of sialic acid in a reaction catalyzed by trans-sialidase in metacyclic forms of Trypanosoma cruzi. Mol. Biochem. Parasitol. 59:293–304. http: //dx.doi.org/10.1016/0166-6851(93)90227-O. Figueiredo RC, Rosa DC, Gomes YM, Nakasawa M, Soares MJ. 2004. Reservosomes: an endocytic compartment in epimastigote forms of the protozoan Trypanosoma cruzi (Kinetoplastida: Trypanosomatidae). Correlation between endocytosis of nutrients and cell differentiation. Parasitology 129:431– 438. http://dx.doi.org/10.1017/S0031182004005797. Barboza M, Duschak VG, Cazzulo JJ, De Lederkremer RM, Couto AS. 2003. Presence of sialic acid in N-linked oligosaccharide chains and Olinked N-acetylglucosamine in cruzipain, the major cysteine proteinase of Trypanosoma cruzi. Mol. Biochem. Parasitol. 126:293–296. http://dx.doi .org/10.1016/S0166-6851(02)00287-6. Kollien AH, Schmidt J, Schaub GA. 1998. Modes of association of Trypano-

Koeller et al.

1326

ec.asm.org

62. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248 –254. http://dx.doi.org/10.1016/0003 -2697(76)90527-3. 63. Zhang D, van der Wel H, Johnson JM, West CM. 2012. Skp1 prolyl 4-hydroxylase of Dictyostelium mediates glycosylation-independent and -dependent responses to O2 without affecting Skp1 stability. J. Biol. Chem. 287:2006 –2016. http://dx.doi.org/10.1074/jbc.M111.314021. 64. Feasley CL, Hykollari A, Paschinger K, Wilson IB, West CM. 2013. N-Glycomic and N-glycoproteomic studies in the social amoebae. Methods Mol. Biol. 983:205–229. http://dx.doi.org/10.1007/978-1-62703-302 -2_11. 65. Dell A, Chalabi S, Easton RL, Haslam SM, Sutton-Smith M, Patankar MS, Lattanzio F, Panico M, Morris HR, Clark GF. 2003. Murine and human zona pellucida 3 derived from mouse eggs express identical Oglycans. Proc. Natl. Acad. Sci. U. S. A. 100:15631–15636. http://dx.doi.org /10.1073/pnas.2635507100. 66. Kang P, Merchref Y, Novotny MV. 2008. High-throughput solid-phase permethylation of glycans prior to mass spectrometry. Rapid Commun. Mass Spectrom. 22:721–734. http://dx.doi.org/10.1002/rcm.3395. 67. Hagen FK, Hazes B, Raffo R, DeSa D, Tabak LA. 1999. Structurefunction analysis of the UDP-N-acetyl-D-galactosamine:polypeptide Nacetylgalactosaminyltransferase. J. Biol. Chem. 274:6797– 6803. http://dx .doi.org/10.1074/jbc.274.10.6797. 68. Furuya T, Okura M, Ruiz FA, Scott DA, Docampo R. 2001. TcSCA complements yeast mutants defective in Ca2⫹ pumps and encodes a Ca2⫹-ATPase that localizes to the endoplasmic reticulum of Trypanosoma cruzi. J. Biol. Chem. 276:32437–32445. http://dx.doi.org/10.1074/jbc .M104000200. 69. Cánepa GE, Mesías AC, Yu H, Chen X, Buscaglia CA. 2012. Structural features affecting trafficking, processing, and secretion of Trypanosoma cruzi mucins. J. Biol. Chem. 287:26365–26376. http://dx.doi.org/10.1074 /jbc.M112.354696. 70. Teixeira MM, Yoshida N. 1986. Stage-specific surface antigens of metacyclic trypomastigotes of Trypanosoma cruzi identified by monoclonal antibodies. Mol. Biochem. Parasitol. 18:271–282. http://dx.doi.org/10.1016 /0166-6851(86)90085-X. 71. Soares MJ, Souto-Padrón T, De Souza W. 1992. Identification of a large pre-lysosomal compartment in the pathogenic protozoan Trypanosoma cruzi. J. Cell Sci. 102:157–167. 72. Bayer-Santos E, Cunha-e-Silva NL, Yoshida N, Da Silveira JF. 2013. Expression and cellular trafficking of gp82 and gp90 glycoproteins during Trypanosoma cruzi metacyclogenesis. Parasites Vectors 6:127–137. http: //dx.doi.org/10.1186/1756-3305-6-127. 73. Agrellos OA, Jones C, Todeschini AR, Previato JO, Mendonça-Previato L. 2003. A novel sialylated and galactofuranose-containing O-linked glycan, Neu5␣2¡3Galp␤1¡6(Galf␤1¡4)GlcNAc, is expressed on the sialoglycoprotein of Trypanosoma cruzi Dm28c. Mol. Biochem. Parasitol. 126:93–96. http://dx.doi.org/10.1016/S0166-6851(02)00245-1. 74. Franke de Cazzulo BM, Martínez J, North MJ, Coombs GH, Cazzulo JJ. 1994. Effects of proteinase inhibitors on the growth and differentiation of Trypanosoma cruzi. FEMS Microbiol. Lett. 124:81– 86. http://dx.doi.org /10.1111/j.1574-6968.1994.tb07265.x. 75. Santos CC, Sant’Anna C, Terres A, Cunha-e-Silva NL, Scharfstein J, Lima APCA. 2005. Chagasin, the endogenous cysteine-protease inhibitor of Trypanosoma cruzi, modulates parasite differentiation and invasion of mammalian cells. J. Cell Sci. 118:901–915. http://dx.doi.org/10.1242/jcs .01677. 76. Chiribao ML, Libisch MG, Osinaga E, Parodi-Talice A, Robello C. 2012. Cloning, localization and differential expression of the Trypanosoma cruzi TcOGNT-2 glycosyl transferase. Gene 498:147–154. http://dx.doi.org/10 .1016/j.gene.2012.02.018. 77. El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson D, Aggarwal G, Tran A, Ghedin E, Worthey EA, Delcher AL, Blandin G, Westenberger SJ, Caler E, Cerqueira GC, Branche C, Haas B, Anupama A, Arner E, Åslund L, Attipoe P, Bontempi E, Bringaud F, Burton P, Cadag E, Campbell DA, Carrington M, Crabtree J, Darban H, da Silveira JF, de Jong P, Edwards K, Englund PT, Fazelina G, Feldblyum T, Ferella M, Frasch AC, Gull K, Horn D, Hou L, Huang Y, Kindlund E, Klingbeil M, Kluge S, Koo H, Lacerda D, Levin MJ, Lorenzi H, Louie T, Machado CR, McCulloch R, McKenna A, Mizuno Y, Mottram JC, Nelson S, Ochaya S, Osoegawa K, Pai G, Parsons M, Pentony M, Pettersson U, Pop M, Ramirez JL, Rinta J, Robertson L, Salzberg SL, Sanchez DO,

Eukaryotic Cell

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

46. Fernandes MC, Cortez M, Flannery AR, Tam C, Mortara RA, Andrews NW. 2011. Trypanosoma cruzi subverts the sphingomyelinase-mediated plasma membrane repair pathway for cell invasion. J. Exp. Med. 208:909 – 921. http://dx.doi.org/10.1084/jem.20102518. 47. Bouts DM, Melo AC, Andrade AL, Silva-Neto MA, Paiva-Silva GO, Sorgine MHH, da Cunha Gomes LS, Coelho HS, Furtado AP, Aguiar EC, de Medeiros LN, Kurtenbach E, Rozental S, Cunha ESNL, de Souza W, Masuda H. 2007. Biochemical properties of the major proteins from Rhodnius prolixus eggshell. Insect Biochem. Mol. Biol. 37:1207–1221. http://dx.doi.org/10.1016/j.ibmb.2007.07.010. 48. Nogueira NFS, Gonzalez MS, Gomes JE, De Souza W, Garcia ES, Azambuja P, Nohara LL, Almeida IC, Zingales B, Colli W. 2007. Trypanosoma cruzi: involvement of glycoinositolphospholipids in the attachment to the luminal midgut surface of Rhodnius prolixus. Exp. Parasitol. 116:120 –128. http://dx.doi.org/10.1016/j.exppara.2006.12.014. 49. Mello CB, Azambuja P, Garcia ES, Ratcliffe NA. 1996. Differential in vitro and in vivo behavior of three strains of Trypanosoma cruzi in the gut and hemolymph of Rhodnius prolixus. Exp. Parasitol. 82:112–121. 50. Garcia ES, Azambuja P, Contreras VT. 1984. Large-scale rearing of Rhodnius prolixus and production of metacyclic trypomastigotes of Trypanosoma cruzi, p 44 – 47. In Morel CM (ed), Genes and antigens of parasites, a laboratory manual. Fundação Oswaldo Cruz, World Health Organization, Rio de Janeiro, Brazil. 51. Lima APCA, Dos Reis FCG, Serveau C, Lalmanach G, Juliano L, Ménard R, Vernet T, Thomas DY, Storer AC, Scharfstein J. 2001. Cysteine protease isoforms from Trypanosoma cruzi, cruzipain 2 and cruzain, present different substrate preference and susceptibility to inhibitors. Mol. Biochem. Parasitol. 114:41–52. http://dx.doi.org/10.1016/S0166-6851(01)00236-5. 52. Morrot A, Strickland DK, Higuchi ML, Reis M, Pedrosa R, Scharsftein J. 1997. Human T cell responses against the major cysteine proteinase (cruzipain) of Trypanosoma cruzi: role of the multifunctional ␣2macroglobulin receptor in antigen presentation by monocytes. Int. Immunol. 9:825– 834. http://dx.doi.org/10.1093/intimm/9.6.825. 53. Yoshida N, Mortara RA, Araguth MF, Gonzalez J, Russo M. 1989. Metacyclic neutralizing effect of monoclonal antibody 10D8 directed to the 35 and 50 kilodalton surface glycoconjugates of Trypanosoma cruzi. Infect. Immun. 57:1663–1667. 54. Carvalho TM, Ferreira AG, Coimbra ES, Resestolato CT, De Souza W. 1999. Distribution of cytoskeletal structures and organelles of the host cell during evolution of the intracellular parasitism by Trypanosoma cruzi. J. Submicrosc. Cytol. Pathol. 31:325–333. 55. de Paulo Martins V, Okura M, Maric D, Engman DM, Vieira M, Docampo R, Moreno SNJ. 2010. Acylation-dependent export of Trypanosoma cruzi phosphoinositide-specific phospholipase C to the outer surface of amastigotes. J. Biol. Chem. 40:30906 –30917. http://dx.doi .org/10.1074/jbc.M110.142190. 56. Bourguignon SC, De Souza W, Souto-Padrón T. 1998. Localization of lectin-binding sites on the surface of Trypanosoma cruzi grown in chemically defined conditions. Histochem. Cell Biol. 110:527–534. http://dx.doi .org/10.1007/s004180050314. 57. Tibbetts RS, Jensen JL, Olson CL, Wang FD, Engman DM. 1998. The DnaJ family of protein chaperones in Trypanosoma cruzi. Mol. Biochem. Parasitol. 91:319 –326. http://dx.doi.org/10.1016/S0166-685 1(97)00214-4. 58. Kelly JM, Ward HM, Miles MA, Kendall G. 1992. A shuttle vector which facilitates the expression of transfected genes in Trypanosoma cruzi and Leishmania. Nucleic Acids Res. 20:3963–3969. http://dx.doi.org/10.1093 /nar/20.15.3963. 59. Röttger S, White J, Wandall HH, Olivo JC, Stark A, Bennett EP, Whitehouse C, Berger EG, Clausen H, Nilsson T. 1998. Localization of three human polypeptide GalNAc-transferases in HeLa cells suggests initiation of O-linked glycosylation throughout the Golgi apparatus. J. Cell Sci. 111:45– 60. 60. Da Rocha WD, Silva RA, Bartholomeu DC, Pires SF, Freitas JM, Macedo AM, Vasquez MP, Levin MJ, Teixeira SM. 2004. Expression of exogenous genes in Trypanosoma cruzi: improving vectors and electroporation protocols. Parasitol. Res. 92:113–120. http://dx.doi.org/10.1007 /s00436-003-1004-5. 61. Cáceres AJ, Portillo R, Acosta H, Rosales D, Quiñones W, Avilan L, Salazar L, Dubourdieu M, Michels PAM, Concepción JL. 2003. Molecular and biochemical characterization of hexokinase from Trypanosoma cruzi. Mol. Biochem. Parasitol. 126:251–262. http://dx.doi.org/10.1016 /S0166-6851(02)00294-3.

T. cruzi TcOGNT2 and Metacyclogenesis

78.

79.

81.

82.

83.

84.

85.

October 2014 Volume 13 Number 10

86. 87.

88.

89.

90.

91.

92. 93.

pression of trypomastigote trans-sialidase in metacyclic forms of Trypanosoma cruzi increases parasite escape from its parasitophorous vacuole. Cell. Microbiol. 8:1888 –1898. http://dx.doi.org/10.1111/j.1462-5822.20 06.00755.x. Hasne MP, Coppens I, Soysa R, Ullman B. 2010. A high affinity putrescine-cadaverine transporter from Trypanosoma cruzi. Mol. Microbiol. 76:78 –91. http://dx.doi.org/10.1111/j.1365-2958.2010.07081.x. Senay C, Lind T, Muguruma K, Tone Y, Kitagawa H, Sugahara K, Lidholt K, Lindhal U, Kusche-Gullberg M. 2000. The EXT1/EXT2 tumor suppressors: catalytic activities and role in heparan sulfate biosynthesis. EMBO Rep. 1:282–286. http://dx.doi.org/10.1093/embo-reports/kvd045. Manya H, Chiba A, Yoshida A, Wang X, Chiba Y, Jigami Y, Margolis RU, Endo T. 2004. Demonstration of mammalian protein Omannosyltransferase activity: coexpression of POMT1 and POMT2 required for enzymatic activity. Proc. Natl. Acad. Sci. U. S. A. 101:500 –505. http://dx.doi.org/10.1073/pnas.0307228101. Xiong H, Kobayashi K, Tachikawa M, Manya H, Takeda S, Chiyonobu T, Fujikake N, Wang F, Nishimoto A, Morris GE, Nagai Y, Kanagawa M, Endo T, Toda T. 2006. Molecular interaction between fukutin and POMGnT1 in the glycosylation pathway of ␣-dystroglycan. Biochem. Biophys. Res. Commun. 350:935–941. http://dx.doi.org/10.1016/j.bbrc.2006 .09.129. Ju T, Aryal RP, Stowell CJ, Cummings RD. 2008. Regulation of protein O-glycosylation by the endoplasmic reticulum-localized molecular chaperone Cosmc. J. Cell Biol. 182:531–542. http://dx.doi.org/10.1083/jcb .200711151. Johswich A, Kraft B, Wuhrer M, Berger M, Deelder AM, Hokke CH, Gerardy-Schahn R, Bakker H. 2009. Golgi targeting of Drosophila melanogaster ␤4GalNAcTB requires a DHHC protein family-related protein as a pilot. J. Cell Biol. 184:173–183. http://dx.doi.org/10.1083/jcb .200801071. Huang HH, Stanley P. 2010. A testis-specific regulator of complex and hybrid N-glycan synthesis. J. Cell Biol. 190:893–910. http://dx.doi.org/10 .1083/jcb.201004102. He CY, Ho HH, Malsam J, Chalouni C, West CM, Ullu E, Toomre D, Warren G. 2004. Golgi duplication in Trypanosoma brucei. J. Cell Biol. 165:313–321. http://dx.doi.org/10.1083/jcb.200311076.

ec.asm.org 1327

Downloaded from http://ec.asm.org/ on October 6, 2014 by UNIV OF OKLAHOMA

80.

Seyler A, Sharma R, Shetty J, Simpson AJ, Sisk E, Tammi MT, Tarleton R, Teixeira S, Van Aken S, Vogt C, Ward PN, Wickstead B, Wortman J, White O, Fraser CM, Stuart KD, Andersson B. 2005. The genome sequence of Trypanosoma cruzi, etiologic agent of Chagas disease. Science 309:409 – 415. http://dx.doi.org/10.1126/science.1112631. Chamond N, Goytia M, Coatnoan N, Barale JC, Cosson A, Degrave WM, Minoprio P. 2005. Trypanosoma cruzi proline racemases are involved in parasite differentiation and infectivity. Mol. Microbiol. 58:46 – 60. http://dx.doi.org/10.1111/j.1365-2958.2005.04808.x. Bao Y, Weiss LM, Ma YF, Lisanti MP, Tanowitz HB, Das BC, Zheng R, Huang H. 2010. Molecular cloning and characterization of mitogenactivated protein kinase 2 in Trypanosoma cruzi. Cell Cycle 9:2888 –2896. http://dx.doi.org/10.4161/cc.9.14.12372. Peloso EF, Vitor SC, Ribeiro LHG, Piñeyro MD, Robello C, Gadelha FR. 2011. Role of Trypanosoma cruzi peroxiredoxins in mitochondrial bioenergetics. J. Bioenerg. Biomembr. 43:419 – 424. http://dx.doi.org/10 .1007/s10863-011-9365-4. Temperton NJ, Wilkinson SR, Meyer DJ, Kelly JM. 1998. Overexpression of superoxide dismutase in Trypanosoma cruzi results in increased sensitivity to the trypanocidal agents gentian violet and benznidazole. Mol. Biochem. Parasitol. 96:167–176. http://dx.doi.org/10.1016/S0166 -6851(98)00127-3. Tomás AM, Miles MA, Kelly JM. 1997. Overexpression of cruzipain, the major cysteine proteinase of Trypanosoma cruzi, is associated with enhanced metacyclogenesis. Eur. J. Biochem. 244:596 – 603. http://dx.doi .org/10.1111/j.1432-1033.1997.t01-1-00596.x. Dos Santos GRRM, Nepomuceno-Silva JL, de Melo LDB, MeyerFernandes JR, Salmon D, Azevedo-Pereira RL, Lopes UG. 2012. The GTPase TcRjl of the human pathogen Trypanosoma cruzi is involved in the cell growth and differentiation. Biochem. Biophys. Res. Commun. 419: 38 – 42. http://dx.doi.org/10.1016/j.bbrc.2012.01.119. Okura M, Fang J, Salto ML, Singer RS, Docampo R, Moreno SNJ. 2005. A lipid-modified phosphoinositide-specific phospholipase C (TcPI-PLC) is involved in differentiation of trypomastigotes to amastigotes of Trypanosoma cruzi. J. Biol. Chem. 280:16235–16243. http://dx.doi.org/10 .1074/jbc.M414535200. Rubin-de-Celis SSC, Uemura H, Yoshida N, Schenkman S. 2006. Ex-