ISSN 10623590, Biology Bulletin, 2014, Vol. 41, No. 3, pp. 208–215. © Pleiades Publishing, Inc., 2014. Original Russian Text © E.A. Mudrik, T.A. Kashentseva, E.A. Gamburg, D.V. Politov, 2014, published in Izvestiya Akademii Nauk, Seriya Biologicheskaya, 2014, No. 3, pp. 219– 227.
GENETICS
Genetic Passportization and Identification of Siberian Cranes (Grus leucogeranus Pallas) in Captivity E. A. Mudrika, T. A. Kashentsevab, E. A. Gamburga, and D. V. Politova a
Vavilov Institute of General Genetics, Russian Academy of Sciences, ul. Gubkina 3, Moscow, 119991 Russia b Oka Crane Breeding Center, Oka State Nature Biosphere Reserve, Brykin Bor, Spasskii region, Ryazan oblast, 391072 Russia email:
[email protected] Received June 17, 2013
Abstract—The genetic diversity of the founders of an artificial population of the Siberian crane Grus leucoger anus Pallas (rare species of cranes) was characterized using 10 microsatellite loci. It was established that the allelic diversity (on average, 5.9 alleles per locus) and genic (HO = 0.739) diversity of the Siberian crane is rather high and comparable with the estimations for natural populations of different crane species. Genetic passportization of the birds (119 individuals) from the register of the Siberian crane International Studbook was carried out at the initial stage. The efficiency of genetic passportization for individual identification, identification of the origin, paternity analysis, and exclusion of inbreeding was demonstrated in Siberian cranes under natural mating and artificial insemination. Cases of natural reproduction in pairs of Siberian cranes imprinted to the human and continuous storage of spermatozoa in the female reproductive ducts were registered. DOI: 10.1134/S1062359014030078
INTRODUCTION The Siberian crane Grus leucogeranus Pallas (Gru idae: Gruiformes: Aves) is a rare endangered species of the world avifauna and one of the rarest species of cranes (Meine and Archibald, 1996). Being endemic to Russia, the Siberian crane is represented by two ter ritorially isolated populations in Western and Eastern Siberia. Few individuals of the Western Siberian pop ulation which is close to extinction (no more than 20 birds) nest in the basin of the lower reaches of the Ob River (Sorokin et al., 2000). The vast majority of Siberian cranes comprising the Eastern Siberian pop ulation nest in the northeastern tundra of Yakutia. According to the accounting at the wintering areas in China, the present size of the Eastern Siberian crane population is 3800–4000 individuals (Li et al., 2013). Reduction and transformation of habitats, as well as poaching across the entire range of the Siberian crane, are the main threats for the survival of this species, which is listed in the Red Book of the Russian Feder ation (I category status), the Red List of the Interna tional Union for Conservation of Nature, and Supple ment I of the Convention on International Trade of Wild Fauna and Flora Species (CITES). As for many endangered rare animal species, the protection measures for the Siberian crane include the keeping and breeding of these birds in the captivity (Kashentseva and Rozdina, 2002; Kashentseva, 2005; Kashentseva et al., 2006). Populations that maintain the required level of genetic diversity in captivity rep
resent a “reserve” gene pool for reintroduction and restoration of natural populations of endangered spe cies (Rhodes and Latch, 2010). Information associ ated with keeping of rare animal species (dates of birth and death, tracking of transfers, sex, origin, parents (if known), places of keeping, assigned numbers) are documented in studbooks (International, European, National). According to the last (fifth) issue of the Siberian Crane International Studbook (SCIS) (2009), 393 individuals of this crane species are kept in 55 organizations from 14 countries (Kashentseva and Belterman, 2009). SCIS maintenance and supervision of the Integrated International Research and Produc tion Program of the Eurasian Regional Association of Zoos and Aquaria (EARAZA) “Conservation of the Cranes of Eurasia” is carried out by the Crane Breed ing Center of Oka State Nature Biosphere Reserve (further, OCBC), the main center of Siberian crane keeping and breeding in Russia. The main activity of the OCBC is directed to restoration of the endangered Western Siberian population of the Siberian crane (Kashentseva, 2005). Over 20 years of reintroduction, more than 130 chicks and young Siberian cranes (obtained from the brood stock from the OCBC) were released into habitats, migration routes and wintering grounds of the Western population (Kashentseva and Belterman, 2009; Shilina et al., 2011). In addition, 54 Siberian cranes from the OCBC were transferred for breeding to Russian (17 birds) and foreign (37 birds) zoos (Kashentseva and Belterman, 2009).
208
GENETIC PASSPORTIZATION AND IDENTIFICATION OF SIBERIAN CRANES
Genetic passportization is obtaining genetically determined (individual and/or group) characteristics using morphological and/or molecular markers. Indi vidual genetic passportization by molecular markers considerably expands the opportunities for the effi cient breeding of rare species in captivity. Inbreeding, decrease in adaptive opportunities, and gene pool impoverishment threaten captive populations created on limited genetic material (Lacy, 1994). The modern arsenal of molecular markers allows breeders to select genetically heterogeneous partners for reproduction and to prevent consansuineous matings among the small amount of individuals (Ivy and Lacy, 2010). To date, there is no standard for construction of genetic passports for animals; however, microsatellite loci are considered to be one of the most efficient molecular markers for individual passportization. Individual genotyping by a set of 8–10 polymorphic microsatellite loci allows breeders to identify one indi vidual with a high accuracy as distinct from another individual of the species (Zvychainaya et al., 2011; Mudrik et al., 2011a, 2011b, 2013a; Rozhnov et al., 2013). The topicality of genetic passportization for captive Siberian cranes is caused by the need to establish the paternity of birds obtained as a result of artificial insemination. This method of an increase in the breeding productivity implies multiple inseminations of females by the sperm of several males; consequently, any of these males could be the father of chicks, and biological paternity can be established only based on DNA analysis (Jones and Nicolich, 2001). Inclusion of microsatellite data in studbooks and genetic management of captive populations in the world practice of rare crane species breeding is carried out only for the Whooping crane (Grus americana L.) (Jones et al., 2002) and for the Mississippi Sandhill crane (G. canadensis pulla Aldrich), one of the rare subspecies of the Sandhill crane (Henkel et al., 2011). Microsatellite loci were developed for the control of illegal trade of chicks and eggs from the wild (but not obtained in captivity) for identification purposes for the narrowrange African endemic species Blue crane (Anthropoides paradisae Lichtenstein) (Meares et al., 2008). Genetic studies have never been conducted for the natural Siberian crane populations and have not yet been conducted due to difficulties in collection of the biological material. At the same time, study of the genetic structure of the captive Siberian crane popula tion (as one of the rarest crane species) is included in the work plan of the EARAZA program “Conserva tion of the Cranes of Eurasia” (Kashentseva et al., 2006). Estimations of kinship and genetic diversity of Siberian cranes in the captive population were previ ously analyzed using DNA fingerprinting (Tokarskaya et al., 1994, 1995, 1999); the levels of inter and intrapopulation differentiation were estimated by mitochondrial DNA data (Ponomarev et al., 2004, 2007). Analysis of microsatellite loci in Siberian crane BIOLOGY BULLETIN
Vol. 41
No. 3
2014
209
(that we conduct for the first time) considerably expands the opportunities for genetic individualiza tion of each bird, including for identification pur poses. The aim of this study was to carry out genetic pass portization of Siberian cranes in captivity at the initial stage using microsatellite loci and to demonstrate its application for identification of reintroduced birds and establishment of paternity during artificial insem ination and natural mating. MATERIALS AND METHODS In 2010–2012, we performed genetic passportiza tion of 119 individuals from the SCIS list, among which were 15 birds from Western Siberia (4 individu als) and Eastern Siberia (11 individuals), which are the founders of the captive Siberian crane population in Russia and its main breeders; 45 descendants of these birds, which live and propagate in domestic and for eign zoos; 40 Siberian cranes raised in the OCBC and reintroduced into the area of the Western Siberian population; and 19 deceased individuals (embryos, chicks, or adult birds). Blood samples collected during annual planned medical examinations of Siberian cranes in 2010– 2012 and some previous years, blood vessels of allan tois from eggshell membranes after hatching (Mudrik et al., 2013b), and mediumsized (up to 10 cm) bird feathers served in different cases as the material for DNA isolation. DNA extraction was carried out in dif ferent ways, including using Chelex100 ionexchange resin (Walsh et al., 1991) and kits for DNA isolation from animal tissues (DIAtomTM DNAPrep100 (Isogen Laboratory Ltd.) and DiamondDNA Animal tissue kit. For genetic passportization of the Siberian crane, 20 polymorphic microsatellite loci isolated from genomes of the Whooping crane (Gram22, Gram25, Gram30, Gram42) (Jones et al., 2010), Blue crane (Gpa12, Gpa32, Gpa35, Gpa36, Gpa38, Gpa39) (Meares et al., 2008), and the Redcrowned crane Grus japonensis Muller (GjM8, GjM11a, GjM13, GjM15, GjM34, GjM48b) (Hasegawa et al., 2000), (Gj4066, Gj8067, Gj8077, Gj2298) (Zou et al., 2010) were tested. Electrophoresis of PCR products was carried out in 6% polyacrylamide gel in the Tris– EDTA–borate buffer system; gel staining was per formed by an ethidium bromide solution with subse quent visualization in ultraviolet light using the Kodak Edas 290 gel documentation system (United States). Calculation of the parameters of genetic diversity was carried out in the addin for the electronic table MS Excel—GenA1Ex 6.41 and 6.501 (Peakall and Smouse, 2006).
210
MUDRIK et al.
RESULTS AND DISCUSSION Characteristics of microsatellite loci for genetic pass portization of Siberian cranes. All 20 initially selected microsatellite loci were successfully amplified in the Siberian crane; however, 10 of them were excluded from the subsequent analysis after testing because of monomorphism (Gram42, Gpa35, GjM11a, Gj4066, Gj8067, Gj8077), the presence of “null” alleles (GjM13, GjM48b), as well as methodical unfitness for genotyping in the conditions that we use (Gram25, Gpa36). The remaining 10 variable loci were characterized by reproducibility and accuracy of interpretation in breeders and their descendants, and therefore, we selected them for genetic passportization of the Siberian crane. The parameters of genetic variation were calcu lated for the sample of 15 unrelated Siberian cranes, which have a natural origin and are founders of the captive population. The amount of alleles detected in the analyzed microsatellite loci was 59 (at an average 5.9 alleles per locus) and varied from 3 (Gpa32, GjM8) up to 11 (Gj2298) (Table 1). The values of observed heterozygosity were from 0.533 (Gram22, GjM8 loci) up to 0.933 (Gpa38) (on average, 0.739). The values of expected heterozygosity varied from 0.531 (GjM8) up to 0.91 (Gj2298) and was 0.69 on average. The level of genetic variation was rather high and comparable to the estimations obtained using microsatellites for nat ural populations of other crane species (Hasegawa et al., 2000; Meares et al., 2008; Jones et al., 2010). Diploid genotypes of all analyzed birds for each of 10 loci were recorded as allele pairs designated accord ing to their molecular weight and were summarized in a matrix of individual genetic passports of Siberian cranes. Individual identification of Siberian cranes: an example of origin identification. Genetic passportiza tion of Siberian crane breeders allowed us to identify a bird returned from the wild and to identify its parents. This individual was delivered to the OCBC in 2003 from Chelyabinsk Zoo, to which a local resident had brought it with a wing broken in several places and without leg bands. The bird maintained juvenile feath ering (consequently, it was young) and was not afraid of people so it was presumably grown by a human. Therefore, it most likely originated from the OCBC. A few months earlier, six young Siberian cranes (born in the OCBC) were released in Kunovatskii Preserve in order to join them for migration to Common cranes that nest in the same territory. Most of these birds (five out of six) were grown by a costume method (using the head model of the adult Siberian crane as a feed instrument and a white costume that hid the human face and figure) (Horwich, 1989). Such birds do not become tame, but are not afraid of people. One chick was brought up by crane parents; such birds remain wild forever relative to humans (Kashentseva and Pos tel’nykh, 2005). Consequently, the Siberian crane
from Chelyabinsk Zoo could have been one of the five reintroducents grown in the OCBC by the costume method. The wing was amputated in the bird (it was female) due to multiple injuries; therefore, it had to live and propagate in captivity. Due to this circum stance, the establishment of its origin was required for the planning of matings and preventing inbreeding. At the time of the study, no blood collection of Siberian cranes reintroduced in 2003 remained; there fore, direct identification of the bird could not be made. It was required to establish its origin through the parents; for this purpose, a comparison of the multilo cus genotype of this individual with genotypes of four pairs of birds, from which the descendants were obtained in 2003, was conducted. In this manner, three pairs of Siberian cranes (numbers 97–85, 68– 33, 154–67 in SCIS) were excluded from the candi dates as parents of the identified bird due to discrepan cies of their genotypes by 6–7 microsatellite loci. The bird itself turned out a descendant of the pair Bilipu (female, SCIS 128) and Kolyma (male, SCIS 82). It was given the name Kama and SCIS number 502 at birth (Table 2). Identification of paternity in chicks obtained as a result of artificial insemination. Artificial insemination is used in the breeding of Siberian cranes when birds are unable to pair themselves (extremity injuries, imprinting to human, behavioral deviations), for breeding of valuable genotypes and selection of genet ically heterogeneous partners (Kashentseva and Rozdina, 2002; Kashentseva, 2006). Typically, the female is sequentially inseminated by sperm from dif ferent sires over an interval of several days for the effi ciency of fertilization during egg laying. The sire involved in insemination last (but no later than two days before egg laying) was traditionally considered as the father of the chick. Genetic passportization of the brood stock from the OCBC and their descendants allowed us to detect a number of discrepancies in doc umentation for the fathers of Siberian cranes obtained from artificial insemination. The case of Chroma chick (male, SCIS 807) is one indicative example (Table 3). In 2009, the dam Mirande (SCIS 226) was insemi nated twice by the artificial method. The first insemi nation was conducted on April 29, with sperm from the sire Kunovat (SCIS 85), whereupon on May 4, the dam laid a fertilized egg, from which the chick Kundysh (male, SCIS 805) was hatched. Kunovat was recorded as his father. On the day of this egg laying (May 4), the dam was inseminated with sperm of the sire Sergei (SCIS 33), whereupon chick Chroma was hatched from an egg laid on May 7. The sire Sergei was recorded as his father. Analysis of multilocus geno types of the dam, sires, and chicks confirmed the paternity of Kunovat in the case of Kundysh and dis proved the paternity of Sergei in the case of Chroma according to the discrepancy of four microsatellite loci (Gpa12, Gpa32, Gpa39, Gj2298) (Table 3). Kuno BIOLOGY BULLETIN
Vol. 41
No. 3
2014
BIOLOGY BULLETIN
Vol. 41
No. 3
2014
R: GGAGAAGTGAAGGGGAAGGT
F: GCCTGTTGCAAGAACACAGA
R: TCCCTCTGGTGTTGGCTGAAAATAC
F: TGCTCAACATTCATCAGGATTTGGG
R: TGCGAATGAACAGATGGCCCCAAGA
F: TCTACCAGATATCATCAGAGCTTGC
R: TACAGTTAATGTGGGTGCAA
(CTG)14
(AC)19
(CA)13
(TC)10
(GATA)13
R: TTCCAAAGTGAAATTAAAGGTGTGTGG
F: TCCGTCAAGCTTTTAGTCAT
(GA)2
(CTAT)13
(GT)11
(GATA)11
(AAGG)7
(AAAC)9
Motif
F: TGCACAGGTTTGGCCAAGAAG
R: GAAGATGTTTGCTGGTTGCAC
F: GGGCAGAAGCAAGTCTTTCA
R: GCAGTCGGTCACATCCTTGG
F: CCCAGCACACCGTGCATAAG
R: TCATCAATCTATTATTTGCCTCAGC
F: GATCAATGCGAAGGATAGGGAGGT
R: ATGAAGGGTGACAACGTAAAC
F: CAGTCGGGCGTCATCATGTAAAGCTCCTTGGGCTG
R: AACCTATTTGCTGTTCCTATTACTC
F: CAGTCGGGCGTCATCACCATTGGCACAATCCCTC
Primer sequence (5'–3')
A, amount of alleles per locus; HO, observed heterozygosity; HE, expected heterozygosity; bp, base pairs.
Gj2298
GjM34
GjM15
GjM8
Gpa39
Gpa38
Gpa32
Gpa12
Gram30
Gram22
Locus
Table 1. Characteristic of microsatellite loci and parameters of genetic variation of the Siberian crane
Average
145–205
138–146
100–112
110–122
86–120
170–190
174–180
202–218
178–210
160–172
Fragment size, bp
5.9
11
4
6
3
9
6
3
5
8
4
A
0.739 ± 0.046
0.880
0.857
0.800
0.533
0.867
0.933
0.600
0.667
0.800
0.533
HO
0.699 ± 0.037
0.910
0.717
0.662
0.531
0.787
0.762
0.540
0.762
0.773
0.578
HE GENETIC PASSPORTIZATION AND IDENTIFICATION OF SIBERIAN CRANES 211
212
MUDRIK et al.
Table 2. Fragment of multilocus genotype matrix of Siberian cranes by 10 microsatellite loci with the example of reintro duced bird identification No.* Sex Gram22 Gram30
Gpa12
Gpa32
Gpa38
Gpa39
GjM8
GjM15
GjM34
Gj2298
502
160 168 194 202 210 214 174 174 178 178 102 120 114 122 100 110 138 140 145 151
128
168 172 194 198 210 214 174 174 178 182 102 104 114 122 100 104 138 146 151 160
82
160 160 186 202 206 210 174 174 178 182
86 120 122 122 104 110 140 140 145 172
97
160 160 190 194 210 210 174 176 170 186
90 112 122 122 106 108 138 146 163 178
85
160 168 194 198 202 210 174 176 174 178
90 116 114 122 104 108 138 140 154 205
68
160 164 178 194 206 206 174 180 170 178
86 104 114 122 104 108 138 140 145 160
33
160 172 194 198 206 210 174 180 170 182 102 108 122 122 104 108 140 144 160 166
154
160 172 186 190 202 206 174 176 178 182 102 116 114 114 104 108 138 140 157 169
67
160 160 194 194 202 202 174 174 170 170 102 106 122 122 110 112 140 140 166 166
Genotypes of females and/or males, by which they are excluded as parents of identified individuals, are highlighted by a gray color. Multilocus genotype of identified bird and alleles that it inherited from mother and father are highlighted in italics (for Tables 2 and 4). * Number in SCIS.
Table 3. Fragment of multilocus genotype matrix of Siberian cranes by 10 microsatellite loci with example of paternity es tablishment under artificial insemination Individual* Gram22 Gram30
Gpa12
Gpa32
Gpa38
Gpa39
GjM8
GjM15
GjM34
Gj2298
Mother (226) 160 168 186 198 210 210 174 176 178 182 104 120 114 122 104 110 140 140 145 160 Sire (85)
160 168 194 198 202 210 174 176 174 178 90 116 114 122 104 108 138 140 154 205
Chick (805)
160 168 198 198 210 210 174 176 178 182 90 104 122 122 104 104 138 140 145 205
Sire (33)
160 172 194 198 206 210 174 180 170 182 102 108 122 122 104 108 140 144 160 166
Chick (807)
160 168 194 198 202 210 176 176 178 182 90 120 122 122 108 110 140 140 154 160
Multilocus genotypes of chicks are highlighted in italics. * Bird numbers according to SCIS register for Siberian cranes are given in brackets (for Tables 3 and 4).
vat, the sperm of which preserved viability and fertiliz ing properties in the female’s reproductive ducts for 8 days, was also shown to be Chroma’s father. His sperm were more competitive than the sperm of another male involved in insemination five days later. A similar effect was also registered in the Whooping crane, female fertilization of which occurred 3–9 days after artificial insemination (Jones and Nicolich, 2001). A record of cases of sperm preservation in the reproductive tracts of crane females (up to 16 days) was described for the Wattled crane (Bugeranus carun culatus Gmelin) (Swengel and Tuite, 1997). Thus, the paternity of the latter male in a series of successive inseminations is not always obvious and requires genetic verification.
The above example also clearly demonstrates how unique individual genetic profiles by microsatellite loci are even among the chicks from the same parents (sibs). Their multilocus genotypes differ among each other by seven out of ten loci, including slightly vari able (Gpa32, GjM34) (Table 3), indicating the high efficiency of genetic passportization by microsatellite loci for identification purposes. We corrected or specified the paternity using genetic passportization in 29 Siberian crane individu als, including a male which was paired with sib female due to an inaccurate documenting of parents. Identification of cases of natural reproduction under artificial insemination. Analysis of the paternity in chicks grown in the OCBC allowed us to detect cases BIOLOGY BULLETIN
Vol. 41
No. 3
2014
GENETIC PASSPORTIZATION AND IDENTIFICATION OF SIBERIAN CRANES
213
Table 4. Fragment of multilocus genotype matrix of Siberian cranes by 10 microsatellite loci with an example of detection of natural fertilization under artificial insemination Individual Chick (647)
Gram22 Gram30
Gpa12
Gpa32
Gpa38
Gpa39
GjM8
GjM15
GjM34
Gj2298
168 172 194 202 206 214 174 174 178 182 108 116 114 122 104 108 138 144 160 169
Mother (42) 160 168 198 202 214 214 174 176 178 182 104 116 114 122 104 104 144 146 151 169 Sire (82)
160 160 186 202 206 210 174 174 178 182 86 120 122 122 104 110 140 140 145 172
Sire (85)
160 168 194 198 202 210 174 176 174 178 90 116 114 122 104 108 138 140 154 205
Sire (67)
160 160 194 194 202 202 174 174 170 170 102 106 122 122 110 112 140 140 166 166
Father (37)
172 172 194 198 206 210 174 174 178 182 102 108 110 114 100 108 138 140 160 160
of natural mating in Siberian cranes that were consid ered incapable of independent pairing. According to the established opinion, cranes grown by a human are imprinted to him as on a sexual partner and are tech nically incapable of natural copulation (Panchenko and Kashentseva, 1995). A pair of Siberian cranes Yulya (SCIS 42) and Nazar (SCIS 37) from the OCBC is a striking example of the inaccuracy of this point of view. Both birds were removed from the nests in nature at the stage of egg and were grown by a human. The dam has been artifi cially inseminated from 1988 by sperm of different sires, including the sperm of its partner Nazar. How ever, in 2005 the dam laid her first egg (which was fer tilized) even before the beginning of artificial insemi nation, and the female Purga (SCIS 643) was success fully hatched from it. Our genetic analysis confirmed Nazar’s paternity for it. Immediately after the hatching of Purga, the dam was sequentially inseminated by the sperm of three sires, including Kolyma (SCIS 82) on May 1, Kunovat (SCIS 85) on May 12, and Kieng (SCIS 67) on May 17. An egg was laid on May 19, and the female Neya (SCIS 647) was hatched from it; Kieng as the last of the sperm donors was recorded as its father. However, analysis of microsatellite data disproved the paternity of all three males involved in artificial insemination. Nazar (partner of the dam) was also Neya’s father (fig ure; Table 4). The mating behavior of cranes, especially Siberian cranes, is rather complex, and until recently the mat ing ritual in this species in captivity was hidden from the human eye. Video surveillance demonstrated that copulation occurs in Siberian cranes in the early morning hours, the precopulatory ritual takes no more than 3 minutes, and pairing is not accompanied by loud vocalization (characteristic for Redcrowned cranes, for example) (Postel’nykh et al., 2011). There fore, the possibility of independent pairing of the birds imprinted to humans and success in fertilization BIOLOGY BULLETIN
Vol. 41
No. 3
2014
became an unexpected discovery in the reproductive biology of Siberian cranes. Among other descendants of the dam Yulya avail able for our analysis and born in different years, Nazar was also established to be the father for four of them, while other males were documented in SCIS as their fathers. It is possible that these chicks also appeared as a result of natural mating; however, it is impossible to state it, since Nazar was among the sperm donors for artificial insemination. And although his sperm was used in the beginning of insemination cycle, 9–10 days before the egg laying, and during the subsequent involvement in the process of other males, it is possible that his sperm preserved viability in the reproductive ducts of the dam, as was demonstrated in the previous example. CONCLUSIONS Siberian cranes from a captive population are char acterized by a high genetic diversity by microsatellite loci, while multilocus genotypes can serve as unique
1
2
3
4
5
6
7
Fragment of electrophoregram of the Gj2298 microsatel lite locus with an example of detection of natural fertiliza tion in Siberian cranes under artificial insemination. 1, Marker of the fragment lengths in base pairs (148/160/180/190/202); 2, Neya chick, genotype 160/169; 3, Yulya dam (mother), 151/169; 4, Kolyma sire, 145/172; 5, Kunovat sire, 154/205; 6, Kieng sire, 166/166; 7, Nazar sire (father), 160/160.
214
MUDRIK et al.
genetic passports for each bird. Genetic passportiza tion of the breeders and their descendants in captivity is an efficient instrument for individual identification, for example, when the birds that lost their leg bands are being captured or when Siberian cranes are occa sionally return from the wild after reintroduction. Using individual genotyping by microsatellite loci, we succeeded in establishing or specifying the paternity in birds born as a result of artificial insemination, includ ing in those males that themselves became sperm donors for insemination. We also detected cases of natural mating of birds imprinted to humans and propagated artificially. The data obtained is the basis for subsequent analysis of kinship relationships of birds that are combined in pairs and propagated using artificial insemination and for reconstruction of genetic pedigrees of Siberian cranes that are bred in captivity. ACKNOWLEDGMENTS We are grateful to the zoos from EARAZA associa tion for the samples of biological material from Sibe rian cranes for genetic analysis. This work was supported by Program of Funda mental Studies of the Presidium of the Russian Acad emy of Sciences “Wildlife: Current Status and Prob lems of Development” (“Dynamics and Conservation of Gene Pools” Subprogram), as well as by Integrated International Research and Production Program of EARAZA “Conservation of the Cranes of Eurasia.” REFERENCES Hasegawa, O., Ishibashi, Y., and Abe, S., Isolation and characterization of microsatellite loci in the Redcrowned crane Grus japonensis, Mol. Ecol., 2000, vol. 9, no. 10, pp. 1677–1678. Henkel, J.R., Jones, K.L., Hereford, S.G., et al., Integrat ing microsatellite and pedigree analyses to facilitate the captive management of the endangered Mississippi Sandhill crane (Grus canadensis Pulla), Zoo Biol., 2011, no. 30, pp. 1–14. Horwich, R.H., Use of surrogate parental models and age periods in a successful release of handreared Sandhill cranes, Zoo Biol., 1989, no. 8, pp. 379–390. Ivy, J.A. and Lacy, R.C., Using molecular methods to improve the genetic management of captive breeding programs for threatened species, in Molecular Approaches in Natural Resource Conservation and Management, DeWoody, J.A., Ed., Cambridge: Cambr. Univ. Press, 2010, pp. 267–295. Jones, K.L. and Nicolich, J.M., Artificial insemination in captive Whooping cranes: results from genetic analyses, Zoo Biol., 2001, no. 20, pp. 331–342. Jones, K.L., Glenn, T.C., Lacy, R.C., et al., Refining the Whooping crane Studbook by incorporating microsatellite DNA and legbanding analyses, Conserv. Biol., 2002, vol. 16, no. 3, pp. 789–799. Jones, K.L., Henkel, J.R., Howard, J.J., et al., Isolation and characterization of 14 polymorphic microsatellite
DNA loci for the endangered Whooping crane (Grus amer icana) and their applicability to other crane species, Conserv. Gen. Res., 2010, vol. 2, no. 1, pp. 251–254. Kashentseva, T.A., Oka Crane Breeding Center: past and present, in Okskii zapovednik (istoriya, lyudi, priroda) (Oka Reserve (History, People, and Nature)), Ryazan’: Russkoe slovo, 2005, pp. 138–169. Kashentseva, T.A., Successful breeding of Siberian cranes in captivity, in Zhuravli Evrazii (raspredelenie, chislennost’, biologiya) (Cranes of Eurasia (Distribution, Abundance, and Biology)), Moscow: Mos. Zoopark, 2006, vol. 2, pp. 221–233. Kashentseva, T.A. and Belterman, R., Siberian Crane— Grus leucogeranus International and EEP Studbook, Russia, Oka State Biosphere Nature Reserve, 2009. Kashentseva, T.A. and Postel’nykh, K.A., Imprinting and introduction of cranes, in Chelovek i zhivotnye: Mater. 3 Mezhdunar. Nauch.Prakt. Konf. (Man and Animals: Proc. 3 Int. Sci.Pract. Conf.), Astrakhan’, 2005, pp. 112– 114. Kashentseva, T.A. and Rozdina, O.I., Captive breeding of cranes, in Zhuravli Evrazii (raspredelenie, chislennost’, biologiya) (Cranes of Eurasia (Distribution, Abundance, and Biology)), Moscow: Mos. Zoopark, 2002, pp. 271– 277. Kashentseva, T.A., Ostapenko, V.A., and Rozdina, O.I., Conservation of the cranes of Eurasia: an integrated research and production program, Inform. Sb. EARAZA, 2006, no. 25, pp. 455–470. Lacy, R.C., Managing genetic diversity in captive popula tions of animals, in Restoration of Endangered Species, Bowles, M.L. and Whelan, C.J., Eds., Cambridge: Cambr. Univ. Press, 1994, pp. 63–89. Li, F., Vu, D., Kharris, D., and Burnam, D., Abundance and distribution of cranes on Poyang Lake, China, in winter 2011/2012, Siberian Crane Flyway News, 2013, no. 12, pp. 12–13. Meares, K., Dawson, D., Horsburgh, G., et al., Character ization of 14 Blue crane Grus paradisea (Gruidae, Aves) microsatellite loci for use in detecting illegal trade, Conserv. Gen., 2008, vol. 9, pp. 1363–1367. Meine, C.D. and Archibald, G.W., The Cranes: Status Sur vey and Conservation Action Plan, Gland, Switzerland: IUCN, 1996. Mudrik, E.A., Kashentseva, T.A., and Politov, D.V., Genetic diversity and multilocus genotyping of the Siberian crane by microsatellite loci, in Zhuravli Evrazii (biologiya, rasprostranenie, migratsiya, upravlenie) (Cranes of Eurasia (Biology, Distribution, Migration, and Management)), Moscow: Mos. Zoopark, 2011a, no. 4, pp. 81–87. Mudrik, E.A., Kashentseva, T.A., Gamburg, E.A., and Politov, D.V., Genetic passportization and DNA control of pedigrees of rare crane species in artificial populations, in Tekhnologii sokhraneniya redkikh vidov zhivotnykh: Mater. Nauch. Konf., Moskva, 21–23 noyabrya 2011 g. (Technolo gies for Rare Species Conservation: Proc. Sci. Conf. Moscow, November 21–23, 2011), Moscow: KMK, 2011b, p. 36. Mudrik, E.A., Kashentseva, T.A., Gamburg, E.A., and Politov, D.V., Genetic identification of twin chicks by feath ers and allantois: a study of Eurasian cranes in the Oka Crane Breeding Center, Newsletter of crane working group of Eurasia, 2013a, no. 12, pp. 79–81. BIOLOGY BULLETIN
Vol. 41
No. 3
2014
GENETIC PASSPORTIZATION AND IDENTIFICATION OF SIBERIAN CRANES Mudrik, E.A., Kashentseva, T.A., Gamburg, E.A., et al., Noninvasive method of sex identification of crane chicks by the DNA from capillary vessels of allantois, Russ. J. Dev. Biol., 2013b, vol. 44, no. 5, pp. 279–282. Panchenko, V.G. and Kashentseva, T.A., Breeding of cranes in the Oka Crane Breeding Center, in Nauchnye osnovy okhrany i ratsional’nogo ispol’zovaniya ptits (Scientific Basis for the Conservation and Management of Birds), Ryazan’: Russkoe slovo, 1995, pp. 236–270. Peakall, R. and Smouse, P.E., GENALEX 6: genetic analy sis in Excel. Population genetic software for teaching and research, Mol. Ecol. Notes, 2006, no. 6, pp. 288–295. Ponomarev, A., Tatarinova, T., Bubyakina, V., et al., Varia tion of mitochondrial DNA Dloop sequences in the endangered Siberian crane Grus leucogeranus Pallas, Con serv. Gen., 2004, vol. 5, pp. 847–851. Ponomarev, A.G., Tatarinova, T.D., Bubyakina, V.V., et al., Evaluation of the current state of inter and intrapopulation divergence of populations of the Siberian white crane (Grus leucogeranus Pallas) using phylogenetic network of mito chondrial DNA haplotypes, Sib. Ekol. Zh., 2007, vol. 14, no. 4, pp. 629–634. Postel’nykh, K.A., Kozhanova, T.V., and Kashentseva, T.A., Some data on mating behavior of the Siberian crane in cap tivity, in Zhuravli Evrazii (biologiya, rasprostranenie, migratsiya, upravlenie) (Cranes of Eurasia (Biology, Distri bution, Migration, and Management)), Moscow: Mos. Zoopark, 2011, vol. 4, pp. 407–415. Rhodes, O.E. and Latch, E.K., Wildlife reintroductions: the conceptual development and application of theory, in Molecular Approaches in Natural Resource Conservation and Management, DeWoody, A.J., Ed., Cambridge: Cambr. Univ. Press, 2010, pp. 296–319. Rozhnov, V.V., Sorokin, P.A., Lukarevskii, V.S., et al., Indi vidual identification of Amur leopards (Panthera pardus ori entalis) using molecular–genetic methods and the popula tion size estimation, Biol. Bull. (Moscow), 2013, vol. 40, no. 2, pp. 124–129. Shilina, A.P., Sorokin, A.G., Markin, Yu.M., and Erma kov, A.M., Crane reintroduction: past, present, future, in Zhuravli Evrazii (biologiya, rasprostranenie, migratsiya,
BIOLOGY BULLETIN
Vol. 41
No. 3
2014
215
upravlenie) (Cranes of Eurasia (Biology, Distribution, Migration, Management)), Moscow: Mos. Zoopark, 2011, vol. 4, pp. 423–449. Sorokin, A.G., Markin, Yu.M., Panchenko, V.G., and Shi lina, A.P., Current state and work on the conservation of western and central populations of Siberian crane, Nauch. Vestn., 2000, no. 4, pp. 74–84. Swengel, S.R. and Tuite, M.L., Recent advances in sched uling strategies and practical techniques in crane artificial insemination, in Proc. North Am. Crane Workshop, 1997, no. 7, pp. 46–55. Tokarskaya, O.N., Kalnin, V.V., Panchenko, V.G., and Ryskov, A.P., Genetic differentiation in a captive popula tion of the endangered Siberian crane (Grus leucogeranus Pall.), Mol. Gen. Genet., 1994, vol. 245, pp. 658–660. Tokarskaya, O.N., Petrosyan, V.G., Kashentseva, T.A., et al., DNA fingerprinting in captive population of the endangered Siberian crane (Grus leucogeranus), Electro phoresis, 1995, vol. 16, no. 9, pp. 1766–1770. Tokarskaya, O.N., Petrosyan, V.G., Kashentseva, T.A., et al., Analysis of relatedness and genetic diversity in Sibe rian cranes Grus leucogeranus by DNA fingerprinting, Vogelwelt, 1999, vol. 120, pp. 383–389. Walsh, P.S., Metzger, D.A., and Higuchi, R., Chelex100 as a medium for simple extraction of DNA for PCRbased typing from forensic material, BioTechniques, 1991, vol. 10, no. 4, pp. 506–513. Zou, H.F., Dong, H.Y., Kong, W.Y., et al., Characterization of 18 polymorphic microsatellite loci in the Redcrowned crane (Grus japonensis), an endangered bird, Anim. Sci. J., 2010, vol. 81, no. 4, pp. 519–522. Zvychainaya, E.Yu., Rozhnov, V.V., and Poyarkov, A.D., Genotyping and certification of individuals of rare species of mammals as exemplified by the snow leopard (Uncia uncia), in Tekhnologii sokhraneniya redkikh vidov zhivot nykh: Mater. nauch. konf. Moskva, 21–23 noyabrya 2011 g. (Technologies for Rare Species Conservation: Proc. Sci. Conf. Moscow, November 21–23, 2011), Moscow: KMK, 2011, p. 16.
Translated by A. Barkhash
