JOURNAL OF BACTERIOLOGY, Aug. 2002, p. 4277–4287 0021-9193/02/$04.00⫹0 DOI: 10.1128/JB.184.15.4277–4287.2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Vol. 184, No. 15
Functional Characterization of Gne (UDP-N-Acetylglucosamine4-Epimerase), Wzz (Chain Length Determinant), and Wzy (O-Antigen Polymerase) of Yersinia enterocolitica Serotype O:8 Jose´ Antonio Bengoechea,1 Elise Pinta,1 Tiina Salminen,2 Clemens Oertelt,3 Otto Holst,3 Joanna Radziejewska-Lebrecht,4 Zofia Piotrowska-Seget,4 Reija Venho,1 and Mikael Skurnik1* Department of Medical Biochemistry and Molecular Biology, University of Turku,1 and Department of ˚ bo Academy,2 Turku, Finland; Division of Analytical Biochemistry, Research Biochemistry and Pharmacology, A Center Borstel, Borstel, Germany3; and Department of Microbiology, University of Silesia, Katowice, Poland4 Received 16 January 2002/Accepted 29 April 2002
The lipopolysaccharide (LPS) O-antigen of Yersinia enterocolitica serotype O:8 is formed by branched pentasaccharide repeat units that contain N-acetylgalactosamine (GalNAc), L-fucose (Fuc), D-galactose (Gal), D-mannose (Man), and 6-deoxy-D-gulose (6d-Gul). Its biosynthesis requires at least enzymes for the synthesis of each nucleoside diphosphate-activated sugar precursor; five glycosyltransferases, one for each sugar residue; a flippase (Wzx); and an O-antigen polymerase (Wzy). As this LPS shows a characteristic preferred O-antigen chain length, the presence of a chain length determinant protein (Wzz) is also expected. By targeted mutagenesis, we identify within the O-antigen gene cluster the genes encoding Wzy and Wzz. We also present genetic and biochemical evidence showing that the gene previously called galE encodes a UDP-N-acetylglucosamine4-epimerase (EC 5.1.3.7) required for the biosynthesis of the first sugar of the O-unit. Accordingly, the gene was renamed gne. Gne also has some UDP-glucose-4-epimerase (EC 5.1.3.2) activity, as it restores the core production of an Escherichia coli K-12 galE mutant. The three-dimensional structure of Gne was modeled based on the crystal structure of E. coli GalE. Detailed structural comparison of the active sites of Gne and GalE revealed that additional space is required to accommodate the N-acetyl group in Gne and that this space is occupied by two Tyr residues in GalE whereas the corresponding residues present in Gne are Leu136 and Cys297. The Gne Leu136Tyr and Cys297Tyr variants completely lost the UDP-N-acetylglucosamine-4-epimerase activity while retaining the ability to complement the LPS phenotype of the E. coli galE mutant. Finally, we report that Yersinia Wzx has relaxed specificity for the translocated oligosaccharide, contrary to Wzy, which is strictly specific for the O-unit to be polymerized. the nucleoside triphosphates, followed by different biosynthetic pathways to give rise to individual nucleoside diphosphate (NDP)-activated sugar precursors. The assembly of the O-units takes place on the cytoplasmic face of the inner membrane and involves an initiation process that transfers the first sugar residue from the NDP sugar precursor onto a lipid carrier, undecaprenylphosphate, followed by sequential transfer of the other sugar residues from the respective NDP sugar precursors by specific glycosyltransferases. The completed O-units still assembled on the undecaprenylphosphate are translocated by the O-unit flippase, Wzx, across the inner membrane to the periplasmic face. There, the O-units are polymerized by the O-antigen polymerase, Wzy, into an O-antigen that is ligated to the lipid A core structure by the O-antigen ligase encoded by the waaL gene of the core gene cluster (for a review, see reference 49). The O-antigen polysaccharide of Yersinia enterocolitica serotype O:8 is formed by branched pentasaccharide repeat units that contain N-acetylgalactosamine (GalNAc), L-fucose (Fuc), D-galactose (Gal), D-mannose (Man), and 6-deoxy-D-gulose (6d-Gul). The adjacent repeat units are joined together by a (134) glycosidic bond between GalNAc and Man residues (47). Previously, we determined the Y. enterocolitica O:8 wb cluster sequence
Lipopolysaccharide (LPS) is the major component of the outer leaflet of the outer membranes of gram-negative bacteria. The LPS molecule contains three structural parts: (i) the O-antigen, a polysaccharide region that protrudes into its surroundings; (ii) the core, an oligosaccharide often rich in negatively charged groups; and (iii) the lipid A, a polar glycolipid in which a disaccharide backbone is replaced with six or seven saturated fatty acids (33). It is common for the genes required for synthesis of the different LPS parts to be clustered in separated loci. In Yersinia, the O-antigen gene cluster (hereafter referred to as the wb cluster) lies between the hemH and gsk genes in the chromosome (37). This location is different from those in Escherichia coli and Salmonella enterica, where the wb cluster is closely linked to the gnd locus, which lies upstream of the his operon (6, 35). The biosynthesis of heteropolymeric O-antigens whose O-units are composed of different sugar residues starts in the cytoplasm by the activation of sugar 1-phosphates in a reaction with one of * Corresponding author. Mailing address: Department of Medical Biochemistry, University of Turku, Kiinamyllynkatu 10, 20520 Turku, Finland. Phone: 358-2-3337441. Fax: 358-2-3337229. E-mail:
[email protected]. 4277
4278
BENGOECHEA ET AL.
(GenBank accession number U46859) that spans 19 kb of chromosomal DNA and contains a total of 18 genes (51, 53). Based on sequence similarities, we were able to identify the genes for the biosynthesis of GDP-Man, GDP–L-Fuc, CDP–6d-Gul, and UDPGal and for the respective glycosyltransferases. However, direct biochemical and/or genetic evidence to confirm these annotations remained to be found. In addition, based on sequence similarity, we identified the gene for the O-unit flippase (Wzx), and on phenotypic and genetic bases we identified the gene for the Oantigen polymerase (Wzy) (53). After this analysis, only two genes of the cluster remained without assigned functions (wbcE and wbcF), and they were speculated to encode biosynthetic proteins (51). The Y. enterocolitica O:8 LPS has a characteristic preferred O-antigen chain length of about 7 to 10 repeat units. In E. coli, Salmonella, and Shigella, the O-antigen chain length is controlled by the chain length determinant (Wzz) in a manner that is not yet completely understood (3, 5), and a similar protein is expected to be present in Y. enterocolitica O:8 as well. In the cloned wb cluster, we did not find a gene for Wzz (51), but this was not unexpected, since in some organisms the wzz gene is located outside the wb cluster, although it is usually found closely linked to it (3–5). Subsequently, Pierson and Carlson challenged the annotation of the last two wb cluster genes, galE and wzy, after studying a polar transposon insertion mutant with the transposon inserted into the galE gene (32). In our work, the wzy gene was assigned based on the semirough LPS (SR-LPS) phenotype, i.e., a single O-unit attached to the lipid A core, that a cosmid expressing the wb cluster without the wzy gene showed in E. coli and on the galE gene, because of its sequence homology to known galE genes (53). However, Pierson and Carlson showed that the galE product is not involved in the synthesis of UDP-Gal as we suggested, and they conclusively demonstrated that there is a true galE gene elsewhere in the Y. enterocolitica O:8 chromosome. Therefore, they named the gene present in the wb cluster lse (for LPS sugar epimerase), but no further studies were performed to characterize its function. Complementation of the transposon mutant with the galE gene alone allowed the strain to produce O-units but resulted in an LPS with a nonmodal distribution of O-antigen lengths, with the majority of the O-antigens having less than four or five repeat units. As this nonmodal LPS pattern of the complemented Y. enterocolitica O:8 galE/lse mutant resembled that seen in wzz mutants, they named the wzy gene downstream of the galE/lse gene rol (the old name for wzz). However, in E. coli, Salmonella, and Shigella, where the function of Wzz has been more thoroughly studied, the LPS patterns of wzz mutants have been somewhat different (3–5). Instead of accumulation of short O-antigens, the O-antigen lengths in wzz strains are distributed over a very broad range from one to tens of units per O-antigen. Thus, one could speculate that the LPS pattern seen in the complemented Y. enterocolitica O:8 galE/lse mutant could also be an indication of low Wzy activity (37). These unsettled issues, and also computer prediction data from other O-antigen gene cluster sequencing projects (38), prompted us to clarify the functions of the Y. enterocolitica O:8 genes. In this report, we conclusively show that the wzy/rol gene is wzz and indeed encodes the chain length determinant as suggested by Pierson and Carlson (32). We further show that the wbcE gene is the true wzy gene encoding the O-antigen polymerase, and finally,
J. BACTERIOL.
we provide biochemical and genetic evidence showing that the galE/lse gene product is the UDP-N-acetylglucosamine-4-epimerase (EC 5.1.3.7) and rename the gene gne. MATERIALS AND METHODS Bacterial strains, plasmids, media, and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. Typically, Y. enterocolitica and E. coli strains were grown in Luria-Bertani medium and tryptic soy broth (TSB) at either 22 to 25 (room temperature [RT]) or 37°C. When appropriate, antibiotics were added to the growth medium at the following concentrations: ampicillin, 100 g/ml; kanamycin, 100 g/ml in agar plates and 20 g/ml in broth; and chloramphenicol, 20 g/ml. Construction of strain YeO8c-⌬WzzGB, a chromosomal wzz knockout mutant of strain YeO8c. A DNA fragment between positions 18196 and 21012 of the wb gene cluster sequence (accession number U46859) carrying the gne (galE/lse) and wzz (wzy/rol) genes was amplified by PCR using primers LZ4 and Yerfb2ext (Table 2). Amplifications were carried out in a 50-l reaction mixture containing 25 pmol of each primer, 400 ng of strain YeO8c chromosomal DNA, 300 M deoxynucleoside triphosphate mixture, 2 mM MgSO4, and 1 U of Vent DNA polymerase (2 U/l; New England BioLabs, Beverly, Mass.). The PCR steps (94°C for 30 s, 48°C for 30 s, and 72°C for 3.5 min) were repeated 25 times, followed by a 10-min extension time at 72°C. The 2.8-kb PCR product was gel purified and cloned into the SmaI site of pUC18 to obtain pUC18-1. Then, the PCR mutagenesis method described by Byrappa et al. (7) was used to delete an internal fragment of the wzz gene from pUC18-1. Primers co-3 and co-4 were designed to generate both a 688-nucleotide deletion and a new NruI site in pUC18-1. Amplifications were carried out in a 50-l reaction volume containing 25 pmol of each 5⬘-phosphorylated primer, 400 ng of purified pUC18-1 plasmid, and 1 U of Vent DNA polymerase. The PCR steps (94°C for 30 s, 49°C for 30 s, and 72°C for 7 min) were repeated 15 times. The 4.8-kb band was gel purified and self-ligated to obtain pUC18-3. A terminatorless kanamycin GenBlock cassette (GB) was obtained by PstI digestion of pSB315 (Table 1). The 1-kb GB fragment was gel purified, blunt ended by T4 DNA polymerase treatment, and cloned into the NruI site of pUC18-3. A clone carrying the GB in the transcriptional orientation of the wzz gene was obtained and named pUC18-5. Subsequently, the 3.1-kb PvuII fragment of pUC18-5 was gel purified and cloned into the EcoRV site of the suicide vector pRV1 to obtain pRV1-⌬WzzGB. This plasmid was transformed into E. coli Sm10 pir, from which the plasmid was mobilized into strain YeO8c. Ten Kmr Clmr transconjugants, with pRV1-⌬WzzGB integrated into the genome by homologous recombination, were pooled and subjected to cycloserine enrichment to select for derivatives that had the vector sequences deleted from the genome by a second homologous-recombination event (13, 31). One Kmr Clms recombinant surviving the cycloserine enrichment was selected and named YeO8c-⌬WzzGB. The mutant genotype was confirmed by Southern blot analysis and by PCR using primers LZ69 and LZ43 (Table 2). Construction of strain YeO8c-WbcEGB. A 2-kb AclI-ClaI DNA fragment (between positions 8567 and 10651 of U46859) obtained from pLZ6020 was cloned into the AccI site of pEL, a pUC18 derivative lacking the unique EcoRI site of the polylinker region, to obtain pELwbcE. The pELwbcE plasmid had a unique EcoRI site in the wbcE coding region at position 9075. The GB fragment obtained by EcoRI digestion of pSB315 was gel purified and cloned into the EcoRI site of pELwbcE. A clone carrying the GB in the transcriptional orientation of the wbcE gene was obtained and named pELwbcEGB. A 3.2-kb PvuII fragment of pELwbcEGB was gel purified and cloned into the EcoRV site of the suicide vector pRV1, giving pRV1-wbcEGB. This plasmid was transformed into E. coli Sm10 pir, and to introduce the wbcE::GB allele into strain YeO8c, the strategy outlined above for the wzz gene was followed. One Kmr Clms recombinant surviving the cycloserine enrichment was selected and named YeO8c-WbcEGB. The mutant genotype was confirmed by PCR using primers o8wb10719r and o8wb8268f (Table 2 and data not shown). Construction of pEEgne and pRV28. pUC18-1, which contains the Y. enterocolitica O:8 gne gene, was digested with HpaI and SalI, and the resulting fragments were blunt ended by Klenow treatment. Next, the gne-carrying 1.7-kb fragment was gel purified, ligated into the EcoRV site of pTM100, and transformed into E. coli C600. A plasmid having the cloned gene transcribed from the tet gene promoter of the vector was named pEEgne, and another plasmid with the fragment cloned in the opposite orientation was named pEEgne-R. The galE/gne gene of Y. enterocolitica O:3 is present in pRV16, which contains the whole Y. enterocolitica O:3 LPS outer-core gene cluster cloned into pTM100 (39). The outer-core genes upstream of the galE/gne gene were deleted by partial digestion of pRV16 with BamHI followed by a complete digestion with BglII and ligation
VOL. 184, 2002
O-ANTIGEN BIOSYNTHESIS OF YERSINIA ENTEROCOLITICA O:8
4279
TABLE 1. Bacterial strains and plasmids used in this work Bacterial strains or plasmid
Genotype or comments
Reference or source
E. coli strains C600 SY327 pir Sm10 pir S874 AD9
thi thr leuB tonA lacY supE ⌬(lac pro) argE (Am) rif nalA recA56 (pir) thi thr leuB tonA lacY supE recA::RP4-2-Tc::Mu-Km (pir) K-12 lacZ trp ⌬(sbcB-his-gnd-cps-rfb) upp rel rpsL ⌬(galK-bioD)76 relA1 rpsL125 thi-1 arg174; Rc-type LPS
2 26 36 19 20
Y. enterocolitica strains 8081-R⫺ M⫹ (YeO8) 8081-c R⫺ M⫹ (YeO8c) 8081-R1 YeO8c-⌬WzzGB YeO8c-WbcEGB
R⫺ M⫹ derivative of wild-type strain 8081; serotype O:8; pYV⫹ R⫺ M⫹ derivative of 8081-c, the pYV-cured derivative of 8081 Spontaneous rough mutant strain strain YeO8c derivative; ⌬wzz::Km-GB; Kmr strain YeO8c derivative; wbcE::Km-GB; Kmr
51 52 51 This work This work
Cloning vector; Ampr Source of terminatorless Km cassette GB; Kmr Mobilizable vector; pACYC184-oriT of RK2; Clmr Suicide vector; derivative of pJM703.1; Clmr 25-kb Sau3AI fragment of strain YeO8c cloned in the BamHI site of pHC79; Ampr BamHI deletion derivative of pLZ5010; contains the whole wb cluster except the last 57 codons of wzz; Ampr BamHI deletion derivative of pLZ5010; Ampr DNA fragment of strain YeO8c wb cluster (between positions 18196 and 21012 of U46859) carrying the gne and wzz genes; Ampr Deletion derivative of pUC18-1 containing a 688-bp deletion in the wzz gene; Ampr Km GB from pSB315 cloned into NruI site of pUC18-3; Ampr Kmr PvuII fragment of pUC18-5 cloned into EcoRV site of pRV1; Kmr Clmr pUC18 derivative lacking the EcoRI site; Ampr AclI fragment (between positions 8567 and 10651 of U46859) of pLZ6020 cloned into AccI site of pEL; Ampr Km GB of pSB315 cloned into EcoRI site of pELwbcE; Ampr Kmr PvuII fragment of pELwbcEGB cloned into EcoRV site of pRV1; Kmr Clmr Hpal-SalI fragment of pUC18-1 cloned into EcoRV site of pTM100; gne is under the control of the tet gene promoter; Clmr HpaI-SalI fragment of pUC18-1 cloned into EcoRV site of pTM100 in the opposite orientation to pEEgne; Clmr gne1; Leu136Tyr; Clmr gne2; Cys297Tyr; Clmr gne3; Leu136Tyr and Cys297Tyr; Clmr pTM100 derivative containing Y. enterocolitica O:3 outer core gene cluster; Clmr BamHI-BlgI deletion derivative of pRV16; gne is under the control of the tet gene promoter; Clmr
50 12 25 39 53 53
Plasmids pUC18 pSB315 pTM100 pRV1 pLZ5010 pLZ6020 pLZ6010 pUC18-1 pUC18-3 pUC18-5 pRV1-⌬wzzGB pEL pELwbcE pELwbcEGB pRV1-wbcEGB pEEgne pEEgne-R pEEgneY1 pEEgneY2 pEEgneY1Y2 pRV16 pRV28
of the DNA. An E. coli C600 transformant that had lost the 10.4-kb BamHI-BglII fragment upstream of the galE/gne gene was isolated, and the resulting 7.6-kb plasmid was named pRV28. In pRV28, the galE/gne gene is transcribed from the tet gene promoter of the vector. Site-directed mutagenesis. Site-directed mutagenesis of the gne gene was performed by PCR (7). Plasmid pUC18-1 purified with a Qiagen minipreparation kit was used as a template, and the desired mutations were introduced by the primer pairs described in Table 2. Amplifications were carried out in a 50-l reaction mixture using Vent DNA polymerase (New England BioLabs). The PCR was started with an initial 70-s incubation at 95°C, and then the steps (95°C for 50 s, 60°C for 75 s, and 72°C for 6 min) were repeated 20 times, followed by a 10-min extension time at 72°C. The obtained PCR products were gel purified, phosphorylated with T4 polynucleotide kinase, ligated, and digested with DpnI to break down any remaining template plasmid. The ligated PCR product was transformed into E. coli C600 by standard procedures (14). Plasmid DNA was isolated from the transformants, and the gne gene was completely sequenced to confirm the generated mutations and to ensure that no other changes were introduced. The mutated gne genes were subcloned into pTM100 the same way described above for the construction of pEEgne and transformed into E. coli AD9. Molecular modeling. A Y. enterocolitica Gne (Swiss-Prot number Q57301) model was made on a Silicon Graphics O2 workstation. The sequences of 76 UDP-glucose-4-epimerases and/or UDP-N-acetylglucosamine-4-epimerases
53 This work This This This This This
work work work work work
This work This work This work This work This This This 39 This
work work work work
were compared to assist in the identification of variable amino acids in these enzymes. The sequence alignments were performed using the programs MALIGN and MALFORM (17, 18). The structure of Y. enterocolitica epimerase in complex with NADH and UDP-glucose was constructed using the X-ray structure of human epimerase in a ternary complex with NADH and UDP-glucose (Protein Data Base [PDB] number 1EK6) (45) as the structural template. In this structure, the C domain is more tightly clamped down over the active site upon substrate binding than in the E. coli complex structures, and thus, the active-site base could be identified (43, 44). In order to compare the substrate-binding modes of Y. enterocolitica and E. coli enzymes, the structure of the E. coli enzyme was also modeled using the human ternary-complex structure as the template. In addition, two structural models of Y. enterocolitica epimerase were constructed using the X-ray crystal structures of a double mutant, S124A 䡠 Y149F, of E. coli epimerase in complex with UDP-glucose (PDB number 1A9Y) and UDP-galactose (PDB number 1A9Z), respectively (44), as the structural templates to find the differences in the modes that UDP-galactose and UDP-glucose use to bind the epimerases. Five different models for each were made using the modeling program MODELLER (34). From each set, the best model was selected by choosing the model with the lowest objective function, which describes the degree of fit of the model to the input structural data used in its construction, derived by the program MODELLER (34). The volumes of the active-site cavities were calculated using SURFNET (22). InsightII (Molecular Simulations
PCR PCR wzz mutagenesis wzz mutagenesis; 5⬘ end modified to NruI site (underlined) PCR PCR PCR PCR gne mutagenesis (Leu136Tyr); modified codon underlined gne mutagenesis gne mutagenesis (Cys297Tyr); modified codon underlined gne mutagenesis 18196 21012 19718 20403 18724 21022 10719 8268 19057 19056 19540 19539 GTGGTGAAATGAGTGCTC GAYTTGCGYTTACCAGGAAATTTCATTG TCACTCATCAATTTTACCCATACC TCGCGAGCTATTGGTGCATTTG AGGAATGTTGTTGTTCTT ATAGTGCTTAGATTTGCG ATATTTTTAACCCCCGCACC ACTGCTTTGATGATGCTTTCC TATACTGAAAAAGCTAGAATTGGCGGG CGGAACGAATTCAGGCTCACCATATAC TATTGGGCAAGCCCTGAACTAGCACAT CTCAGCTATATCACCAGGCCTACGGCT
18213 20985 19695 20424 18741 21005 10700 8288 19083 19030 19566 19513
5⬘-sequence position Sequence
3⬘-sequence position
Purpose
BENGOECHEA ET AL.
J. BACTERIOL. Inc., San Diego, Calif.) was used for displaying the structures and cavities. All the figures were made using MOLSCRIPT (21) and RASTER3D (24). Isolation and analysis of LPS. For small-scale LPS isolation, a modified version of the protocol devised by Hitchcock and Brown was used (15). Bacteria were grown overnight in TSB, subcultured (1:10) in 5 ml of TSB in a 15-ml Falcon tube, and grown till late log phase. Bacteria were collected by centrifugation in a microcentrifuge from a 1.5-ml aliquot of the cell suspension. The pellet was resuspended in lysis buffer (2% deoxycholate [DOC], 4% 2-mercaptoethanol, 10% glycerol, and 0.002% bromophenol blue in 1 M Tris-HCl buffer [pH 6.8]) in a volume adjusted according to the optical density of the culture at 540 nm and heated at 100°C for 10 min. After that, 40 g of proteinase K (Roche) was added, and the suspension was incubated at 55°C for at least 2 h. Samples were stored at ⫺20°C until analyzed by DOC-polyacrylamide gel electrophoresis (PAGE) as described previously (39). For chemical analysis, LPS was obtained from the dried cells by hot phenol-water extraction (48) and was purified by three repeated ultracentrifugation steps (each at 105,000 ⫻ g for 4 h; yield, 139 mg; 1% of bacterial dry mass). LPS (110 mg) was hydrolyzed (100°C; 1.5 h) with 1% acetic acid (10 ml). After centrifugation (5,000 ⫻ g) to remove lipid A, the supernatant containing the oligosaccharide fraction was concentrated by rotary evaporation and separated on a column (3.5 by 50 cm) of Sephadex G-50 eluted with pyridine-acetic acid-water (4:10:1,000 [by volume]). Two oligosaccharide fractions, I and II, were obtained (yields, 15.7 and 19 mg, respectively; representing 14.2 and 17.3% of purified LPS) and were subjected to chemical analysis. Samples (0.5 mg each) of fractions I and II were hydrolyzed (100°C; 18 h) with 4 M HCl (200 l). After the evaporation of the HCl, the samples were N acetylated, reduced with NaBH4, and O acetylated as described previously (16). Alditol acetates were subjected to gas chromatography-mass spectroscopy analysis performed as previously described (16, 42). Enzymatic assays. (i) Preparation of cell extracts. Cultures were grown in 15 ml of Luria-Bertani medium at 28°C overnight (typically, 20 h) with vigorous shaking (250 rpm). Cells were collected by centrifugation, washed once with 10 mM Tris-HCl (pH 8.8), and finally resuspended in 60 l of the same buffer. To this cell suspension, 150 mg of glass beads was added, and the cells were broken by 10 cycles of vortexing (30 s) and incubation on ice (30 s). After that, the glass beads and cell debris were pelleted by centrifugation (16,000 ⫻ g; 4 min; RT), and the supernatant was immediately used for the enzymatic assays described below. (ii) UDP-N-acetylglucosamine-4-epimerase activity. The reaction mixture (final volume, 22.5 l) contained 2.5 l of the extract, 10 l of 10 mM Tris-HCl (pH 8.8), and 10 l of 5 mM UDP-GlcNAc or UDP-GalNAc (Sigma Chemical Co., St. Louis, Mo.). The reaction mixture was incubated for 1 h at RT, and the reaction was stopped by adding 62 l of ice-cold 4 mM H3PO4 in ethanol followed by a 30-min incubation on ice. The proteins were pelleted by centrifugation (16,000 ⫻ g; 20 min; 4°C), and the supernatant was transferred to a new Eppendorf tube, dried in a SpeedVac concentrator, and stored at ⫺20°C. UDPGalNAc and UDP-GlcNAc were detected by a Dionex high-performance anionexchange chromatography system (series 4500i) equipped with a CarboPac PA100 anion-exchange column (250 by 4 mm) in combination with a CarboPac PA-100 guard column and 0.5 M sodium acetate in 0.1 M NaOH as the eluent. The eluted carbohydrates were detected with a pulsed amperometric detection system. (iii) UDP-glucose-4-epimerase activity. The enzyme activity was measured as described by Moreno et al. (27) with some modifications. Briefly, the reaction mixture contained 4 to 5 l of the extract (3.5 g of protein/reaction), 10 l of 10 mM Tris-HCl (pH 8.8), and 10 l of a 5 mM UDP-Gal solution. The reaction mixture was incubated for 1 h at 37°C, the reaction was stopped by addition of 2.5 l of 0.1 N HCl, and the mixture was immediately incubated for 15 min at 100°C to hydrolyze the formed UDP-Glc. The free glucose was determined as previously described (27) by addition of 200 l of 0.1 M phosphate buffer (pH 7.0) containing 4 U of glucose oxidase, 1 g of peroxidase, and 60 g of o-dianisidine (all from Sigma Chemical Co.). After 30 min of incubation at 37°C, the reaction was stopped by addition of 250 l of 6.0 N HCl. After centrifugation (16,000 ⫻ g; 4 min; RT) to get a clear supernatant, the optical density at 540 nm was measured.
LZ4 Yerfb2ext co-4 co-3 LZ69 LZ43 o8wb10719r o8wb8268f o8wb19057f o8wb19056r o8wb19540f o8wb19539r
RESULTS AND DISCUSSION Primer
TABLE 2. Primers used in this work based on the nucleotide sequence of the Y. enterocolitica O:8 wb gene cluster
4280
Wzz, the O-antigen chain length determinant of Y. enterocolitica O:8. To elucidate whether the wzy/rol gene of the Y. enterocolitica O:8 O-antigen cluster encodes the Wzz or Wzy activity, we inactivated the gene in strain YeO8c as described
VOL. 184, 2002
O-ANTIGEN BIOSYNTHESIS OF YERSINIA ENTEROCOLITICA O:8
FIG. 1. DOC-PAGE analysis followed by silver staining of LPS preparations from Y. enterocolitica O:8 strains. Lane 1, strain YeO8c; lane 2, YeO8c-⌬WzzGB; lane 3, YeO8c-WbcEGB; lane 4, 8081-R1.
in Materials and Methods. The LPS of YeO8c-⌬WzzGB analyzed by DOC-PAGE showed a nonmodal random distribution of the O-antigen chain lengths in contrast to the modal distribution of chain lengths present in the LPS of the wild-type strain (Fig. 1, compare lanes 1 and 2). It is noteworthy that this LPS phenotype was similar to that of other wzz mutants obtained in E. coli, Salmonella, and Shigella. Furthermore, membrane topological predictions of these Wzz proteins performed by the hidden Markov motif analysis for membrane-spanning domains (40) show that these proteins are predicted to have two transmembrane helices in the N and C termini spanning the cytoplasmic membrane and a large central region forming a periplasmic loop. Significantly, both the N- and C-terminal transmembrane helices could be identified in the Y. enterocolitica O:8 Wzz, and in addition, it also contains a characteristic proline-rich sequence overlapping the C-terminal transmembrane helix (8, 28, 29). pTMWzzF, a plasmid containing the wzz gene transcribed from the cat gene promoter of pTM100, was able to complement the mutant YeO8c-⌬WzzGB (not shown), confirming that the phenotype described above was caused by the generated wzz mutation. In conclusion, these results allowed us to rigorously identify the wzy/rol gene as the wzz gene of the Y. enterocolitica O:8 O-antigen gene cluster, and accordingly, the gene was renamed wzz. Identification of WbcE as Wzy, the O-antigen polymerase of Y. enterocolitica O:8. The putative O-antigen polymerase of Yersinia pseudotuberculosis O:1b showed some similarity to the wbcE gene product (38). The hidden Markov motif analysis for membrane-spanning domains of WbcE predicted 10 transmembrane helices, which is a common trait present in other Wzy proteins (9, 29). Furthermore, other features, like codon usage and the low G⫹C content of the wbcE gene, are similar to those of known wzy genes, suggesting that wbcE could encode Wzy. To confirm this hypothesis, the wbcE was inacti-
4281
vated and the mutant LPS phenotype was analyzed. The LPS of YeO8c-WbcEGB examined by DOC-PAGE showed an SRLPS phenotype (Fig. 1, lane 3) similar to that of an O-antigen polymerase mutant, where a single O-unit is attached to the lipid A core. Moreover, chemical analysis of the LPS oligosaccharide of this mutant revealed the presence of Y. enterocolitica O:8 core sugars plus those of one O-unit (data not shown). Plasmid pTMWzyF, containing the wbcE gene under the control of the tet gene promoter of pTM100, trans-complemented the mutation of YeO8c-WbcEGB (not shown). Altogether, these data experimentally confirmed our hypothesis, and therefore, wbcE was renamed wzy. In the light of these new data, we had to find an explanation for our previous results that led us to erroneously identify wzz as wzy (53). In brief, we reported that E. coli containing the cosmid pLZ6020 (Table 1) expressed an LPS with the typical ladderlike phenotype of the Y. enterocolitica O:8 LPS (Fig. 2B, lane 6). However, E. coli C600(pLZ6010), a deletion derivative of pLZ6020, expressed an SR-LPS (Fig. 2B, lane 2; also see Fig. 5, lane 2). Moreover, the migration of the LPS band in DOC-PAGE was the same as that of the first ladder of the LPS from C600(pLZ6020), and it reacted with a monoclonal antibody specific for the Y. enterocolitica O:8 O-antigen (not shown). These data were in good agreement with the LPS phenotypes of wzy mutants in other bacteria and furthermore argued that C600(pLZ6010) expressed a complete O-unit and not an incomplete O-unit lacking one distal sugar residue that would also prevent O-antigen polymerization. Based on these considerations, we concluded that the gene absent in pLZ6010 should be wzy, the O-antigen polymerase. However, we have shown above that in fact the missing gene in pLZ6010 was wzz, encoding the chain length determinant. To further complicate the situation, the true wzy gene is actually present in both pLZ6020 and pLZ6010. Therefore, we reasoned that the Ounit expressed by C600(pLZ6010) could not be identical to that expressed by C600(pLZ6020) and hence it would not function as a substrate for the Y. enterocolitica O:8 Wzy protein. This scenario was tested by chemical analysis of the LPS of C600(pLZ6010). After mild hydrolysis of the purified LPS, two oligosaccharide fractions were obtained. Chemical analysis revealed that fraction I contained sugars characteristic of the E. coli K-12 core oligosaccharide but also characteristic sugars present in the Y. enterocolitica O:8 O-antigen, although the latter were present in relatively smaller quantities. On the other hand, fraction II contained sugars present only in the E. coli K-12 core. Interestingly, the only hexosamine present in fraction I was GlcNAc. Therefore, the O-unit expressed by C600(pLZ6010) contained Fuc, Gal, Man, 6d-Gul, and GlcNAc, but not GalNAc, the natural constituent of the Y. enterocolitica O:8 O-antigen. This provided experimental evidence supporting our hypothesis that in C600(pLZ6010) the SR-LPS phenotype was due to the inability of Wzy to polymerize an O-unit with altered composition. This also indicates that UDPGalNAc is not available in E. coli C600. Presumably, E. coli WecA is the GlcNAc-transferase (1) responsible for the incorporation of GlcNAc into the O-unit expressed by E. coli C600(pLZ6010). Gne, the UDP-N-acetylglucosamine-4-epimerase (EC 5.1.3.7) of Y. enterocolitica O:8. In addition to lacking the wzz gene, pLZ6010 lacked the 3⬘ end of the galE/lse gene. Taking
4282
BENGOECHEA ET AL.
J. BACTERIOL.
FIG. 2. Analysis of UDP-N-acetylglucosamine-4-epimerase activity. (A) Dionex analysis of the UDP-N-acetylglucosamine-4-epimerase activities of different E. coli C600 cell extracts. The sources of the cell extracts and the substrates used in each reaction are shown at the right. The positions of the UDP-GalNAc (Gal) and UDP-GlcNAc (Glc) peaks are indicated by vertical arrows. (B) DOC-PAGE analysis followed by silver staining of LPS preparations from different E. coli strains. Lane 1, C600; lane 2, C600(pLZ6010); lane 3, C600(pLZ6010, pEEgne-R); lane 4, C600(pLZ6010, pRV28); lane 5, C600(pLZ6010, pEEgne); lane 6, C600(pLZ6020). The apparent difference between samples run in lanes 2 and 3 is due to an unequal loading of the sample run in lane 2.
into consideration the previous data, it was tempting to speculate that the galE/lse gene product could be the UDP-Nacetylglucosamine-4-epimerase of Y. enterocolitica O:8 responsible for the biosynthesis of UDP-GalNAc by C4 epimerization of UDP-GlcNAc. It is also worth noting that GalNAc is one of the sugars present in the outer-core oligosaccharide of Y. enterocolitica O:3 and that the outer-core gene cluster encodes a GalE homologue with 84% identity to Y. enterocolitica O:8 GalE/Lse (37). It was reasonable to postulate that both Y. enterocolitica O:8 and Y. enterocolitica O:3 genes would encode the same enzymatic activity. Therefore, we asked whether the galE/lse gene provided UDP-N-acetylglucosamine-4-epimerase activity to crude cytoplasmic extracts of bacteria. The results obtained with different cell extracts are shown in Fig. 2A. No UDP-N-acetylglucosamine-4-epimerase activity was present in C600 extracts; neither UDP-GalNAc nor UDP-GlcNAc was epimerized. However, the epimerase activity was present in C600(pEEgne) extracts, and both UDP-GlcNAc and UDP-GalNAc functioned as substrates, showing that the reaction is reversible. As expected, very little or no epimerase activity was present in the C600(pEEgne-R) extracts. Significantly, the enzymatic activity was also present in the C600(pRV28) extracts. These results led us to conclude that both Y. enterocolitica O:8 and O:3 galE/lse genes encode a UDP-N-acetylglucosamine-4-epimerase, and they were renamed gne after the gene with the same function in Bacillus (10). In view of the biochemical data described above, pEEgne and pRV28 should trans-complement the SR-LPS phenotype
of C600(pLZ6010), as they would contribute to the biosynthesis of the proper O-unit. To confirm this, both plasmids were mobilized into E. coli C600(pLZ6010), and the LPS phenotype was analyzed. As expected, the LPS expressed by C600(pLZ6010, pEEgne) and C600(pLZ6010, pRV28) had the ladderlike LPS phenotype characteristic of the Y. enterocolitica O:8 O-antigen (Fig. 2B, lanes 4 and 5). In good agreement with the biochemical data, E. coli C600(pLZ6010, pEEgne-R) expressed SR-LPS (Fig. 2B, lane 3). Next, we wanted to determine if Gne also displays UDPglucose-4-epimerase activity, which might be possible, considering the high degree of similarity between Gne and the E. coli GalE protein (53% identity). To this end, plasmid pEEgne was transformed into E. coli AD9. This strain contains a deletion of the galE gene, producing a truncated LPS of the Rc type (see Fig. 4B, lane 5) due to the absence of the galactose residue required for the completion of the K-12 core oligosaccharide. Cell extract of E. coli AD9(pEEgne) showed UDP-glucose-4epimerase activity that was, however, hardly over the background level. To confirm that Gne indeed has UDP-glucose4-epimerase activity, we used a biological approach and asked whether Gne could restore the K-12 LPS core production of E. coli AD9. The LPS expressed by E. coli AD9(pEEgne) was similar to that of E. coli C600 (see Fig. 4B and compare lanes 4 and 6), strongly suggesting that Gne possesses enough UDPglucose-4-epimerase activity to complement the GalE defect and therefore allows the expression of a complete K-12 LPS core. Identification of Gne residues critical for substrate specific-
VOL. 184, 2002
O-ANTIGEN BIOSYNTHESIS OF YERSINIA ENTEROCOLITICA O:8
ity. We showed above that Gne is able to catalyze the interconversion of UDP-GalNAc and UDP-GlcNAc and, in addition, the interconversion of UDP-galactose and UDP-glucose, although the latter activity was clearly less efficient. Interestingly, the human UDP-glucose-4-epimerase (55% identical to Gne) is also able to catalyze both reactions, whereas E. coli GalE (53% identical to Gne) has only UDP-glucose-4-epimerase activity (46). To find the molecular basis behind this substrate specificity, we constructed a structural model of Gne based on the crystal structures of the human and E. coli enzymes. A reliable model could be obtained due to the high degree of similarity to both human and E. coli epimerases and due to the excellent alignment of the sequences. Similar to that of GalE, the overall structure of Gne consists of two distinct domains. The N-terminal nucleotide-binding domain is composed of a seven-stranded parallel -pleated sheet flanked on either side by ␣-helices, and the C-terminal substrate-binding domain is composed of six strands of -sheet and five ␣-helices. The substrate-binding cavity is located between these two domains. The C-terminal domain is clamped down over the active site upon substrate binding (45). The active sites of the Y. enterocolitica, E. coli, and human enzymes are extremely similar. The conserved residues involved in glucose binding are Ser124, Tyr149, Asn179, Asn199, and Arg231 (Fig. 3A). One additional residue, Tyr299, forming a hydrogen bond with the 6⬘-hydroxyl group, is implicated in glucose binding in the E. coli enzyme. This residue is not conserved in either the human or Y. enterocolitica sequences. In this position, there is a cysteine residue, Cys297, in Y. enterocolitica, but it is too far away from the glucose moiety to form a hydrogen bond with the 6⬘-hydroxyl group. The aminoacetyl group of UPD-GalNAc and UDP-GlcNAc is bound into the C-2 position of the sugar moiety, but based on this structural comparison, no significant difference could be located near this position. However, the unique feature characterizing the epimerase reaction mechanism is the putative rotation of the 4⬘-ketopyranose within the active site. In order to be able to detect the effect of this rotation on the active-site interactions, the structural models of Gne in complex with NADH/UDP-glucose and NADH/UDP-galactose (Fig. 3B) were constructed using the E. coli enzyme structures as templates (44). In fact, the 2⬘-hydroxyl group of the galactose moiety is located near Cys297 in the structural model of the Gne/NADH/UDP-galactose complex (Fig. 3B), whereas the much bulkier Tyr299 is the corresponding residue in the E. coli enzyme. Furthermore, this structural comparison revealed an additional nonconserved position in the active site of Gne, Leu136 (Fig. 3C). The corresponding residue in the E. coli enzyme is another tyrosine, Tyr136, which is larger than the corresponding leucine residue (Leu144) in both Gne and human epimerase. Therefore, an empty space large enough to accommodate the aminoacetyl group can be detected in the active site of the Gne/NADH/UDP-galactose model (Fig. 3C), whereas there is no space for the aminoacetyl group in the E. coli complex structure due to the presence of the Tyr136 and Tyr299 residues. Residues Leu136 and Cys297 in Gne were predicted to have an important role in substrate specificity. In order to test this idea, three different site-directed mutant proteins of Gne were constructed, the single mutants Leu136Tyr and Cys297Tyr and a double mutant,
4283
Leu136Tyr 䡠 Cys297Tyr, and the epimerase activities of these variants in the E. coli AD9 background were tested (Fig. 4A). Similar to E. coli C600, no UDP-N-acetylglucosamine-4-epimerase activity was detected in E. coli AD9. The activity became apparent in the E. coli AD9(pEEgne) extracts, and both UDP-GlcNAc and UDP-GalNAc functioned as substrates. However, the epimerase activity was completely absent in the extracts of E. coli AD9 strains expressing the Leu136Tyr, Cys297Tyr, or Leu136Tyr 䡠 Cys297Tyr variant, confirming the relevance of the absence of Tyr residues for the UDP-N-acetylglucosamine-4-epimerase function. On the other hand, both Gne variants with single mutations were able to complement the LPS phenotype of E. coli AD9, as the LPSs expressed by E. coli AD9(pEEgneY1) (Fig. 4B, lane 3) and E. coli AD9(pEEgneY2) (Fig. 4B, lane 2) were similar to that of E. coli C600 (Fig. 4B, lane 6). These results indicate that both variants were still able to catalyze the UDP-glucose-4-epimerase reaction. Interestingly, the Gne double mutant Leu136Tyr 䡠 Cys297Tyr only partially complemented the LPS phenotype of E. coli AD9 (Fig. 4B, lane 1), suggesting that the double mutation might have a subtle effect on the overall protein conformation, thereby affecting the enzymatic activity. It is worth mentioning that residues Leu136 and Cys297 are also conserved in Y. enterocolitica O:3 Gne, whereas in Bacillus subtilis Gne (10,), the combination is Ile-Cys. These residues are also present in an E. coli O:113 enzyme located in the wb cluster that has recently been shown to display UDP-N-acetylglucosamine-4-epimerase activity (30). This gene was also initially called galE because it encoded a product with a high degree of similarity to putative GalE proteins from a large number of bacteria. Therefore, we made a computer search for the presence of these critical residues in other proteins showing over 30% identity to Gne. Interestingly, most of them are called GalE in the databases. The following amino acid combinations were present in the respective residue positions 136 and 297 in 100 different proteins: Ala-Cys, Cys-Val, Ile-Cys, Ile-Leu, Ile-Val, Leu-Ala, Leu-Cys, Leu-Leu, Leu-Val, MetLeu, Leu-Ser, Pro-Ser, Thr-Met, Val-Cys, Val-Leu, Val-Met, Phe-Thr, Phe-Tyr, Tyr-Phe, Tyr-Ser, and Tyr-Tyr. Taking into account our modeling predictions, it is reasonable to speculate that proteins containing the underlined combinations will most likely have only the UDP-glucose-4-epimerase activity, whereas proteins containing the other combinations will have only the UDP-N-acetylglucosamine-4-epimerase activity or both. Future studies are required to confirm these predictions. We propose the use of two simple biological assays to get a first idea of the protein activity. A protein with UDP-glucose-4epimerase activity should complement the LPS phenotype of E. coli AD9, whereas an enzyme with UDP-N-acetylglucosamine-4-epimerase activity should complement the phenotype of E. coli C600(pLZ6010). O-unit specificity of Wzx, the Y. enterocolitica O:8 O-unit flippase. The ability of E. coli C600(pLZ6010) to express the SR-LPS is based on three prerequisites: (i) that Wzy is strictly specific for the O-unit to be polymerized, as demonstrated above; (ii) that Wzx has a relaxed specificity for the oligosaccharide to be translocated; and (iii) that the E. coli K-12 WaaL, the O-antigen ligase, has little or no specificity for the Oantigen to be ligated to the lipid A core. In fact, this feature of WaaL is the most likely explanation for the possibility of ex-
4284
BENGOECHEA ET AL.
J. BACTERIOL.
FIG. 3. Molecular modeling of the active sites of the Gne and GalE type 4 epimerases. (A) Superimposition of the Y. enterocolitica Gne active site with UDP-glucose (yellow; the 2⬘-hydroxyl group is cyan) and UDP-galactose (green; the 2⬘-hydroxyl group is white). The residues involved in sugar binding are shown as ball-and-stick diagrams. (B) Superimposition of the UDP-galactose (carbon atoms are green) complexes of Y. enterocolitica Gne and E. coli GalE. The conserved sugar binding residues are shown as ball-and-stick diagrams. The residues Cys297 and Leu136 in Y. enterocolitica Gne (cyan) are replaced with tyrosines (magenta) in E. coli GalE. The 2⬘-hydroxyl group of UDP-galactose is white. (C) Empty volume (cyan) in the active site of the Y. enterocolitica Gne/NADH/UDP-galactose model. The cavity is large enough to accommodate the aminoacetyl group of UDP-GalNAc. The residues Cys297 and Leu136 in Y. enterocolitica Gne (cyan) are replaced with tyrosines (magenta) in E. coli GalE.
pressing many heterologous O-antigens in E. coli K-12. However, in E. coli C600(pLZ6010), the translocation function could be provided either by the E. coli C600 wzx gene present in the cryptic O-antigen gene cluster (23, 41) or by the Y. enterocolitica O:8 wzx gene present in pLZ6010. Therefore, it might be possible for Y. enterocolitica O:8 Wzx to be as specific as Wzy for the O-unit substrate. To address this, pLZ6010 was transformed into E. coli S874, a K-12 derivative lacking the whole wb cluster (19), resulting in a situation where the Y.
enterocolitica O:8 Wzx would be the only enzyme able to translocate the O-units. The LPS patterns expressed by S874(pLZ6010) and C600(pLZ6010) (Fig. 5, lanes 2 and 4) were identical, and both were of the SR-LPS type, indicating that Y. enterocolitica O:8 Wzx was indeed able to translocate an O-unit with GlcNAc instead of GalNAc. Significantly, this finding gave further experimental support to a recent report by Feldman et al. (11) in which they showed that E. coli O7 and Salmonella enterica Wzx functions are rather nonspecific for
VOL. 184, 2002
O-ANTIGEN BIOSYNTHESIS OF YERSINIA ENTEROCOLITICA O:8
4285
FIG. 5. DOC-PAGE analysis followed by silver staining of LPS preparations from different E. coli strains. Lane 1, E. coli S874(pLZ6020); lane 2, E. coli S874(pLZ6010); lane 3, E. coli S874; lane 4, E. coli C600(pLZ6010); lane 5, E. coli C600.
FIG. 4. Critical role of the Cys297 and Leu136 residues in UDPN-acetylglucosamine-4-epimerase activity of Gne. (A) Dionex analysis of the UDP-N-acetylglucosamine-4-epimerase activities of different cell extracts. The sources of the cell extracts are shown at the right. The amino acid changes introduced in the Gne variants are Leu136Tyr in pEEgneY1, Cys297Tyr in pEEgneY2, and both in pEEgneY1Y2. UDPGalNAc was used as a substrate in all reactions. The positions of the UDP-GalNAc (Gal) and UDP-GlcNAc (Glc) peaks are indicated by vertical arrows. (B) Sodium dodecyl sulfate-PAGE analysis followed by silver staining of LPS preparations from different E. coli strains. Lane 1, E. coli AD9(pEEgneY1Y2); lane 2, E. coli AD9(pEEgneY2); lane 3, E. coli AD9(pEEgneY1); lane 4, E. coli AD9(pEEgne); lane 5, E. coli AD9; lane 6, E. coli C600.
the chemical structure of the saccharide moiety and that Wzx can even translocate incomplete O-units, although at reduced potential. The LPS expressed by S874(pLZ6020) was similar to that
of C600(pLZ6020) (compare Fig. 5, lane 1, and Fig. 2, lane 6), indicating that the Y. enterocolitica O:8 Wzx and Wzy proteins, together with the E. coli WaaL protein, were able to build up the Y. enterocolitica O:8 O-antigen and ligate it to the E. coli K-12 lipid A core. However, it should be pointed out that there was a large proportion of E. coli lipid A core molecules to which the Y. enterocolitica O:8 O-antigen had not been ligated. This is in sharp contrast to the situation in Yersinia, where almost all the lipid A core molecules are replaced by the O-antigen. One possible explanation could be a lower efficiency of the Y. enterocolitica O:8 O-unit biosynthesis in E. coli. Alternatively, and more attractive to us, there is the possibility that the final assembly of the LPS molecule from the separate components (the lipid A core and O-units) requires specific interactions among the proteins that are involved in its assembly, i.e., Wzx, Wzy, and WaaL. Apparently Y. enterocolitica O:8 Wzx and Wzy cooperate more efficiently with Y. enterocolitica O:8 WaaL than with the E. coli counterpart. It is further possible that these postulated protein-protein interactions contribute to the tight regulation of the O-antigen synthesis. Studies are in progress to test these ideas. ACKNOWLEDGMENTS We thank Regina Engel for technical assistance, Eric Bertoft for his help with the Dionex, Werner Brabetz for sending us the strain E. coli AD9, and the Skurnik laboratory members for their advice. This work was supported by grants from the Academy of Finland (project numbers 50441 and 45820), the bilateral Finnish-German researcher exchange program of the Academy of Finland and Deutscher Akademischer Austauschdienst, and the European Commission (contract QLRT-1999-00780).
4286
BENGOECHEA ET AL. REFERENCES
1. Alexander, D. C., and M. A. Valvano. 1994. Role of the rfe gene in the biosynthesis of the Escherichia coli O7-specific lipopolysaccharide and other O-specific polysaccharides containing N-acetylglucosamine. J. Bacteriol. 176: 7079–7084. 2. Appleyard, R. K. 1954. Segregation of new lysogenic types during growth of doubly lysogenic strain derived from Escherichia coli K12. Genetics 39:440– 452. 3. Bastin, D. A., G. Stevenson, P. K. Brown, A. Haase, and P. R. Reeves. 1993. Repeat unit polysaccharides of bacteria—a model for polymerization resembling that of ribosomes and fatty acid synthetase, with a novel mechanism for determining chain length. Mol. Microbiol. 7:725–734. 4. Batchelor, R. A., P. Alifano, E. Biffali, S. I. Hull, and R. A. Hull. 1992. Nucleotide sequences of the genes regulating O-polysaccharide antigen chain length (rol) from Escherichia coli and Salmonella typhimurium— protein homology and functional complementation. J. Bacteriol. 174: 5228–5236. 5. Batchelor, R. A., G. E. Haraguchi, R. A. Hull, and S. I. Hull. 1991. Regulation by a novel protein of the bimodal distribution of lipopolysaccharide in the outer membrane of Escherichia coli. J. Bacteriol. 173:5699–5704. 6. Berlyn, M. K. B., K. B. Low, and K. E. Rudd. 1996. Linkage map of Escherichia coli K-12, edition 9, p. 1715–1902. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2. American Society for Microbiology, Washington, D.C. 7. Byrappa, S., D. K. Gavin, and K. C. Gupta. 1995. A highly efficient procedure for site-specific mutagenesis of full-length plasmids using Vent DNA polymerase. Genome Res. 5:404–407. 8. Daniels, C., and R. Morona. 1999. Analysis of Shigella flexneri Wzz (Rol) function by mutagenesis and cross-linking: Wzz is able to oligomerize. Mol. Microbiol. 34:181–194. 9. Daniels, C., C. Vindurampulle, and R. Morona. 1998. Overexpression and topology of the Shigella flexneri O-antigen polymerase (Rfc/Wzy). Mol. Microbiol. 28:1211–1222. 10. Estrela, A. I., H. M. Pooley, H. de Lencastre, and D. Karamata. 1991. Genetic and biochemical characterization of Bacillus subtilis 168 mutants specifically blocked in the synthesis of the teichoic acid poly(3-O-beta-Dglucopyranosyl-N-acetylgalactosamine 1-phosphate): gneA, a new locus, is associated with UDP-N-acetylglucosamine 4-epimerase activity. J. Gen. Microbiol. 137:943–950. 11. Feldman, M. F., C. L. Marolda, M. A. Monteiro, M. B. Perry, A. J. Parodi, and M. A. Valvano. 1999. The activity of a putative polyisoprenol-linked sugar translocase (Wzx) involved in Escherichia coli O antigen assembly is independent of the chemical structure of the O repeat. J. Biol. Chem. 274:35129–35138. 12. Galan, J. E., and R. Curtiss III. 1990. Expression of Salmonella typhimurium genes required for invasion is regulated by changes in DNA supercoiling. Infect. Immun. 58:1879–1885. 13. Gripenberg-Lerche, C., M. Skurnik, L. J. Zhang, K. O. So ¨derstro ¨m, and P. Toivanen. 1994. Role of YadA in arthritogenicity of Yersinia enterocolitica serotype O:8: experimental studies with rats. Infect. Immun. 62:5568–5575. 14. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557–580. 15. Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J. Bacteriol. 154:269–277. 16. Holst, O., W. Broer, J. E. Thomasoates, U. Mamat, and H. Brade. 1993. Structural analysis of oligosaccharide bisphosphates isolated from the lipopolysaccharide of a recombinant strain of Escherichia coli F515 (Re chemotype) expressing the genus-specific epitope of Chlamydia lipopolysaccharide. Eur. J. Biochem. 214:703–710. 17. Johnson, M. S., A. C. May, M. A. Rodionov, and J. P. Overington. 1996. Discrimination of common protein folds: application of protein structure to sequence/structure comparisons. Methods Enzymol. 266:575–598. 18. Johnson, M. S., and J. P. Overington. 1993. A structural basis for sequence comparisons. An evaluation of scoring methodologies. J. Mol. Biol. 233:716– 738. 19. Keenleyside, W. J., M. Perry, L. Maclean, C. Poppe, and C. Whitfield. 1994. A plasmid-encoded rfbO:54 gene cluster is required for biosynthesis of the O:54 antigen in Salmonella enterica serovar Borreze. Mol. Microbiol. 11:437– 448. 20. Kikuchi, A., D. Elseviers, and L. Gorini. 1975. Isolation and characterization of lambda transducing bacteriophages for argF, argI and adjacent genes. J. Bacteriol. 122:727–742. 21. Kraulis, P. J. 1991. MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures. J. Appl. Crystallogr. 24:946–950. 22. Laskowski, R. A. 1995. SURFNET: a program for visualizing molecular surfaces, cavities, and intermolecular interactions. J. Mol. Graph. 13:323– 330.
J. BACTERIOL. 23. Liu, D., and P. R. Reeves. 1994. Escherichia coli K12 regains its O antigen. Microbiology 140:49–57. 24. Merritt, E. A., and D. J. Bacon. 1997. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277:505–524. 25. Michiels, T., and G. R. Cornelis. 1991. Secretion of hybrid proteins by the Yersinia Yop export system. J. Bacteriol. 173:1677–1685. 26. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575–2583. 27. Moreno, F., R. Rodicio, and P. Herrero. 1981. A new colorimetric assay for UDP-glucose 4-epimerase activity. Cell. Mol. Biol. 27:589–592. 28. Morona, R., L. Van Den Bosch, and G. Daniels. 2000. Evaluation of Wzz/ MPA1/MPA2 proteins based on the presence of coiled-coil regions. Microbiology 146:1–4. 29. Morona, R., L. Van Den Vosch, and P. A. Manning. 1995. Molecular, genetic, and topological characterization of O-antigen chain length regulation in Shigella flexneri. J. Bacteriol. 177:1059–1068. 30. Paton, A. W., R. Morona, and J. C. Paton. 2001. Neutralization of Shiga toxins Stx1, Stx2c, and Stx2e by recombinant bacteria expressing mimics of globotriose and globotetraose. Infect. Immun. 69:1967–1970. 31. Pepe, J. C., J. L. Badger, and V. L. Miller. 1994. Growth phase and low pH affect the thermal regulation of the Yersinia enterocolitica inv gene. Mol. Microbiol. 11:123–135. 32. Pierson, D. E., and S. Carlson. 1996. Identification of the galE gene and a galE homolog and characterization of their roles in the biosynthesis of lipopolysaccharide in a serotype O:8 strain of Yersinia enterocolitica. J. Bacteriol. 178:5916–5924. 33. Raetz, C. R. H. 1996. Bacterial lipopolysaccharides: a remarkable family of bioactive macroamphiphiles, p. 1035–1063. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. 34. Sali, A., and T. L. Blundell. 1993. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234:779–815. 35. Sanderson, K. E., A. Hessel, S.-L. Liu, and K. E. Rudd. 1996. The genetic map of Salmonella typhimurium, edition VIII, p. 1903–1999. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2. American Society for Microbiology, Washington, D.C. 36. Simon, R., U. Priefer, and A. Pu ¨hler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1:784–791. 37. Skurnik, M. 1999. Molecular genetics of Yersinia lipopolysaccharide, p. 23– 51. In J. Goldberg (ed.), Genetics of bacterial polysaccharides. CRC Press, Boca Raton, Fla. 38. Skurnik, M., A. Peippo, and E. Ervela ¨. 2000. Characterization of the Oantigen gene clusters of Yersinia pseudotuberculosis and the cryptic O-antigen gene cluster of Yersinia pestis shows that the plague bacillus is most closely related to and has evolved from Y. pseudotuberculosis serotype O:1b. Mol. Microbiol. 37:316–330. 39. Skurnik, M., R. Venho, P. Toivanen, and A. Al-Hendy. 1995. A novel locus of Yersinia enterocolitica serotype O:3 involved in lipopolysaccharide outer core biosynthesis. Mol. Microbiol. 17:575–594. 40. Sonnhammer, E. L. L., G. von Heijne, and A. Krogh. 1998. A hidden Markov model for predicting transmembrane helices in protein sequences, p. 175– 182. In J. Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C. Sensen (ed.), Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology. AAAI Press, Menlo Park, Calif. 41. Stevenson, G., B. Neal, D. Liu, M. Hobbs, N. H. Packer, M. Batley, J. W. Redmond, L. Lindquist, and P. Reeves. 1994. Structure of the O antigen of Escherichia coli K-12 and the sequence of its rfb gene cluster. J. Bacteriol. 176:4144–4156. 42. Susskind, M., S. Muller-Loennies, W. Nimmich, H. Brade, and O. Holst. 1995. Structural investigation on the carbohydrate backbone of the lipopolysaccharide from Klebsiella pneumoniae rough mutant R20/01⫺. Carbohydr. Res. 269:C1-C7. 43. Thoden, J. B., P. A. Frey, and H. M. Holden. 1996. Molecular structure of the NADH/UDP-glucose abortive complex of UDP-galactose 4-epimerase from Escherichia coli: implications for the catalytic mechanism. Biochemistry 35: 5137–5144. 44. Thoden, J. B., and H. M. Holden. 1998. Dramatic differences in the binding of UDP-galactose and UDP-glucose to UDP-galactose 4-epimerase from Escherichia coli. Biochemistry 37:11469–11477. 45. Thoden, J. B., T. M. Wohlers, J. L. Fridovich-Keil, and H. M. Holden. 2000. Crystallographic evidence for Tyr 157 functioning as the active site base in human UDP-galactose 4-epimerase. Biochemistry 39:5691–5701. 46. Thoden, J. B., T. M. Wohlers, J. L. Fridovich-Keil, and H. M. Holden. 2001. Molecular basis for severe epimerase deficiency galactosemia. X-ray struc-
VOL. 184, 2002
47. 48. 49. 50.
O-ANTIGEN BIOSYNTHESIS OF YERSINIA ENTEROCOLITICA O:8
ture of the human V94m-substituted UDP-galactose 4-epimerase. J. Biol. Chem. 276:20617–20623. Tomshich, S. V., R. P. Gorshkova, and Y. S. Ovodov. 1987. Structural investigation of the lipopolysaccharide of Y. enterocolitica serovar O:8. Khim. Prir. Soedin., p. 657–664. ¨ ber die Ekstraktion von Westphal, O., O. Lu ¨deritz, and F. Bister. 1952. U Bakterien mit Phenol/Wasser. Z. Naturforsch. 7:148–155. Whitfield, C. 1995. Biosynthesis of lipopolysaccharide O antigens. Trends Microbiol. 3:178–185. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103–119.
4287
51. Zhang, L., J. Radziejewska-Lebrecht, D. Krajewska-Pietrasik, P. Toivanen, and M. Skurnik. 1997. Molecular and chemical characterization of the lipopolysaccharide O-antigen and its role in the virulence of Yersinia enterocolitica serotype O:8. Mol. Microbiol. 23:63–76. 52. Zhang, L., and M. Skurnik. 1994. Isolation of an R⫺ M⫹ mutant of Yersinia enterocolitica serotype O:8 and its application in construction of rough mutants utilizing mini-Tn5 derivatives and lipopolysaccharide-specific phage. J. Bacteriol. 176:1756–1760. 53. Zhang, L., P. Toivanen, and M. Skurnik. 1996. The gene cluster directing O-antigen biosynthesis in Yersinia enterocolitica serotype O:8: identification of the genes for mannose and galactose biosynthesis and the gene for the O-antigen polymerase. Microbiology 142:277–288.
