Curr Genet (2007) 51:161–169 DOI 10.1007/s00294-006-0107-9
R E SEARCH ART I CLE
Functional analysis of Kluyveromyces lactis carboxylic acids permeases: heterologous expression of KlJEN1 and KlJEN2 genes Odília Queirós · Leonor Pereira · Sandra Paiva · Pedro Moradas-Ferreira · Margarida Casal
Received: 3 October 2006 / Accepted: 17 October 2006 / Published online: 21 December 2006 © Springer-Verlag 2006
Abstract The present work describes a detailed physiological and molecular characterization of the mechanisms of transport of carboxylic acids in Kluyveromyces lactis. This yeast species presents two homologue genes to JEN1 of Saccharomyces cerevisiae: KlJEN1 encodes a monocarboxylate permease and KlJEN2 encodes a dicarboxylic acid permease. In the strain K. lactis GG1888, expression of these genes does not require an inducer and activity for both transport systems was observed in glucose-grown cells. To conWrm their key role for carboxylic acids transport in K. lactis, null mutants were analyzed. Heterologous expression in S. cerevisiae has been performed and chimeric fusions with GFP showed their proper localization in the Communicated by K. Breunig.
plasma membrane. S. cerevisiae jen1 cells transformed with KlJEN1 recovered the capacity to use lactic acid, as well as to transport labeled lactic acid by a mediated mechanism. When KlJEN2 was heterologously expressed, S. cerevisiae transformants gained the ability to transport labeled succinic and malic acids by a mediated mechanism, exhibiting, however, a poor growth in malic acid containing media. The results conWrmed the role of KlJen1p and KlJen2p as mono and dicarboxylic acids permeases, respectively, not subjected to glucose repression, being fully functional in S. cerevisiae. Keywords Yeast · Kluyveromyces lactis · Carboxylate transport · Heterologous expression · GFP
Introduction
O. Queirós and L. Pereira contributed equally to this work. O. Queirós Instituto Superior de Ciências da Saúde-Norte (ISCSN), Rua Central da Gandra 1317 4585-116 Gandra, Paredes, Portugal L. Pereira · S. Paiva · M. Casal (&) Centro de Biologia, Departamento de Biologia, Universidade do Minho, Campus de Gualtar, 4710-057 Braga, Portugal e-mail:
[email protected] O. Queirós · L. Pereira · P. Moradas-Ferreira Instituto de Biologia Molecular e Celular (IBMC), Universidade do Porto, R. Campo Alegre 823, 4150-180 Porto, Portugal P. Moradas-Ferreira Instituto de Ciências Biomédicas Abel Salazar (ICBAS), Universidade do Porto, Largo Professor Abel Salazar 2, 4099-003 Porto, Portugal
The interest of the metabolism and transport of carboxylic acids in yeast lies on the fact that they can lead to Wnal products or sub-products that interfere with the organoleptic characteristics and preservation of food (Radler 1983). The transport of the undissociated form of carboxylic acid(s) through the lipid membranes can occur by simple diVusion, in contrast with the uptake of the anionic form(s) that requires a mediated mechanism. The Wrst report on the existence of a mediated transport system for carboxylic acids was performed in Kluyveromyces lactis for L-malic acid (Zmijewski and Macquillan 1975). Additional dicarboxylate transporters have since then been identiWed in several yeasts, namely Candida sphaerica (Côrte-Real and Leão 1989), Hansenula anomala (Côrte-Real and Leão 1990), C. utilis (Cássio and Leão 1993) and K. marxianus (Queirós et al. 1998). In all these yeasts, the dissociated
123
162
Curr Genet (2007) 51:161–169
form is transported across the plasma membrane through a proton symport mechanism, which is induced by the substrate and subjected to glucose repression. In Schizosaccharomyces pombe a dicarboxylate permease is present, which behaves diVerently: it is not glucose repressed and, instead, it requires the presence of an assimilable carbon source, like glucose or glycerol, to transport malate (Osothsilp and Subden 1986; Sousa et al. 1992). Monocarboxylic acid proton symporters with a very similar range of substrates, all accepting lactate, pyruvate, acetate and propionate were described in the yeasts C. utilis, Saccharomyces cerevisiae, Torulaspora delbrueckii, Zygosaccharomyces bailii and Dekkera anomala (Leão and van Uden 1986; Cássio et al. 1987; Casal et al. 1996; Casal and Leão 1995; Gerós et al. 2000; Sousa et al. 1996). In K. marxianus, the monocarboxylate transporter works through a diVerent mechanism since no proton movements are associated with lactate uptake, suggesting that the transporter is a uniporter (Fonseca et al. 1991). All the monocarboxylate transporters referred so far are repressed by glucose except in Z. bailii, where activity of a transporter speciWc for acetate is present in glucose-grown cells (Sousa et al. 1996). The Wrst carboxylate permease gene identiWed in yeast was the gene mae1, coding for the transporter of dicarboxylic acids of S. pombe (Grobler et al. 1995). In S. cerevisiae, the gene JEN1 was found to encode for a monocarboxylic acid permease shared by lactic, pyruvic, acetic, and propionic acids and repressed by glucose (Casal et al. 1999; Andrade and Casal 2001). Recently, the gene ADY2 was reported as a new key element in the mechanism of transport of acetic acid in S. cerevisiae (Paiva et al. 2004). In C. albicans a recent study has identiWed a gene, CaJEN1, homologous to the JEN1 of S. cerevisiae, coding for a permease involved in the uptake of lactic, pyruvic, and propionic acids and also subjected to glucose repression (SoaresSilva et al. 2004). In K. lactis, a yeast species that can
use mono and dicarboxylic acids as the sole carbon and energy source, two homologues to the S. cerevisiae JEN1 gene were identiWed and named KlJEN1 and KlJEN2 (Lodi et al. 2004). This identiWcation has been performed by screening the K. lactis genome sequence available at the Génolevures database (http://www.cbi.labri.fr/Genolevures/index.php). KlJ EN1 (AN AJ585426) was demonstrated to be a functional homologue of S. cerevisiae JEN1 gene. However, KlJEN2 (AN AJ627630), that revealed a lower homology with JEN1 gene, encodes for a dicarboxylic acid permease. We report here, the deeper characterization of carboxylate transport systems found in K. lactis showing their full functionality in S. cerevisiae.
Materials and methods Strains, plasmids and media The yeast strains used in this study are listed in Table 1. Yeast cells were grown in a 0.7% Difco yeast nitrogen base mineral medium (YNB medium), supplemented with the adequate requirements for prototrophic growth. Carbon sources are described in the results. Solid media were prepared adding agar (2% w/v) to the respective liquid media. Growth was carried out at 26°C, both in liquid and solid media. For growth under repression conditions, the yeast cells were cultivated in YNB medium with glucose (YNglucose). For derepression conditions, glucose grown cells were collected, washed twice with ice-cold deionised water and inoculated into YNB medium with DL-malic acid (1% w/v; pH 5.0), succinic acid (1% w/v; pH 5.0) or DL-lactic acid (0.5% w/v; pH 5.0). Escherichia coli XL-1 blue served as plasmid host. Its cultivation and media were performed as described previously (Sambrook et al. 1989). The plasmid pGEM-T easy (Promega, Madison,
Table 1 Yeast strains used in this work Strain
Genotype
Reference or source
Saccharomyces cerevisiae W303-1A jen1 jen1—pKlJEN1 jen1—pKlJEN2 jen1—pKlJEN1GFP jen1—pKlJEN2GFP
MATa ade2 leu2 his3 trp1 ura3 W303-1A jen1::KanMx4 jen1 transformed with the plasmid p416-KlJEN1 jen1 transformed with the plasmid p416-KlJEN2 jen1 transformed with the plasmid pUG35-KlJEN1GFP jen1 transformed with the plasmid pUG23-KlJEN2GFP
Thomas and Rothstein (1989) Sandra Paiva This work This work This work This work
Kluyveromyces lactis GG 1888 kljen1 kljen2 kljen1 kljen2
CBS 2359 Mat a ura3-59 GG 1888 kljen1::loxPKanMX4loxP GG 1888 kljen2::KanMX4loxP GG1888 kljen1::loxPkljen2::KanMX4loxP
A Winkler This work This work This work
123
Curr Genet (2007) 51:161–169
WI) was used for subclonings. The loxP-KanMX4-loxP gene marker used in the construction of the disruption cassettes was obtained from the plasmid pUG6 (Güldener et al. 1996). The yeast shuttle vector p416-GPD (CEN6/ARSH4) was kindly provided by Dr. Dominik Mumberg (Institut für Molekularbiologie und Tumorforschung, Philipps-Universität Marburg, Germany) (Mumberg et al. 1995). The plasmids pUG35 and pUG23 were used to fuse KlJEN1 and KlJEN2 with GFP (U. Güldener and J.H. Hegemann unpublished). The plasmid pKLNatCre, used to remove the KanMX4 marker, was kindly provided by Dr. Steensma (Institute of Molecular Plant Sciences, Leiden University, Leiden, The Netherlands). DNA manipulation and cloning techniques General procedures for DNA cloning and manipulations were essentially performed according to standard protocols (Sambrook et al. 1989). KlJEN1 and KlJEN2 entire genes were ampliWed from K. lactis GG1888 genomic DNA using primers jen1f (5⬘TTCA ACCGGATCCATGAATAACAACAATATTAC3⬘) and jen1r (5⬘CATTAAGTCGACTCAAACTGAAA CCTTTTCCAATTG3⬘) and jen2f (5⬘ATATAACC GGATCCATGGCTGCAGAATCAATAG3⬘) and jen2r (5⬘CTTTCCGTCGACTTATACTCTTTCCTT ATGTTG3⬘), respectively. The cloned PCR products were veriWed by DNA sequencing. The sequencing was performed following the method of Sanger et al. (1977), using an ABI PRISM 310 Genetic Analyzer. The primers introduced a BamHI and a SalI restriction sites at the 5⬘ and 3⬘ ends of the genes. The BamHISalI fragments containing KlJEN1-2 genes were cloned in the p416-GPD vector. To fuse KlJEN1 and KlJEN2 with GFP, the stop codon was removed and the primers jen1r and jen2r were substituted by the primers jen1rgfp (5⬘CATTAAGTCGACAACTGAAACCTT TTCCAATTG3⬘) and jen2rgfp (5⬘CTTTCCGTCGA CTACTCTTTCCTTATGTTG3⬘), respectively. These primers introduced a SalI restriction sites at the 3⬘ end of the genes. The BamHI-SalI fragments containing KlJEN1-2 genes without the stop codon were cloned in the pUG35-23 vectors (U. Güldener and J.H. Hegemann unpublished), in frame with GFP. Heterologous expression of KlJEN1 and KlJEN2 genes in Saccharomyces cerevisiae KlJEN1 and KlJEN2 were cloned in the shuttle vector p416-GPD. The resulting plasmids were used to transform the S. cerevisiae jen1 strain. The transformants were selected in YNGlucose medium without uracil.
163
Cellular localization of Kljen1-gfp and Kljen2-gfp Saccharomyces cerevisiae jen1 strain was transformed with the constructions pUG35-KlJEN1GFP and pUG23-KlJEN2GFP. The transformants were selected in YNglucose medium without uracil or histidine, respectively. S. cerevisiae living cell images were registered as described by Soares-Silva et al. (2004). Disruption of KlJEN1 and KlJEN2 genes in Kluyveromyces lactis The entire KlJEN1 and KlJEN2 genes were subcloned in pGEM-T easy. For the disruption of KlJEN1 gene, the EcoRV-HpaI fragment spanning the region from 508 to 850 bp was substituted for a PvuII-EcoRV fragment carrying the loxPKanMX4loxP marker from the plasmid pUG6. The disrupted gene was ampliWed by PCR, using the primers jen1f and jen1r and the fragment was used to transform the K. lactis GG1888 strain. For the disruption of KlJEN2 gene, the BglIIEcoRV fragment spanning the region from 1,114 to 1,464 bp was substituted for a BglII-EcoRV fragment carrying the KanMX4loxP marker from the plasmid pUG6. The disrupted gene was ampliWed by PCR, using the primers jen2f and jen2r and the fragment was used to transform the K. lactis GG1888 strain. To construct the double mutant, the KanMX4 marker was removed from the mutant kljen1, according to the protocol described by Steensma (2003). The resulting strain was transformed with the same ampliWed fragment used to construct the kljen2 mutant strain. All the transformants were selected in YPD plates containing geneticin (200 g ml¡1). Gene deletions were veriWed by PCR. K2 (5⬘TCGATAGATTGTCGCACCT G3⬘), K3 (5⬘CATCCTATGGAAATGCCTCGG3⬘), Jen1-5⬘ext (5⬘CGA CAA TCA ACG TTC TTC CAA3⬘), Jen1-3⬘ext (5⬘GTG CAC ATG AGT GTG GGT G3⬘), Jen2-5⬘ext (5⬘CGC AGC GGT TCA GGT TTC3⬘), and Jen2-3⬘ext (5⬘CAA AGA CCA AAT TAC CTG GG3⬘) primers were used to verify the insertion of KanMX4 gene and to conWrm KlJEN1 and KlJEN2 genes disruption. The expression of KlJEN1 and KlJEN2 genes in the mutant strains was evaluated by Northern blot assays. Northern-blot Total RNA was isolated using hot acidic phenol. The samples of RNA (20 g) were electrophoresed on 1.5% (w/v) agarose Mops/formaldehyde gels and blotted onto Hybond-N+ membranes (Ausubel et al. 1998). An internal fragment of KlJEN1 or KlJEN2 genes,
123
164
Curr Genet (2007) 51:161–169
ampliWed by PCR with the pairs of primers jen1c (5⬘GCTCGAATTCATCGATGGTTGTTTCACTTA TCCAG3⬘)/jen1r and jen2c (5⬘GCTCGAATTCAT CGATGGGTGGTATCATTGTTGTTGCC3⬘)/jen2r, respectively, was 32P-labeled and used as probe. Actin RNA was used as internal control.
1/V (nmol s-1mg-1dry wt)-1
50
Transport assays Transport assays were performed according to the method described previously (Queirós et al. 1998). The radioactively labeled substrates were [2, 3-14C] succinic acid (NEN Life Science), L-[1,4(2,3)-14C] malic acid (CFB42—Amersham, Freiburg, Germany) and L-[U14 C] lactic acid (CFB97—Amersham) with a speciWc activity of 3,000 dpm nmol¡1. To determine the kinetic parameters and the transport kinetics that best Wtted the experimental initial uptake rate values, a computer-assisted non-linear regression analysis (GraphPAD software, San Diego, CA, USA) was used. All experiments were performed in triplicate and the data reported here represent the average values.
Results Transport of carboxylic acids in Kluyveromyces lactis GG1888 Cells of K. lactis GG1888 derepressed on 0.5% DL-lactic acid (pH 5.0) during 4 h were used to measure the initial uptake rates of L-lactic acid over a concentration range from 0.1 to 4.0 mM. The uptake mechanism at pH 5.0 obeyed a Michaelis–Menten kinetics and was characterized by a maximum velocity (Vmax) of 1.44 § 0.17 nmol lactic acid s¡1 mg¡1 d.w. and a Michaelis constant (Km) of 2.08 § 0.50 mM of total lactic acid. Pyruvic acid inhibited competitively lactic acid uptake, indicating that the transport system is shared by both acids (Fig. 1). Kluyveromyces lactis malic or succinic acid growncells (0.5% w/v) were used to measure the initial
30 20 10 0
–2
–1
0
2
3
4
5
6
7
8
9
10
-1
1/[L-lactic acid] (mM ) Fig. 1 Lineweaver–Burk plots of initial uptakes rates of labeled L-lactic acid (pH 5.0) as a function of lactic acid concentration, in Kluyveromyces lactis GG1888 cells after 4 h of induction in medium containing lactic acid. Absence of pyruvic acid (Wlled triangle); presence of 1 mM pyruvic acid (Wlled square); presence of 2 mM pyruvic acid (Wlled circle)
uptakes rates of labeled malic and succinic acids at pH 5.0, respectively. In both cases, a Michaelis–Menten kinetics was found, indicating the presence of a mediated transport system. In malic acid derepressed cells, the values estimated for the kinetic parameters were: Km = 0.15 § 0.03 mM total malic acid and Vmax = 0.77 § 0.04 nmol malic acid s¡1 mg¡1 d.w. and Km = 0.11 § 0.03 mM succinic acid and Vmax = 0.75 § 0.04 nmol succinic acid s¡1 mg ¡1 d.w. Similar parameters were found in succinic acid grown cells. Additionally, malic acid uptake was competitively inhibited by succinic acid, and vice-versa, indicating that the transport system is shared by both acids (data not shown). These results are in agreement with previous data reported by Zmijewski and MacQuillan (1975). In this work, we measured the activity of carboxylic transport systems in glucose exponential grown cells. For all the acids mentioned above, a mediated transport system was found. The Km values estimated were of the same order of magnitude when compared to the ones obtained in acid-grown cells; however lower Vmax values were found (Fig. 2).
B
0.3
0.1
0.25
-1
0.20 0.15
-1
-1
-1
0.2
0.10 0.05 0.00
0.0
0
123
1
V(nmol s mg dry wt)
A V(nmol s mg dry wt)
Fig. 2 Initial uptakes rates of a labeled L-lactic acid and b labeled L-malic (Wlled triangle) and succinic acids (Wlled square) at pH 5.0, in Kluyveromyces lactis GG1888 cells exponentially grown in glucose
40
1
2 3 4 [L-lactic acid] (mM)
5
0.0
0.5
1.0
1.5
2.0
[dicarboxylic acids] (mM)
2.5
Curr Genet (2007) 51:161–169
165
Physiological analysis of Kluyveromyces lactis mutants To address the role of the proteins encode by KlJEN1 and KlJEN2 genes regarding the utilization of carboxylic acids, three null mutant strains were constructed (kljen1, kljen2, and kljen1kljen2), as mentioned in Materials and methods. Gene disruptions were conWrmed by PCR. Furthermore, northern-blot assays revealed the absence of expression of the respective disrupted gene using probes against KlJEN1 and KlJEN2 and this assay proved that no cross-labeling of the probes was occurring, conWrming their speciWcity for the corresponding gene (data not shown). We evaluated the ability of K. lactis null mutants and wild type strain to grow in medium containing pyruvic acid, malic acid or glucose, as sole carbon and energy source (Fig. 3). The growth of K. lactis kljen1 strain in pyruvic acid medium was lower, compared with the wild type strain, and no diVerence was found for malic acid grown cells. Cells of K. lactis kljen2 strain exhibited an inverse phenotype: a lower growth on malic acid media and no diVerences were detected in pyruvic acid media. As expected, growth of the double mutant cells was aVected both in mono and dicarboxylic acid utilization. Initial uptake rates of labeled mono and dicarboxylic acids were also measured in the three mutants, using the derepression conditions previously used for the wild-type strain (Table 2). In cells of K. lactis kljen1 and kljen1kljen2 strains, no activity was found for the lactate permease, whereas K. lactis kljen2 strain exhibited a mediated transport system with kinetic parameters of the same order of magnitude to the ones found in the wild type strain. For dicarboxylic acids uptake, the activity of the permease was estimated with labeled succinic and malic acids, both in succinic and in malic acid-derepressed cells. Cells of K. lactis kljen2 and kljen1kljen2 strains did not display activity of the dicarboxlylate permease, whereas K. lactis kljen1 strain presented a mediated transport system with kinetic parameters of the same Fig. 3 Growth phenotypes of Kluyveromyces lactis GG1888 and mutant strains in solid media at pH 5.0. 10-fold serial dilutions were performed and 5 l of each suspension were applied. The growth was evaluated after 3 days of incubation at 26°C
order of the ones found in the wild type strain (Table 2). Expression analysis of KlJEN1 and KlJEN2 genes Northern-blot analysis of KlJEN1 and KlJEN2 was evaluated in K. lactis GG1888 cells cultivated in media containing distinct carbon sources (mono-, di- and tricarboxylic acids) in diVerent times (0, 2, 4, and 6 h). The time 0 corresponds to glucose grown-cells collected at mid-exponential phase; the remaining times correspond to 2, 4, and 6 h of incubation in the indicated media (Fig. 4). Both genes were expressed in glucose grown cells. KlJEN1 gene displayed the highest expression in medium containing lactic acid, as the sole carbon and energy source. Regarding KlJEN2 gene, a similar expression pattern was observed in the presence of lactic acid and dicarboxylic acids. Both genes presented very low expression levels in citric acid media. The expression was also analyzed in cells grown in media containing glycerol or ethanol as sole carbon and energy source. In comparison with KlJEN1, a higher expression of KlJEN2 was found in these carbon sources (data not shown). Heterologous expression of KlJEN1 and KlJEN2 genes in Saccharomyces cerevisiae Experiments regarding KlJEN1 and KlJEN2 heterologous expression were performed in the yeast strain S. cerevisiae jen1, which is unable to use and to transport lactic and pyruvic acids. The subsequent cloning of the ScJEN1 gene in this mutant strain re-established the growth in these carbon sources and the transport of monocarboxylic acids trough the plasma membrane (Casal et al. 1999). S. cerevisiae species behave as natural mutants in what concerns the transport of dicarboxylic acids since no mediated transport system was found for these substrates (Salmon 1987; Radler 1993). Based on these assumptions, heterologous expression of the genes KlJEN1 and KlJEN2 has been performed
YNB glucose 2%
YNB pyruvic acid 0.5%, pH 5.0
YNB malic acid 1%, pH 5.0
K. lactis strains GG 1888
kljen1∆
kljen2∆
kljen1∆ kljen2∆
123
123
Km (mM) Vmax (nmol s¡1 mg¡1 d.w.) 0.15 § 0.03 0.77 § 0.04 0.16 § 0.03 0.76 § 0.06 – – – – YNB malic acid 1%, pH 5.0 Km (mM) Vmax (nmol s¡1 mg¡1 d.w.) 0.11 § 0.03 0.75 § 0.05 0.07 § 0.03 0.76 § 0.06 – – – – YNB succinic acid 1%, pH 5.0 Km (mM) Vmax (nmol s¡1 mg¡1 d.w.) 2.08 § 0.50 1.44 § 0.17 – – 2.39 § 0.65 1.43 § 0.20 – – YNB lactic acid 0.5%, pH 5.0 Kluyveromyces lactis strains GG 1888 kljen1 kljen2 kljen1kljen2 Medium
Kinetic parameters
Kd (l s¡1 mg¡1 d.w.) – 0.02 § 0.002 – 0.04 § 0.003
Labeled succinic acid, pH 5.0 Labeled lactic acid, pH 5.0
Kd (l s¡1 mg¡1 d.w.) – – 0.07 § 0.008 0.06 § 0.004
Labeled malic acid, pH 5.0
Kd (l s¡1 mg¡1 d.w.) – – 0.05 § 0.005 0.06 § 0.004
Curr Genet (2007) 51:161–169 Table 2 Kinetic parameters for the transport of labeled lactic, succinic and malic acids at pH 5.0 in Kluyveromyces lactis strains after 4 h of induction in lactic, succinic and malic acids containing medium, respectively
166
in the strain S. cerevisiae jen1. In this approach, we utilized the plasmid p416-GPD, a centromeric vector that contains the constitutive promoter GPD (Mumberg et al. 1995), in order to assess whether KlJEN1 and KlJEN2 would complement the mutant phenotype or not. This system has been successfully utilized before, when ScJEN1 cloned in this plasmid restored the lactate permease activity in S. cerevisiae jen1 strain (Soares-Silva et al. 2003). Kinetic parameters were determined for lactic acid uptake (pH 5.0) in S. cerevisiae jen1 cells transformed with the empty vector and vectors containing the genes KlJEN1 and KlJEN2. The expression of KlJEN1 gene restored the capacity of the cells to transport labeled lactic acid by a mediated mechanism. In contrast, S. cerevisiae jen1-pKlJEN2 strain presented a simple diVusion mechanism for lactic acid uptake, like the one observed in the S. cerevisiae jen1 strain transformed with the empty vector (Fig. 5a). Regarding succinic and malic acids uptakes at pH 5.0 (Figs. 5b, c) only the strain S. cerevisiae jen1–pKlJEN2 presented a mediated mechanism for the transport of these substrates, although a lower values for Vmax (Vmax = 0.26 nmol s¡1 mg¡1 d.w. for succinic acid; Vmax = 0.21 nmol s¡1 mg d.w. for malic acid) were obtained when compared to the ones determined for K. lactis (Table 2). In agreement with the literature, S. cerevisiae W303-1A strain, induced during 4 h in these substrates, presented a simple diVusion mechanism for dicarboxylic acids (Queirós 2002; Salmon 1987). The same results were found for the strains S. cerevisiae jen1—p416GPDø and S. cerevisiae jen1—pKlJEN1. To further characterize the role of KlJen1p and KlJen2p, we investigated their subcelullar localization using GFP as reporter gene, by the construction of chimeric proteins (Kljen1-GFPp and Kljen2-GFPp). Fluorescence microscopy revealed that the fusion proteins were localized in the plasma membrane, reinforcing their role as full functional transporters in S. cerevisiae (Fig. 6).
Discussion The study of the metabolism and transport of carboxylic acids is important under a biotechnological perspective since these substrates are widely distributed in nature, being frequently Wnal products and/or subproducts of several industrial processes. The species K. lactis belongs to the group of yeasts able to use eYciently mono- and dicarboxylic acids as sole carbon and energy sources and to transport these substrates by a mediated mechanism (Zmijewski and Macquillan 1975;
Curr Genet (2007) 51:161–169
167
Time (hours) 0
2
4
6
2
4
6
2
4
6
2
4
6
KlJEN1 KlJEN2 KlACT YNB Glucose 2%
YP Citric acid 1%, pH 5.0
YNB Lactic acid 1%, pH 5.0
Fig. 4 Transcription analysis of KlJEN1 and KlJEN2 genes was performed in Kluyveromyces lactis GG1888 cells. Total RNA was prepared from exponentially glucose grown cells (time 0) and after 2, 4, and 6 h of induction in diVerent media containing mono-, 0.35
0.6 0.5 0.4 0.3 0.2 0.1
0.3
B
0.30 0.25 0.20 0.15 0.10 0.05 0.00
0.0 0
1
2 3 4 [L-lactic acid] (mM)
5
0.0
YNB Malic acid 1%, pH 5.0
di- and tricarboxylic acids as the only carbon and energy sources. Internal fragments of KlJEN1 and KlJEN2 were used as probes. KlACT was used as reference for relatively constant transcription
V ( nmol s-1mg -1 dry wt)
A
0.7
V ( nmol s-1mg-1 dry wt)
V ( nmol s-1mg-1 dry wt)
0.8
YNB Succinic acid 1%, pH 5.0
0.5
1.0 1.5 2.0 [succinic acid] (mM)
Fig. 5 Initial uptake rates of labeled lactic acid (a), succinic acid (b), and malic acid (c), at pH 5.0, as a function of the acid concentration, measured in Saccharomyces cerevisiae strains. Transport assays were performed in Saccharomyces cerevisiae W303-1A cells (Wlled square) induced for 4 h in medium containing lactic,
Wésolowski-Louvel et al. 1996; Queirós et al. 2003, Lodi et al. 2004). The present work describes a detailed characterization of KlJEN1 and KlJEN2 genes in K. lactis GG1888 strain, which encode for permeases responsible for the transport of mono- and dicarboxylic acids, respectively, in that species and which are homologues to S. cerevisiae JEN1 gene (Casal et al. 1999). Primary carbon metabolism in K. lactis markedly diVers from that in S. cerevisiae. Like the majority of yeast species, K. lactis belongs to the Crabtree-negative group due to the absence of aerobic production of ethanol. In Crabtree positive species (like S. cerevisiae) the glycolytic Xux is primarily correlated with the external glucose concentration, possessing the capacity to ferment glucose into ethanol even in the presence of oxygen (De Deken 1966). Several hypotheses have been reported to explain the molecular bases for the physiological diVerences between these group of yeasts, which display diVerent mechanisms of catabolic regulation under aerobic and anaerobic conditions (Snoek and Steensma 2006). In this work, the expression and functionality of KlJEN1 and KlJEN2 genes
2.5
C
0.2
0.1
0.0 0.0
0.5
1.0 1.5 2.0 [L-malic acid] (mM)
2.5
succinic or malic acids and in Saccharomyces cerevisiae jen1 cells exponentially grown in glucose medium and transformed with: (Wlled inverted triangle) p416-KlJEN1 (Wlled triangle) p416KlJEN2 and (Wlled circle) p416GPD;
pUG35-KlJEN1
pUG35
A
pUG23-KlJEN2
pUG23
B
Fig. 6 Cellular localization of Kljen1p (a) and Kljen2p (b) in Saccharomyces cerevisiae jen1. The cells were grown overnight in YNB-acetic acid 0.5%, pH 5.0 without methionine and uracil (pUG35) or histidine (pUG23)
123
168
were assessed in K. lactis cells grown in fermentable and non-fermentable carbon sources. In opposition to what is described for ScJEN1 gene that is fully repressed by glucose (Casal et al. 1999), KlJEN1 and KlJEN2 genes are not under glucose repression in the K. lactis strain studied. DiVerent data were described by Lodi et al. (2004), where no expression for KlJEN1 and KlJEN2 was observed in glucose grown cells. In K. lactis, glucose repression has been reported to be far less pronounced than in S. cerevisiae and dependent on the strain studied (Ferrero et al. 1978; Breunig et al. 2000). The sensitivity of K. lactis strains to glucose repression seems to depend on the expression of glucose tansporters and is likely to involve the glucose transport capacity of the cell. K. lactis strains which are able to grow on glucose in the presence of mitochondrial inhibitors, have the so called Rag+ phenotype, due to the presence of a low aYnity glucose permease, Rag1 and are reported to be glucose repressible (GoVrini et al.1989; Milkowski et al. 2001; Weirich et al. 1997; Prior et al. 1993). However, according to our data, these reasons cannot account for the diVerences found, since both K. lactis GG1888 used in this work and the strain JA6 used by Lodi et al. (2004) display Rag+ phenotype (GoVrini et al. 1989). The grounds of the diVerent behavior should be further investigated. Transport assays conWrmed the role of KlJEN1 and KlJEN2 genes as permeases for carboxylic acids as described by Lodi et al. (2004): the mutant kljen1 lost the ability to transport and to grow on monocarboxylic acids, while the mutant kljen2 lost the ability to transport and to grow on dicarboxylic acids; the double mutant, as expected, was not able to utilize and transport any of these substrates. In addition, it was also possible to verify that the mutant K. lactis kljen1 was not impaired in the transport of dicarboxylic acids and that the mutant K. lactis kljen2 did not aVect the transport of monocarboxylic acids indicating that KlJEN1 and KlJEN2 genes exhibited diVerent functions. Probably, a gene duplication from a common ancestor occurred and these genes can be considered paralogues, with diVerent functions as well as distinct regulatory patterns. The level of KlJEN1-mRNA was strongly induced by monocarboxylic acids when compared to glucose grown cells, and it was higher than in dicarboxylic acids; the level of KlJEN2-mRNA was similar in cells grown in media containing both mono and dicarboxylic acids. In cells cultivated in ethanol or glycerol, a strong signal against a KlJEN2 probe was found, contrary to what was observed for KlJEN1 (data not shown). When citrate was present in the medium, the levels of both KlJEN1 and KlJEN2 mRNA were lower than those found in glucose grown
123
Curr Genet (2007) 51:161–169
cells. These results were supported by the absence of a mediated transport system for this substrate in citric acid-induced cells of K. lactis (data not shown). The S. cerevisiae system used and described in this work has already been tested successfully for the expression of heterologous permeases (Soares-Silva et al. 2004). Therefore, to test the functionality of the transporter proteins for mono- and dicarboxylic acids, KlJEN1 and KlJEN2 genes were expressed in S. cerevisiae jen1 strain. This strain recovered the ability to transport monocarboxylic acids, when transformed with KlJEN1 gene and gained a new capacity to transport dicarboxylic acids when transformed with KlJEN2, indicating that both genes are functional transporters in the yeast S. cerevisiae. Once again, these results conWrm that the KlJEN1 gene does not interfere with dicarboxylic acids transport and, on the other hand, KlJEN2 gene does not interfere on monocarboxylic acids transport. To localize the proteins Kljen1p and Kljen2p, KlJEN1 and KlJEN2 genes were fused with GFP and the chimeric proteins were visualized by Xuorescence microscopy. In S. cerevisiae, the fusion proteins were targeted to the plasma membrane, in agreement to their assumed function as permeases. In glucose grown-cells, Xuorescence was detected in the plasma membrane, but in lower amounts (data not shown). However, in these conditions some amount of the chimeric proteins was also detected in the vacuole, probably due to the internalization by endocytosis as it has been reported for ScJen1::GFP (Paiva et al. 2002). All these results evidenced that KlJEN1 gene encodes for a monocarboxylic acids permease, shared by lactic and pyruvic acids, and KlJEN2 gene encodes for a dicarboxylic acids permease, shared by malic and succinic acids, both functional in S. cerevisiae. Acknowledgments This study was supported by the Portuguese grant POCTI/BIO/38106/2001 (Eixo 2, Medida 2.3, QCAIII— FEDER).
References Andrade RP, Casal M (2001) Expression of the lactate permease gene JEN1 from the yeast Saccharomyces cerevisiae. Fungal Genet Biol 32:105–111 Ausubel FA, Brent R, Kingston D, Moore D, Seidman JG, Smith JA, Struhl K (1998) In: Current protocols in molecular biology. Wiley, New York, pp 4.9.1–4.9.11 Breunig KD, Bolotin-Fukuhara M, Bianchi MM, Bourgarel D, Falcone C, Ferrero I, Frontali L, GoVrini P, Krijger JJ, Mazzoni C, Milkowski C, Steensma HY, Wesolowski-Louvel M (2000) Regulation of primary carbon metabolism in Kluyveromyces lactis. Enzyme Microb Technol 26:771– 780
Curr Genet (2007) 51:161–169 Casal M, Cardoso H, Leão C (1996) Mechanisms regulating the transport of acetic acid in Saccharomyces cerevisiae. Microbiology 142:1385–1390 Casal M, Leão C (1995) Utilization of short-chain monocarboxylic acids by the yeast Torulaspora delbrueckii: speciWcity of the transport systems and their regulation. Biochim Biophys Acta 1267:122–130 Casal M, Paiva S, Andrade RP, Gancedo C, Leão C (1999) The lactate-proton symport of Saccharomyces cerevisiae is encoded by JEN1. J Bacteriol 181:2620–2623 Cássio F, Leão C (1993) A comparative study on the transport of L(-)malic acid and other short-chain carboxylic acids in the yeast Candida utilis: evidence for a general organic acid permease. Yeast 9:743–752 Cássio F, Leão C, van Uden N (1987) Transport of lactate and other short-chain monocarboxylates in the yeast Saccharomyces cerevisiae. Appl Environ Microbiol 53:509–513 Côrte-Real M, Leão C (1989) Transport of L-malic acid and other dicarboxylic acids in the yeast Candida sphaerica. Appl Microbiol Biotechnol 31:551–555 Côrte-Real M, Leão C (1990) Transport of malic acid and other dicarboxylic acids in the yeast Hansenula anomala. Appl Environ Microbiol 56:1109–1113 De Deken RH (1966) The Crabtree eVect: a regulatory system in yeast. J Gen Microbiol 44:149–156 Ferrero I, Rossi C, Landini MP, Puglisi PP (1978) Role of the mithocondrial protein synthesis in the catabolite repression of the petite-negative yeast Kluyveromyces lactis. Biochem Biophys Res Commun 80:340–348 Fonseca A, Spencer-Martins I, van Uden N (1991) Transport of lactic acid in Kluyveromyces marxianus: evidence for a monocarboxylate uniport. Yeast 7:775–780 Gerós H, Cássio F, Leão C (2000) Utilization and transport of acetic acid in Dekkera anomala and their implications on the survival of the yeast in acidic environments. J Food Prot 63(1):96–101 GoVrini P, Algeri AA, Donnini C, Wésolowski-Louvel M, Ferrero I (1989) RAG1 and RAG2: nuclear genes involved in the dependence/independence on mitochondrial respiratory function for growth on sugars. Yeast 5(2):99–106 Grobler J, Bauer F, Subden RE, van Vuuren HJJ (1995) The mae1 gene of Schizosaccharomyces pombe encodes a permease for malate and other C4 dicarboxylic acids. Yeast 11:1485–1491 Güldener U, Heck S, Fiedler T, Beinhauer J, Hegemann JH (1996) A new eYcient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res 24:2519–2524 Leão C, van Uden N (1986) Transport of lactate and other short chain monocarboxylates in the yeast Candida utilis. Appl Microbiol Biotechnol 23:389–393 Lodi T, Fontanesi F, Ferrero I, Donnini C (2004) Carboxylic acids permeases in yeast: two genes in Kluyveromyces lactis. Gene 339:111–119 Milkowski C, Krampe S, Weirich J, Hasse V, Boles E, Breunig KD (2001) Feedback regulation of glucose transporter gene transcription in Kluyveromyces lactis by glucose uptake. J Bacteriol 183(18):5223–5229 Mumberg D, Mailer R, Funk M (1995) Yeast vectors for the controlled expression of heterologous proteins in diVerent genetic backgrounds. Gene 156:119–122 Osothsilp C, Subden RE (1986) Malate transport in Schizosaccharomyces pombe. J Bacteriol 168:1439–1443 Paiva S, Devaux F, Barbosa S, Jacq C, Casal M (2004) Ady2p is essencial for the acetate permease activity in the yeast Saccharomyces cerevisiae. Yeast 21(3):201–210 Paiva S, Kruckeberg AL, Casal M (2002) Utilization of green Xuorescent protein as a marker for studying the expression
169 and turnover of the monocarboxylate permease Jen1p of Saccharomyces cerevisiae. Biochem J 363(Pt 3):737–744 Prior C, Mamessier P, Fukuhara H, Chen XJ, Wésolowski-Louvel M (1993) The hexokinase gene is required for transcriptional regulation of the glucose transporter gene RAG1 in Kluyveromyces lactis. Mol Cell Biol 13(7):3882–3889 Queirós O (2002) Transporte e utilização de ácidos dicarboxílicos nas leveduras Kluyveromyces sp. e Saccharomyces cerevisiae: uma abordagem Wsiológica, bioquímica e genética. Ph.D. Thesis, University of Minho Queirós O, Casal M, AlthoV S, Moradas-Ferreira P, Leão C (1998) Isolation and characterization of Kluyveromyces marxianus mutants deWcient in malate transport. Yeast 14:401–407 Queirós O, Paiva S, Moradas-Ferreira P, Casal M (2003) Molecular and physiological characterization of monocarboxylic acids permeases in the yeast Kluyveromyces lactis. Yeast 20:S237 Radler F (1993) Yeasts—metabolism of organic acids. In: Fleet GH (ed) Wine microbiology and biotechnology. Harwood Academic Publishers, Switerzland, pp 165–182 Salmon JM (1987) L-malic acid permeation in resting cells of anaerobically grown Saccharomyces cerevisiae. Biochim Biophys Acta 901:30–34 Sambrook J, Fritisch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, New York Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467 Snoek IS, Steensma HY (2006) Why does Kluyveromyces lactis not grow under anaerobic conditions? Comparison of essential anaerobic genes of Saccharomyces cerevisiae with the Kluyveromyces lactis genome. FEMS Yeast Res 6(3):393–403 Soares-Silva I, Paiva S, Kötter P, Entian K-D, Casal M (2004) Disruption of JEN1 from Candida albicans impairs the transport of lactate. Mol Membr Biol 21:401–411 Soares-Silva I, Schüller D, Andrade RP, Baltazar F, Cássio F, Casal M (2003) Functional expression of the lactate permease Jen1p of Saccharomyces cerevisisiae in Pichia pastoris. Biochem J 376(Pt 3):781–787 Sousa MJ, Miranda L, Côrte-Real M, Leão C (1996) Transport of acetic acid in Zygosaccharomyces bailii: eVects of ethanol and their implications on the resistance of the yeast to acidic environments. Appl Environ Microbiol 62:3152–3157 Sousa MJ, Mota M, Leão C (1992) Transport of malic acid in the yeast Schizosaccharomyces pombe: evidence for a proton-dicarboxylate symport. Yeast 8:1025–1031 Steensma HY (2003) Removal of dominant markers from the Kluyveromyces lactis genome using Cre/loxP system. In: Wolf K (ed) Non-convencional yeasts in genetics biochemistry and biotechnology. Springer, Berlin Heidelberg New York pp 175–178 Thomas BJ, Rothstein R (1989) Elevated recombination rates in transcriptionally active DNA. Cell 56:619–630 Weirich J, GoVrini P, Kuger P, Ferrero I, Breunig KD (1997) InXuence of mutations in hexose-transporter genes on glucose repression in Kluyveromyces lactis. Eur J Biochem 249(1):248–257 Wésolowski-Louvel M, Breunig KD, Fukuhara H (1996) Kluyveromyces lactis. In: Wolf K (ed) Nonconventional yeasts in biotechnology, a handbook. Springer, Berlin Heidelberg New York, pp 139–201 Zmijewski MJJr, MacQuillan AM (1975) Dual eVects of glucose on dicarboxylic acids transport in Kluyveromyces lactis. Can J Microbiol 21:473–480
123
