Feline lentiviruses demonstrate differences in receptor repertoire and envelope structural elements

Virology 342 (2005) 60 – 76 www.elsevier.com/locate/yviro

Feline lentiviruses demonstrate differences in receptor repertoire and envelope structural elements Natalia Smirnova a, Jennifer L. Troyer a, Jennifer Schissler a, Julie Terwee a, Mary Poss b, Sue VandeWoude a,* a

Department of Microbiology, Immunology, and Pathology, Colorado State University, 1619 Campus Delivery, Fort Collins, CO 80523-1619, USA b Division of Biological Sciences, University of Montana, Missoula, MT 59812, USA Received 20 April 2005; returned to author for revision 9 June 2005; accepted 20 July 2005 Available online 24 August 2005

Abstract Feline immunodeficiency virus (FIV) causes fatal disease in domestic cats via T cell depletion-mediated immunodeficiency. Pumas and lions are hosts for apparently apathogenic lentiviruses (PLV, LLV) distinct from FIV. We compared receptor use among these viruses by: (1) evaluating target cell susceptibility; (2) measuring viral replication following exposure to specific and non-specific receptor antagonists; and (3) comparing Env sequence and structural motifs. Most isolates of LLV and PLV productively infected domestic feline T cells, but differed from domestic cat FIV by infecting cells independent of CXCR4, demonstrating equivalent or enhanced replication following heparin exposure, and demonstrating substantial divergence in amino acid sequence and secondary structure in Env receptor binding domains. PLV infection was, however, inhibited by CD134/OX40 antibody. Thus, although PLV and LLV infection interfere with FIV superinfection, we conclude that LLV and PLV utilize novel, more promiscuous mechanisms for cell entry than FIV, underlying divergent tropism and biological properties of these viruses. D 2005 Elsevier Inc. All rights reserved. Keywords: Feline; Lentivirus; Receptor; CXCR4; Envelope

Introduction Feline immunodeficiency virus (FIV), like HIV, infects lymphocytes, results in T cell activation and CD4/CD8 inversion, and ultimately leads to the death of the host due to immunological exhaustion (Ackley et al., 1990). In this respect, FIV is unique in its similarity to the pathogenic primate lentiviruses, as ungulate lentiviruses induce disease conditions that are more typical of a chronic inflammatory reaction (reviewed in Miller et al., 2000; Overbaugh et al., 1997). FIV infection of the domestic cat has been established as an animal model for AIDS, providing valuable insights into maternal – fetal and trans-mucosal transmission, design and testing of anti-retroviral agents,

* Corresponding author. Fax: +1 970 491 0523. E-mail address: [email protected] (S. VandeWoude). 0042-6822/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2005.07.024

pediatric AIDS, vaccine design, and lentiviral pathogenesis (reviewed in Bendinelli et al., 1995; Elder et al., 1998; Willett et al., 1997b). Serologic surveys of 36 non-domestic feline species have revealed a minimum of 20 species with antibodies that cross-react with FIV antigens (Barr et al., 1995; Brown et al., 1993; Carpenter and O’Brien, 1995; Olmsted et al., 1992; Troyer et al., 2005). Genetic characterization of the lentiviruses associated with seroconversion in several of these species has determined that they are distinct from each other, related to domestic cat FIV, and have marked intraand inter-strain genetic heterogeneity (Barr et al., 1997; Biek et al., 2003; Brown et al., 1994; Carpenter et al., 1996; Troyer et al., 2004, 2005). Additionally, sequence comparison of pol sequences from lion and puma lentiviruses (LLV, PLV; also referred to as FIV-Ple and FIV-Pco) demonstrated increased diversity, saturation of synonymous sites, and an increased proportion of substitutions at non-synonymous

N. Smirnova et al. / Virology 342 (2005) 60 – 76

sites when compared to sequences derived from FIVinfected cats (Biek et al., 2003; Brown et al., 1994; Carpenter et al., 1996, 1998; Troyer et al., 2004). These observations suggest that LLV and PLV have been maintained in their host lineages longer than FIV has been in domestic cat populations. The clinical effects of the FIVs indigenous to wild and captive non-domestic cat populations have not been well studied. However, given high seroprevalence rates in the absence of indications of decreased population fitness, it appears likely that these infections are not responsible for high levels of pathology in free-ranging populations (Biek et al., 2003; Brown et al., 1994; Carpenter et al., 1996). Additionally, several strains of PLV and LLV can productively infect domestic cats without resulting in disease, suggesting that viral as well as host factors mediate pathogenicity and disease outcome (VandeWoude et al., 1997a, 2000, 2002, 2003). PLV-1695, an isolate originally obtained from a British Columbia cougar, is infectious for domestic cats both parenterally and oronasally, and mucosal infection was contained in three of four cats in the absence of specific markers of enhanced host immune response. Moreover, this isolate demonstrated a greater propensity to target tissues of the gastrointestinal tract than FIV (Terwee et al., 2005). These observations support the supposition that LLV and PLV are less pathogenic and, at least in a domestic cat model, have significantly different biological properties than FIV. The virus –receptor interaction is the primary event in the process of lentivirus infection, is a critical determinant of cell tropism, and significantly influences the pathogenesis of disease. For example, human immunodeficiency virus targets helper T cells preferentially as these cells express the viral receptor CD4 (Klatzmann et al., 1984; Maddon et al., 1986), and variation at the level of viral receptor specificity underlies the classification of HIV isolates into syncytium-inducing (SI, X4-adapted strains; Feng et al., 1996) and non-syncytium-inducing (NSI, R5 strains; Alkhatib et al., 1996; Choe et al., 1996; Deng et al., 1996; Doranz et al., 1996; Dragic et al., 1996). It is generally thought that R5 tropic strains are the initial infecting subtype, and as a result, gastrointestinal tissues expressing high levels of CCR5 are targeted during initial infection (Apetrei et al., 2004). As disease progresses, X4-adapted strains are increasingly isolated, and at end stage of disease become the primary virus in circulation (Apetrei et al., 2004). Pathogenicity has been linked to X4 and R5 usage in both SIV and SIV-HIV recombinant (S/HIV) systems (Nishimura et al., 2004), and a paucity of CD4+CCR5+ target cells has been correlated with lack of pathogenicity in natural SIV infections of African Green Monkeys (Allan et al., 2004). Receptor tropism has been mapped to the Env region of HIV and SIV, particularly in the V3 loop (Carrillo and Ratner, 1996; Chesebro et al., 1996; Johnston and Power, 2002; Kato et al., 1999; Pohlmann et al., 2004; Speck et al., 1997). Similarly, pathogenicity and cell tropism

61

of FIV have also been linked to env V3 sequence (Hohdatsu et al., 1996; Hosie et al., 2002; Johnston and Power, 2002; Lerner and Elder, 2000; Pedersen et al., 2001; Verschoor et al., 1995). As described above, PLV-1695 localizes in the gastrointestinal tract tissues and draining lymph nodes in cats infected parenterally or mucosally, unlike domestic cat FIV, which is more highly tropic for thymus and bone marrow (Terwee et al., 2005). The chemokine receptor CXCR4 has been shown to act as a co-receptor for FIV, suggesting conservation of receptor usage between the feline and primate lentiviruses (Willett et al., 1997a, 1997c, 1998). However, despite the fact that FIV pathogenicity closely mimics that of HIV, FIV infection has not been demonstrated to involve interaction with CD4 and there are no firm data to support a role for CCR5 in infection of feline cells (Johnston and Power, 1999; Johnston et al., 2001; Lerner and Elder, 2000). However, CD134/OX40, a member of the tumor necrosis factor/nerve growth factor-receptor superfamily, has been identified as a high-affinity receptor for field strains of FIV (de Parseval et al., 2004a; Shimojima et al., 2004); and binding mechanics between FIV Env and CD134 mimic that of HIV Env and CD4 (de Parseval et al., 2005). CD134 is expressed primarily on activated CD4+ T cells, plays a role in CD4+ expansion, and has been implicated in modulating cell adhesion in HTLV-1 infection (Uchiyama, 1997; Weinberg et al., 2004). In contrast to FIVs isolated from cats during the asymptomatic stage of disease, tissue culture-adapted FIVs appear to utilize CXCR4 as a sole receptor, as do FIVs isolated from cats with end stage immunodeficiency disease (Haining et al., 2004). These findings illustrate a virus – receptor interaction that varies with pathogenicity as observed in the primate lentivirus system. For these reasons, we have compared viral – receptor interactions and env sequences between pathogenic domestic cat FIV and the presumably less pathogenic non-domestic feline lentiviruses. Our initial experimental data suggested that FIV and PLV have overlapping receptor repertoires, as viral interference has been observed in vitro and in vivo, and lion and puma lentiviruses were able to infect domestic cat PBMC and cell lines (VandeWoude et al., 1997a, 1997b). The aim of this study was to further characterize receptor use by these apparently less pathogenic, more highly hostadapted viruses. We have investigated the use of CD134, CXCR4, CD4, and CD25 by FIV, PLV, and LLV. We have also evaluated non-specific binding interactions via heparin and cyanovirin-N (CVN-N) interference. The data presented here demonstrate that the non-domestic feline lentiviruses use different receptors and binding modalities than FIV. Comparisons of FIV- and PLV-Env amino acid sequences reveal substantial differences in biochemical properties in the V3 loop, providing a rationale for variation in receptor use and suggesting a plausible mechanism for the observed biological differences noted among the feline lentiviruses.

62

N. Smirnova et al. / Virology 342 (2005) 60 – 76

Results Non-domestic cat lentiviruses replicate in domestic cat cells We used a representative panel of primary feline lymphoid cells, lymphoid cell lines, and adherent cells to assess in vitro growth characteristics of several strains of LLV and PLV. As previously described, several isolates of PLV and LLV are able to grow on domestic cat cells in vitro (Table 1; VandeWoude et al., 2003, 1997a). The feline lymphoid cell lines 3201 and Mya-1 cells were more likely to support growth of non-domestic cat lentiviruses than adherent cell lines. LLV was more difficult to propagate in vitro than PLV, though several isolates were recovered following co-cultivation with Mya-1 cells. PLV-1695 and FIV-C-PG were also able to replicate when grown on pumaderived PBMC stocks, and conversely, FIV-C-PG was replication competent on puma-origin PBMC. Thus, domestic cat cell lines can be used as a substrate for non-domestic cat lentiviral growth, similar to cross-species in vitro cultures of SIV using Asian macaque or human cells (Chakrabarti, 2004; Muller and Barre-Sinoussi, 2003). These results demonstrate that lack of inhibition by specific antagonists observed in our studies is independent of the ability of virus to infect cells primarily. Additionally, PLV could be grown on AH927 cells, which are CXCR4-, CCR5-, and non-permissive for all strains of FIV tested (Willett, B.W., personal communication). CXCR4 antagonists inhibit FIV, but not LLV or PLV, infection AMD3100 is a potent CXCR4 antagonist that blocks infection with CXCR4-dependent strains of HIV and FIV (Brelot et al., 1999; Donzella et al., 1998; Egberink et al., 1999; Willett and Hosie, 1999). We therefore examined the

effect of AMD3100 on infection with LLV and PLV. Twenty-four hour exposure to high concentrations of AMD3100 efficiently and reproducibly inhibited FIV infection in a dose-dependent manner as previously reported (Figs. 1A and 3A, Tables 2 and 3). Figs. 1B and C demonstrate that comparatively, LLV and PLV are not inhibited by AMD3100 in a dose-dependent manner. In order to compare results across all three viruses despite differences in assay technique (ELISA vs. reverse-transcriptase) and wide variation in raw data ranges, viral growth in the presence of inhibitor is presented as a percentage of growth in the presence of no AMD control in Fig. 1D and Figs. 2, 4, 5, and 6. Values from the raw data for these figures, and subsequent statistical comparisons of percent inhibition, are presented in Table 3. Comparisons of time course data between FIV and PLV exposed to lower concentrations of AMD3100 demonstrated that although the duration of FIV growth inhibition persisted for several weeks post-inoculation (Fig. 2A), PLV infection was only inhibited at doses above 0.25 Ag/ml, and then only transiently (Fig. 2B). In order to evaluate the possibility that this transient inhibition was attributable to puma virus adaptation to domestic cat cells, AMD3100 inhibition was tested on puma-derived PBMC alongside Mya-1 cells. As previously noted in Mya-1 cells, FIV-C-PG growth was completely inhibited, and PLV-1695 growth was transiently inhibited at the highest concentration. AMD3100 also blocked FIV infection of puma PBMC; however, in contrast, PLV-1695 growth was not inhibited by AMD3100 in puma cells at any concentration (Fig. 3). Taken collectively, these results reveal that: (1) AMD3100 potently blocks FIV – CXCR4 interactions; dilute concentrations of this drug present for 1 h are capable of significant reduction in viral replication greater than 2 weeks post-exposure; (2) high concentrations of AMD3100 are capable of inducing transient reductions in

Table 1 Growth of cat, lion, and puma lentiviruses in feline cells Host species Domestic cat

Lion

Puma

Isolate ID FIV-PET FIV-GL8 FIV-B 2452 FIV-C PGammer Free-ranging LLV-458 Columbus OH 772005 Free-ranging 1027, 1029 Florida panther PLV-14 British Columbia cougar CoLV British Columbia cougar PLV-1695 2+

Virulence in vivoa (domestic cat)

In vitro tropism Lion PBMC

Cat PBMC

3201b

CrFKc

Mya-1d

+ ++ ++ +++

nd nd nd nd ++

+++ +++ +++ +++ ++

+++

++++

+++ +++ ++ ++ ++ +++ ++ ++

++ ++++

nd

++++ ++++ ++++

+ +++ nd

nd nd

+

+

++

Replication detected by Mg RT assay or FIV-specific p24 capture ELISA. = < 2 background; + = 2 – 5 background, ++ = 5 – 10 background, +++ = 10 – 25 background, ++++ = >25 background, nd = not done. Results based on at least duplicate estimations monitored for 28 days after infection. a In vivo virulence, see (VandeWoude et al., 1997b; VandeWoude et al., Terwee et al., 2005). b 3201—feline lymphosarcoma. c CrFK—Crandell feline kidney. d Mya-1—IL-2-dependent feline T cells.

N. Smirnova et al. / Virology 342 (2005) 60 – 76

63

not, as evidenced by response to the presence to CXCR4 antagonist AMD3100. In order to evaluate the possibility that LLV and PLV attached to CXCR4 in a manner not disrupted by AMD3100, we attempted to block viral entry with antiCXCR4 antibody. In contrast to AMD3100 interference, this agent did not inhibit infection by any of the feline lentiviruses. Others have observed that FIV infection was not inhibited by anti-CXCR4 antibody, a phenomenon attributed to the disparate sites of antibody vs. FIV binding (de Parseval et al., 2004b). SDF1-a, the natural ligand for CXCR4, inhibited FIV growth as expected, albeit to a lesser extent than AMD3100. Others have reported weaker inhibition of FIV growth by SDF1-a than by AMD3100, which may be observed because of cellular CXCR4 upregulation following exposure to its ligand (Hosie et al., 1998). PLV growth was not abrogated in the presence of SDF1-a in multiple trials. LLV was only transiently inhibited by SDF1-a in 2/5 trials, again demonstrating that infection of domestic cat cells by non-domestic FIVs is less sensitive to disruption of CXCR4 binding than the domestic cat virus (Table 2). Blocking CD134 significantly inhibits FIV, transiently inhibits PLV, and does not inhibit LLV in vitro

Fig. 1. High dose AMD3100 inhibits FIV more significantly than LLV- or PLV-growth. (A – C) Triplicate wells containing 3201 T cells were exposed to a range of high concentrations of AMD3100, then inoculated with 10 TCID50 FIV-B-2542, LLV-458, or PLV-1695. Cells were washed at 24 h and reexposed to the same AMD concentrations as on day 0, providing an extended period of inhibitor exposure to maximize inhibition of PLV and LLV. Supernatants were collected bi-weekly for 3 weeks and assayed as described in Materials and methods. FIV growth was inhibited at all concentrations as illustrated in panel A for day 10 post-infection (PI). Replication of LLV and PLV was transiently inhibited (LLV on day 14 and PLV on day 10 PI only), but the trend was not statistically significant (B, C). Because y-axis scale range did not allow single graph comparisons, data were converted to %-noinhibitor control (as described in Materials and methods) in panel D and in Figs. 2, 4, 5, and 6. Bars represent average and standard deviation of triplicate assays. Indicates P < 0.001 (see Table 3).

PLV (and possibly LLV) cellular entry on domestic catderived cells; and (3) FIV infection of puma PBMCderived cells is CXCR4 dependent, while PLV infection is

The recent identification of CD134 as a primary FIV receptor (de Parseval et al., 2004a; Shimojima et al., 2004) led us to investigate whether this molecule also served as a receptor for LLV or PLV cell infection. Several experiments were conducted to determine the cross reactivity of human anti-CD134 with domestic cat CD134. Mean fluorescence intensity (MFI) correlated with antibody concentration over a range of 1 to 20 Ag/ml on Mya-1 cells (Fig. 4A). Approximately 13% of Mya-1 cells were labeled using 5 Ag/ml antibody, whereas less than 5% of cells were labeled when the concentration was decreased to 2 Ag/ml (data not shown). Because of a generalized suppression of cell growth following addition of antibody (which precluded analysis in concentrations greater than 5 Ag/ml), isotype matched irrelevant antibody (rather than no antibody) was used in similar dilutions as non-specific immunoglobulin control. Growth of FIV-C-PG was consistently and significantly inhibited on Mya-1 cells by anti-CD134 at a concentration of 5 Ag/ml compared to irrelevant isotype control antibody ( P < 0.001), but was not inhibited at 2 Ag/ml (Fig. 4B, Table 3). PLV-1695 was also significantly inhibited by CD134 antibody at 5 Ag/ml ( P < 0.001, Fig. 4B, Table 3) but not 2 Ag/ml, though percent inhibition was less than for FIV. LLV-458 was not significantly inhibited by 5 Ag/ml of anti-CD134 antibody ( P = 0.058; Fig. 4B). These data are similar to observations of AMD3100 inhibition, i.e. strong support for FIV use of CD134 for cellular entry that cannot be replicated in identical inhibition experiments with PLV or LLV.

64

N. Smirnova et al. / Virology 342 (2005) 60 – 76

Table 2 Summary of inhibition studies

Heparin inhibits FIV, but enhances LLV and PLV infection

Inhibitor

Virus

Cell type

Trials

Result

AMD-3100

FIV-B-2542

3201, Mya

3/3

SDF-1a

LLV-458 PLV-1695 FIV-C-PG PLV-1695 FIV-B-2542

3201, Mya 3201, Mya Puma Puma 3201, FePBMC Mya

2/2 5/5 1/1 5/5 3/3

3/5 2/5

Transient inhibition

5/5

No inhibition

FIV-C-PG

3201, FePBMC Mya, FePBMC 3201, Mya, FePBMC Mya

Dose-dependent inhibition Transient inhibition Transient inhibition Complete inhibition Transient inhibition Dose-dependent inhibition Dose-dependent inhibition No inhibition

1/1

PLV-1695

Mya

1/1

LLV-458

Mya

1/1

FIV-C-PG LLV-458 PLV-1695 FIV-C-PG LLV-458 PLV-1695 PLV-1695 PLV-1695 FIV-C-PG

Mya Mya Mya, 3201 Mya Mya Mya Mya 3201 Mya

1/1 1/1 3/3 1/1 1/1 1/1 2/2 2/2 2/2

PLV-1695 LLV-458

Mya Mya

2/2 1/1

FIV-C-PG

Mya

1/1

LLV-458 PLV

Mya, 3201 Mya, 3201

4/4 3/3

Dose-dependent inhibition Dose-dependent inhibition Marginal inhibition No inhibition No inhibition No inhibition No inhibition No inhibition No inhibition No inhibition No inhibition Dose-dependent inhibition No inhibition Dose-dependent inhibition Dose-dependent inhibition Enhancement Enhancement

FIV-C-PG LLV-458 LLV-458 PLV-1695 Anti-CD134

Anti-CD4

Anti-CD25

Anti-X4 TAK 779 Cyanovirin

Heparin

1/1

Each trial consisted of samples run in triplicate or in sets of five (cyanovirin, anti-CD134, anti-CD25) at each inhibitor concentration. Transient inhibition is defined as dose-dependent inhibition noted only at the earliest timepoint that no-inhibitor control supernatants were RT positive. Enhancement is defined as inhibitor RT values significantly greater than no inhibitor control at multiple timepoints post-inoculation.

Saturation of CD4 and CD25 surface molecules does not inhibit FIV, LLV, or PLV infection Given that blocking of either CXCR4 or CD134 did not fully inhibit the non-domestic lentiviruses, other surface molecules were assayed for a possible role in viral binding. Mya-1 cells are the only cell type found thus far that are permissive for all three feline lentiviruses (FIV, PLV, and LLV). These cells are CD4+CD25+ (data not shown). Therefore, the possible role of these surface molecules in viral entry was determined. Incubation of Mya-1 cells with high, medium, or low concentrations of anti-CD4 and antiCD25 either alone or concurrently failed to inhibit FIV, PLV, and LLV infection (Tables 2 and 3).

In addition to specific receptor binding, non-specific interactions between lentiviral envelope and target cell membranes are involved in HIV, SIV, and FIV infection. For example, heparin binding has been shown to play a role in both HIV- and FIV-cellular entry, purportedly through interactions between basic gp120 (gp95) with anionic cellular heparin sulfates (de Parseval and Elder, 2001; Ibrahim et al., 1999; Roderiquez et al., 1995; Tanabe-Tochikura et al., 1992). To better define non-specific interactions that might assist infection with LLV and PLV, we infected cells in the presence of heparin. FIV-C-PG infection was inhibited in a dose-dependent manner ( P < 0.05) by heparin as previously reported for FIV-34TF10 and FIV-Pet (de Parseval and Elder, 2001). In striking contrast, LLV and PLV infection was not inhibited, and in fact, viral growth in the face of heparin exceeded no-heparin controls in 4 of 4 (LLV) or 3 of 3 (PLV) trials (Fig. 5, Tables 2 and 3), suggesting substantial differences in non-specific binding interactions between domestic and non-domestic FIVs. High mannose glycosylation contributes to FIV and LLV, but not PLV, Env –receptor interactions CVN-N, an antibiotic which blocks high-mannose glycosylation sites on viral Env, interferes with both HIV and FIV receptor binding and subsequent infection in a nonspecific manner (Barrientos et al., 2003; Bolmstedt et al., 2001; Dey et al., 2000; Mori and Boyd, 2001; O’Keefe et al., 2000, 2003), and has recently been shown to interfere with vaginal and rectal transmission of SIV (Tsai et al., 2003, 2004). This activity is based upon binding of the molecule to envelope glycoproteins (specifically highmannose oligosaccharides) which interferes with Env – receptor binding and fusion. Fig. 6 demonstrates the ability of CVN-N to inhibit infection of LLV on Mya-1 cells, though results were not strictly dose dependent. FIV and PLV infection was only inhibited at one dose and timepoint (Fig. 6, Table 3). However, growth of all three viruses was blunted in the presence of any concentration of CVN-N. These results demonstrate that CVN-N stringency and efficiency of in vitro FIV-, LLV-, or PLV-growth inhibition are highly variable compared to the specific receptor antagonists AMD3100 and anti-CD134. FIV Env sequence and biochemical properties differ substantially from non-domestic cat lentiviral Env Given that Env has been shown to be the principal lentiviral receptor-binding domain, we compared Env among 2 PLV strains (PLV-1695 and PLV-14), and 2 FIV strains (Petaluma and C-PG). Addition of lentiviral-Env sequence obtained from a Pallas’ cat FIV-like virus (Otocolobus manul, FIV-Oma) assisted in bridging alignments of highly divergent regions of FIV- and PLV-Env.

N. Smirnova et al. / Virology 342 (2005) 60 – 76

65

Table 3 Statistical analysis of inhibition studies represented in figures Virus

AMD (Ag/ml)

Viral growth

FIV

0 0.3 1.25 5 0 0.3 1.25 5 0 0.3 1.25 5

0.781 T 0.084 0.098 T 0.006 0.076 T 0.008 0.034 T 0.004 13,061 T 4626 7533 T 3377 9215 T 3261 8901 T 4135 1138 T 1044 435 T 296 362 T 195 310 T 36

PLV

LLV

Virus

Antibody

Ag/ml

FIV

Control Anti-CD134 Control Anti-CD134 Control Anti-CD134 Control Anti-CD134 Control Anti-CD134 Control Anti-CD134

2

PLV

LLV

5 2 5 2 5

Viral growth 1.48 T 1.20 T 1.17 T 0.34 T 335 T 352 T 394 T 218 T 677 T 698 T 567 T 403 T

0.41 0.27 0.11 0.17 82 51 66 40 325 263 120 113

Dose vs. control 2-tailed Student’s t

Sequential dose 2-tailed Student’s t

P < 0.001 P < 0.001 P < 0.001

P < 0.05 P < 0.01

nsd nsd nsd

nsd nsd

nsd nsd nsd

nsd nsd

Dose vs. control 2-tailed Student’s t

Sequential dose 2-tailed Student’s t

nsd P < 0.001

P < 0.001

nsd P < 0.01

P < 0.05

nsd nsd

nsd

Dose vs. control 2-tailed Student’s t

Sequential dose 2-tailed Student’s t

nsd

nsd

nsd

nsd

nsd

nsd

Dose vs. control 2-tailed Student’s t

Sequential dose 2-tailed Student’s t

P < 0.05* P < 0.05* nsd

nsd nsd

nsd nsd

nsd nsd

P < 0.10*

Virus

Treatment

Viral growth

FIV

Control Anti-CD4+anti-CD25 Control Anti-CD4+anti-CD25 Control Anti-CD4+anti-CD25

1.845 1.900 816 1013 768 585

Virus

Heparin (Ag/ml)

Viral growth

FIV

0 2.5 5 20 0 2.5 5 20 0 2.5 5 20

0.374 T 0.260 0.165 T 0.159 0.029 T 0.018 0.022 T 0.055 511 T 550 Not done 1020 T 1150 646 T 809 331 T 52 773 T 491 508 T 227 508 T 105

P < 0.05*

nsd nsd nsd

Virus

CV-N (Ag/ml)

Viral growth

Dose vs. control 2-tailed Student’s t

Sequential dose 2-tailed Student’s t

FIV

0 1 10 0 1 10 0 1 10

nsd P < 0.001

nsd P < 0.01

P < 0.05 nsd

nsd nsd

nsd P < 0.05

nsd nsd

PLV LLV

PLV

LLV

PLV

LLV

T T T T T T

0.055 0.133 152 418 118 184

2.19 T 0.25 1.72 T 0.70 0.38 T 0.39 1683 T 304 776 T 599 1316 T 772 1473 T 444 1226 T 684 497 T 601

Statistical comparisons are made using 2-tailed two-sample homoscedastic Student’s t test except where indicated. Values for FIV represent OD450nm ELISA absorbance values. Values for PLV and LLV represent cpm (counts per minute) in reverse-transcriptase assays. * Indicates 1-tailed two-sample homoscedastic Student’s t test.

66

N. Smirnova et al. / Virology 342 (2005) 60 – 76

positive charge noted in this region among domestic cat FIVs (+8 to +12). Three to 6 additional N-glycosylation sites were predicted in non-domestic lentiviruses in comparison with FIV, and 5 –6 fewer cysteine residues were present in PLV vs. FIV. A similar trend was noted in V3, the region implicated as receptor binding domain for FIV (Hohdatsu et al., 1996; Sodora et al., 1994; Verschoor et al., 1995; Willett and Hosie, 1999). In contrast, the more conserved regions flanking V3 – V5 were more positively charged in non-domestic lentiviruses than FIV, and contained similar numbers of cysteine residues and putative N-glycosylation sites (Fig. 7, Table 4). Such differences indicate that substantial divergence occurs in secondary and tertiary structures at the receptor-binding region of PLV- vs. FIV-Env, providing an explanation for the differential susceptibilities to receptor inhibitors, and supporting the hypothesis that PLV uses a different receptor to gain cellular entry than FIV.

Fig. 2. Low dose AMD3100 inhibits FIV-, but only transiently inhibits PLV-growth. Triplicate wells containing 3201 T cells were exposed to a range of mid-to-low range concentrations of AMD3100, then inoculated with 10 TCID50 FIV-B-2542 (A) and PLV-1695 (B). Cells were washed at 1 h and fed with AMD-free media. Supernatants were collected and processed as described in Materials and methods. As previously described, FIV was inhibited in a dose-dependent manner at all concentrations over a 2 week growth period (A). PLV replication was initially inhibited in an approximately does-dependent manner (days 8 – 10 PI, B) but the trend did not persist after day 15 PI (growth exceeds no AMD control, B). Bars represent the average % inhibition of triplicate assays. *Indicates P < 0.05 (see Table 3).

Sequences were aligned to compare structural regions, particularly those known to be important for receptor binding. Domestic cat FIV Env differed from non-domestic cat lentiviruses at approximately 77% of the amino acid sites. However, the sequence divergence was not uniform in that regions of relative homology (30 – 50%) were interrupted by long tracts of unalignable sequence (¨12% homology). Despite substantial sequence disparity, three hydrophobic regions were conserved in similar positions across all feline lentiviruses, allowing more probable alignments within the non-homologous regions (Fig. 7). The V3 – V5 region of PLV shared least homology with FIV Env (corresponding to aa 365 to 627 in the env alignment and defined in Pancino et al., 1993). In FIV, this region has been shown to contain the CXCR4 binding site (Willett et al., 1997a), neutralizing antibody binding sites (Lombardi et al., 1994, 1995; Tozzini et al., 1993) and several epitopes important for cell tropism and cell line adaptation (Hohdatsu et al., 1996; Vahlenkamp et al., 1997; Verschoor et al., 1995). Within the V3 – V5 region, several biochemical differences are notable that suggest corresponding differences in secondary structure and function (Table 4). Total charge was negative in all three non-domestic lentivirus isolates ( 1 to 4); this differs substantially from the highly

Discussion The data presented here strongly support the conclusion that lion and puma lentiviruses have different mechanisms

Fig. 3. AMD 3100 inhibits FIV-, but not PLV-, growth in domestic cat cells and puma-derived cells. Mya-1 (domestic cat) cells or puma PBMC-derived cells (2  105) were exposed to AMD 3100 at concentrations 5 Ag/ml, 1.25 Ag/ml, and 0.3 Ag/ml, then inoculated with 10 TCID50 FIV-C-PG (A) and PLV-1695 (B). Experiments were performed in quintiplicate. Cells were incubated overnight (18 h), washed, and re-exposed to the same concentrations of AMD 3100 as on day 0. Supernatants were collected bi-weekly and subjected to reverse transcriptase assay. RT values shown are from day 10 (Mya-1 cell) or day 14 (puma cells) PI. (A) FIV growth was significantly inhibited at all concentrations in both cell types. (B) PLV growth was slightly inhibited at the highest AMD dose in Mya-1 cells, and not for any AMD concentrations on puma cells. Indicates P < 0.01; *indicates P < 0.05 (see Table 3).

N. Smirnova et al. / Virology 342 (2005) 60 – 76

67

Fig. 5. Heparin inhibits FIV- but enhances LLV- and PLV-growth. Naı¨ve Mya-1 cells were incubated with decreasing dilutions of heparin for 1 h. FIV-C-PG, LLV-458, and PLV-1695 supernatant stocks were then plated on Mya-1 cells and processed as described in Materials and methods. Data are shown for day 7 PI for LLV and FIV, day 14 PI for PLV. Bars represent average of % inhibition in three assays. Whereas FIV replication was inhibited in a dose-dependent manner, LLV and PLV replication was enhanced by 100% or more at nearly all heparin concentrations over multiple timepoints. nd = not done. *Indicates P < 0.05 with 1-tailed t test, #indicates P < 0.10 (see Table 3). Fig. 4. Anti-CD134 inhibits FIV- and PLV- but not LLV-growth. (A) Mya-1 cells were incubated with dilutions of anti-human CD134 (OX40, Ancell Corporation: clone Ber Act 35) or Isotype control (Mouse IgG1, Ancell Corporation: clone MOPC 31C) for 30 min at 4 -C, washed, and stained using Anti-Mouse IgG FITC, and subjected to flow cytometry as described in Materials and methods. Mean fluorescence intensity decreased with antiCD134 concentration. Twelve – fifteen percent of Mya-1 cells were labeled at 5 Ag/ml compared to 0.5 in the Gonnet PAM250 matrix; Yang, 1997) are in medium grey, and those with weakly conserved amino acid changes across taxa (25% identity across all feline lentiviruses are considered highly conserved, and are indicated by white boxes above the amino acid sequence rows and labeled C1 – C6. Variable regions (V1 – V9) are defined based on the domestic cat FIV sequences (light green, entire variable region; dark green, V3 binding region). Epitope binding sites are indicated by orange boxes above amino acid sequence rows; stronger binding sites are darker orange. Other structural features defined in FIV (fusion peptide, leucine zipper, principle immunodominant domain (PID), alpha-helix, Trp-rich motif, transmembrane region) have also been indicated in white boxes. Light grey numbers highlight the highly divergent V3 – V5 region (residues 365 – 627), where non-domestic feline lentiviruses have lower charge, fewer cysteines, and more predicted glycosylation sites than the FIVs.

N. Smirnova et al. / Virology 342 (2005) 60 – 76

69

70

N. Smirnova et al. / Virology 342 (2005) 60 – 76

Table 4 Comparison of Env amino acid sequence properties V3 binding

V3

376 – 416

FIVA-PET FIVC-PG OMA PLV-14 PLV-1695

V3 – V5

354 – 419

FPC2

354 – 567

T

N

C

T

N

C

6 5 3 3 4

0 0 0 0 0

2 2 1 1 1

7 5 5 4 4

1 1 4 4 5

3 3 1 1 1

T 12 8 2 4 1

V5-FPC3

283 – 331

N

C

8 10 14 14 13

14 13 8 8 8

T 2 1 1 1 1

FPC3

568 – 658

659 – 687

N

C

T

N

C

T

N

C

1 1 2 1 1

3 3 3 3 3

0 0 8 9 5

0 0 0 0 0

0 0 0 0 0

1 1 6 4 3

0 0 0 0 0

0 0 0 0 0

FIVA-Pet = FIV Petaluma strain (Olmsted et al., 1989); FIV-C-PG = FIVC-Paddy-Gammer strain (de Rozieres et al., 2004); OMA = Pallas’ cat (O. manul; Barr et al., 1997) FIV sequence; PLV-14 = Florida Panther FIV sequence (Langley et al., 1994); PLV-1695 = British Columbia cougar FIV sequence (see text). Amino acid residues corresponding to FIV-Pet sequence are indicated under each column heading; FPC2 = region demonstrating high amino acid sequence homology among all depicted strains, FPC3 = region demonstrating high amino acid sequence homology among all depicted strains; V5-FPC3 = region between amino terminus of V5 loop and beginning of conserved region, representing an area of intermediate homology among depicted strains.

We have previously observed viral interference between PLV and FIV (VandeWoude et al., 2002), and have here noted similar in vitro tropisms, leading us to initially hypothesize that these viruses used similar receptors. The work presented here does not support this hypothesis. Other mechanisms underlying viral interference could include: (a) suppression of superinfection by innate immune mechanisms, similar to observations that HIV-2 prevents superinfection by R5 strains of HIV-1 by inducing h-chemokine production, or by actions of intracellular nucleases (Gaddis et al., 2004; Mariani et al., 2003; Schrofelbauer et al., 2004); (b) selection of PLV laboratory-cultured isolates with altered mechanisms for cell entry relative to primary strains (discussed above); (c) different receptor binding sites on CD134 or CXCR4 for PLV vs. FIV, attributable to variations in puma vs. domestic cat molecules; or (d) disruption of primary PLV viral receptor expression following initial infection with FIV. Viral glycosylation sites and point mutations in Env substantially influence receptor usage among HIV strains (McCaffrey et al., 2004; Nabatov et al., 2004). It is also possible that the biological viral isolates used here contained viral quasi-species with varying receptor affinities due to slight variation in sequence and N-glycosylation, which do not reflect all subtypes of PLV and LLV. Perhaps the most intriguing finding presented here is the marked differences in FIV, PLV, and FIV-Oma Env amino acid sequences and alignments. Alterations in the V3 loop of FIV and HIV have been strongly correlated with changes in host cell susceptibility, receptor affinity, neutralizing antibody binding sites, and pathogenicity (Bjorndal et al., 1997; Carrillo and Ratner, 1996; Chesebro et al., 1996; Nielsen and Yang, 1998; Nishimura et al., 1996; Pohlmann et al., 2004; Siebelink et al., 1995; Speck et al., 1997; Verschoor et al., 1995). Therefore, the high degree of nucleotide and amino acid divergence noted here provides an attractive explanation for differential receptor use by non-domestic cat lentiviruses vs. FIV. It is interesting that FIV-Oma demonstrates an intermediate alignment between FIV and PLV, despite the fact that the

Pallas cat is an Asian cat species vs. the North American dwelling puma. That the V3 – V5 region of PLV more closely aligns with that of the Pallas cat suggests these older and more host-adapted viruses might have evolved convergently to use similar receptor mechanisms which vary from the more recently emerged and virulent domestic cat FIV. Further studies comparing amino acid structure of LLV-Env to PLV and FIV-Oma will allow an opportunity to further study this trend using an Africanorigin FIV. The lack of inhibition of LLV and PLV by agents that reproducibly inhibit FIV or HIV, together with substantial differences noted in predicted Env structure will provide models to relate changes in receptor use and Env structure to lentiviral pathogenicity.

Materials and methods Cells and viruses Heparinized blood samples were obtained from cats in a specific pathogen free breeding colony housed in an AAALAC International accredited animal facility. Peripheral blood mononuclear cells (PBMC) were isolated from heparinized blood by ficoll gradient centrifugation (Quackenbush et al., 1990). Lion and puma naı¨ve PBMC were provided by Dr. Stephen O’Brien as viably frozen field samples; Drs. Don Hunter and Caroline Krumm provided anti-coagulated blood collected from a free-ranging puma. The feline lymphoid cell lines 3201 (Hardy et al., 1980) and Mya-1 (Miyazawa et al., 1990, 1992) were grown under standard conditions (Quackenbush et al., 1990) using commercially obtained media (Invitrogen Life Sciences, Carlsbad, CA). Puma-derived PBMC infection experiments were performed on cells isolated from EDTA anti-coagulated blood using Histopaque (Sigma) and were cultured for 2 months in RPMI-1640 supplemented with Glutamax I, non-essential amino acids, sodium pyruvate, glucose, sodium bicarbonate, l-glucose, antibiotics, concanavalin A at 5 Ag/ml, and recombinant human IL-2 at 100 units/ml.

N. Smirnova et al. / Virology 342 (2005) 60 – 76

Concanavalin A exposure was discontinued after 8 doublings (2 months). Cells used in experiments described had been in culture for approximately 4 months and replicated continuously when grown in IL-2. PLV-1695 (gift of Dr. Ken Langelier) was amplified in feline PBMC or Mya-1 cells as previously described (Terwee et al., 2005; VandeWoude et al., 1997b). LLV458 and PLV-14 supernatants were obtained from Dr. Stephen J. O’Brien, and stocks were amplified in domestic cat PBMC or Mya-1 cells in vitro (VandeWoude et al., 1997a, 1997b). Supernatants were harvested at peak RT activity (Willey et al., 1988). FIV-B-2542 and FIV-C-Paddy Gammer (FIVC-PG) stocks were generated in feline PBMC or Mya-1 cells using standard conditions (Quackenbush et al., 1990). These two field strains of FIV have been shown in previous studies to infect cats mucosally and transplacentally and cause immunological and clinical decline (Allison and Hoover, 2003; Burkhard et al., 1997; Diehl et al., 1996; Obert and Hoover, 2000; Pedersen et al., 2001; Rogers and Hoover, 1998, 2002). FIV-GL8 and FIV-PET were prepared as previously described (Willett et al., 1997a). Stocks were titrated on the targeted cell type for each assay using standard techniques (Harper, 1993) and used in inhibition experiments at concentrations of 20 –40 TCID50. In vitro tropism studies Supernatants grown in naı¨ve cat, lion, or puma PBMC were co-cultivated on feline PBMC, CrFK, 3201, or Mya1 cells. Cells were plated in 24-well plates in the appropriate media at a concentration of 2  106/ml. Viral stocks were added to constitute 10% total media volume. Twenty-five to 50% of the supernatants were collected and cells re-fed with fresh media bi-weekly for 4 weeks. Supernatants were subjected to microtiter RT assay as previously described (VandeWoude et al., 1997a; Willey et al., 1988). Inhibitors AMD3100 was a gift from Dr. Lou Hegedus (Colorado State University, Fort Collins, CO, Department of Chemistry). Recombinant human SDF-1a was obtained from Peprotech (Rocky Hill, NJ). Mouse monoclonal antibodies were obtained as follows: anti-human CXCR4, catalogue # MAB-172, R&D Systems (Minneapolis, MN); anti-feline CD4 clone 3-4F4, Southern Biotech (Birmingham AL); anti-human CD134 (OX40) clone Ber Act 35; mouse IgG1 (clone MOPC 31C, Ancell Corporation, Bayport, MN); and IgG2a (Unlb Clone HOPC-1 Southern Biotech, Birmingham AL) isotype control. Porcine heparin (sodium salt), Grade I-A was purchased from Sigma Aldrich (St Louis, MO). Cyanovirin-N (CVN, purified recombinant expressed in E. coli) was a gift from Dr. John Elder (The Scripps Research Institute, La Jolla, California, Department

71

of Molecular Biology). Anti-feline CD25 monoclonal antibody was a gift of Dr. Wayne Tompkins (North Carolina State University, Raleigh, NC, Immunology Program). Inhibition assays Inhibition of virus-CXCR4 binding was attempted using the CXCR4 inhibitor AMD3100, monoclonal antibody anti-CXCR4 172, and SDF-1a. Virus was plated in constant concentration against serial dilutions of inhibitor, or in one AMD3100 experiment, virus was titrated against a constant concentration of inhibitor. CD4, CD25 and CD134 inhibition studies were performed with anti-feline CD4 or CD25 monoclonal antibody or anti-human CD134. Serial-dilutions of heparin and CVN were used for nonspecific blocking studies as outlined below. Anti-CD4, anti-CD25, and anti-CD134 binding limits for serial dilutions were determined by flow cytometric analysis as described below. Positive controls consisted of FIV when appropriate (i.e. CXCR4 and CD134 inhibition) or flow cytometric analysis of cells labeled with the concentrations of antibodies used (i.e. CD4, CD25, CD134). Negative controls consisted of virus without inhibitor, cells without virus, or isotype control antibodies (for CD4, CD25, CD134, CXCR4). The standard format for inhibition assays was as follows: (1) target cells (Mya-1, 3201, or PBMC) were plated at 2  105 cells/well in replicates of 3 –5 in lymphocyte or 3201 media; (2) inhibitors were added to 2 final concentration in ranges shown previously to inhibit FIV infection (AMD3100, SDF1a, heparin, CVN; Donzella et al., 1998; Egberink et al., 1999) or in concentrations determined using flow cytometry to evaluate limiting dilution (anti-CD134, anti-CD4, anti-CD25); (3) 20 –40 TCID50 viral supernatant stocks were added to wells in an equal volume to each well, or naı¨ve supernatant was added as negative control; cells were incubated at 37 -C with 5% CO2 for 24 h, then washed and re-fed with media alone. In CVN, CD25, CD4, and CD134 inhibition studies, protocols were modified so that cells were exposed to inhibitor for 1 h at 37 -C followed by addition of virus and a 2-h, 4 -C incubation. Cells were then again incubated at 37 -C for 4 h. We employed this protocol to synchronize viral-cell binding in each culture and eliminate any potential viral binding kinetic differences in the experiments. Cells were then centrifuged at 400  g, washed and re-plated with media; CVN was re-added to cultures in the original exposure concentration. Supernatants were collected bi-weekly starting at day 3 and assayed for virus as described below for most samples; in some cases FIV supernatants were collected daily. Samples were considered positive when OD450 nm readings or RT values exceeded 2.5 media control in at least two samples, and was confirmed at later timepoints during

72

N. Smirnova et al. / Virology 342 (2005) 60 – 76

sampling. Ranges for ELISA and RT assays varied widely between viruses and assays, which precluded multi-viral comparisons on one graph. Therefore, percent inhibition was calculated as [((NRx Neg) (Rx Neg)) / (NRx Neg)] * 100, where NRx = cells with virus and no inhibitor; Neg = cells with no virus; Rx = cells with virus and inhibitor. Percent of no-inhibitor control was calculated as 100% (percent inhibition). Percent inhibition was determined starting at timepoints where positive controls were clearly above background as described until 3 – 4 weeks post-inoculation. Multiple replications were performed for several inhibitors as listed in Table 2 to verify reproducibility of results using multiple viral strains or cell types. Statistics presented in Table 3 were calculated using raw data subjected to two-sample homoscedastic Student’s t test analysis (Microsoft Excel, Microsoft Corporation, Redmond, WA).

tently infected with PLV-1695. Nested PCR were employed to amplify a 4.5 kb fragment that encompasses the 3V coding regions of the PLV genome. Reactions employed ExTaq DNA polymerase (Takara Mirus Bio, Madison WI) according to manufacturer’s protocol. PCR conditions were 3 min at 94 -C, and then 35 cycles of 94 -C for 30 s, 30 s annealing at 54 -C for first round PCR and 52 -C for second rounds, a 70 -C extension for 4 min 30 s, and a final 10 min extension at 70 -C. First round PCR primers were 3PLV11F, 5V GCCGGAACCTACAGACCCCTTAT 3V and 3PLV12R, 5V TTTGTTCTGCCCATTCTCCTATTG 3V and second round primers were 3770F, 5VAGAGAAGAAGATGCTAGATATGATTT 3V and 3PLV14R, 5V ACAGATATCTTTGAAGGGACACAT 3V. PCR products were gel isolated and cloned into pDrive (Qiagen) and used to transform TOP10 cells (Invitrogen Corp, Carlsbad CA). Plasmid DNA was recovered from transformed colonies and sequenced.

Viral detection

Comparison of domestic and non-domestic feline lentiviral Env regions

The presence of FIV in culture supernatants was detected using p24 antigen capture ELISA (Dreitz et al., 1995). Previous studies have demonstrated that PLV and LLV are not detected by this ELISA assay (VandeWoude et al., 1997a). LLV and PLV growth was detected using a reverse transcriptase microtiter assay as described with the exception that 3 Al of RT reaction was spotted on Wallac DEAE nylon microbeta counter filter paper and read with a Wallac microbeta counter (Wallac/Perkin Elmer, Wellesley, MA; Willey et al., 1988). Flow cytometry 2.0  105 Mya-1 cells were plated and centrifuged at 800  g in a 96-well-v-bottom plate (Costar, Corning Inc, Corning NY). Mouse monoclonal anti-human CD134 (1 mg/ml), anti-feline CD4 (0.5 mg/ml), or anti-feline CD25 (cell culture supernatant) described above was diluted in flow buffer at concentrations from 1:50 to 1:1000 (antiCD134) or 1:100 to 1:10000 (anti-CD4, anti-CD25) in a final volume of 0.2 ml with 2  105 cells. Reactions were incubated at 4 -C for 30 min, then washed twice. Cells were incubated with 1:100 dilution of fluorescein isothiocyanate (FITC)-conjugated sheep anti-mouse IgG (Sigma, St Louis, MO), for 30 min. After washing, samples were passed through an EPICS XL-MCL flow cytometer (Beckman Coulter, Miami, FL). Cells stained with isotype control antibodies were used to set analysis gates. Results following acquisition of 10,000 events were analyzed using FlowJo software (Tree Star, Inc., San Carlos, CA). PLV-1695 env sequencing Genomic DNA was extracted with QIAamp DNA blood mini kit (Qiagen, Valencia CA) from Mya-1 cells persis-

env nucleotide sequences for FIV-Petaluma (accession no. M25381; Olmsted et al., 1989), FIV-C36 (accession no. AY600517; de Rozieres et al., 2004), Pallas’ cat lentivirus, FIV-Oma (accession no. U56928; Barr et al., 1997), and PLV-14 (accession no. U03982; Langley et al., 1994) were obtained from GenBank. Predicted amino acid sequences were aligned with those of PLV-1695 (see above) in Clustal X (Thompson et al., 1997) using the PAM 350 protein weight matrix (Yang, 1997) and realigned manually. The predicted secondary structure of these amino acid sequences including N-glycosylation sites (Gupta et al., in preparation; Gupta and Brunak, 2002; Gupta et al., 2002), protein domains (Corpet et al., 1998), disulfide bonds (Rost et al., 2004), hydrophobic regions, and net charge was determined using the PredictProtein server; http:// www.embl-heidelberg.de/predictprotein/, NetNGlyc 1.0 server; http://www.cbs.dtu.dk/services/NetNGlyc/, and Isoelectric Plot; http://www-biol.univ-mrs.fr/d_abim/d_docs/ doc-tab-pk.html.

Acknowledgments We thank Drs. Brian Willett and Margaret Hosie for discussions regarding PLV receptor use, and for manuscript review. Drs. J. Elder, L. Hegedus, W. Tompkins, K. Langelier, D. Hunter, and C. Krumm and S.J. O’Brien generously contributed reagents, cells, and virus stocks, and we thank Dr. E.A. Hoover and the Feline Retrovirus Research Laboratory at CSU for provision of laboratory infrastructure support, and for manuscript review. We thank Jennifer Yactor, Kerry Sondgeroth, and Joy Zartman for technical assistance. This work was supported by Public Health Service grants R29 AI41871 and R01 AI49765 from NIAID, DAIDS, the

N. Smirnova et al. / Virology 342 (2005) 60 – 76

Colorado State University College of Veterinary Medicine and Biomedical Science Research Council, and the MerckMeriel Summer Fellowship Program. References Ackley, C.D., Yamamoto, J.K., Levy, N., Pedersen, N.C., Cooper, M.D., 1990. Immunologic abnormalities in pathogen-free cats experimentally infected with feline immunodeficiency virus. J. Virol. 64 (11), 5652 – 5655. Alkhatib, G., Combadiere, C., Broder, C.C., Feng, Y., Kennedy, P.E., Murphy, P.M., Berger, E.A., 1996. CC CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272 (5270), 1955 – 1958. Allan, J.S., Wilson, B., Potter, J., Hodara, V., Giavedoni, L., White, R., 2004. 22nd Annual Symposium on Nonhuman Primate Models for AIDS, San Antonio, TX. Allison, R.W., Hoover, E.A., 2003. Feline immunodeficiency virus is concentrated in milk early in lactation. AIDS Res. Hum. Retroviruses 19 (3), 245 – 253. Apetrei, C., Robertson, D.L., Marx, P.A., 2004. The history of SIVS and AIDS: epidemiology, phylogeny and biology of isolates from naturally SIV infected non-human primates (NHP) in Africa. Front. Biosci. 9, 225 – 254. Barr, M.C., Zou, L., Holzschu, D.L., Phillips, L., Scott, F.W., Casey, J.W., Avery, R.J., 1995. Isolation of a highly cytopathic lentivirus from a nondomestic cat. J. Virol. 69 (11), 7371 – 7374. Barr, M.C., Zou, L., Long, F., Hoose, W.A., Avery, R.J., 1997. Proviral organization and sequence analysis of feline immunodeficiency virus isolated from a Pallas’ cat. Virology 228 (1), 84 – 91. Barrientos, L.G., O’Keefe, B.R., Bray, M., Sanchez, A., Gronenborn, A.M., Boyd, M.R., 2003. Cyanovirin-N binds to the viral surface glycoprotein, GP1,2 and inhibits infectivity of Ebola virus. Antiviral Res. 58 (1), 47 – 56. Bendinelli, M., Pistello, M., Lombardi, S., Poli, A., Garzelli, C., Matteucci, D., Ceccherini-Nelli, L., Malvaldi, G., Tozzini, F., 1995. Feline immunodeficiency virus: an interesting model for AIDS studies and an important cat pathogen. Clin. Microbiol. Rev. 8 (1), 87 – 112. Bewley, C.A., Otero-Quintero, S., 2001. The potent anti-HIV protein cyanovirin-N contains two novel carbohydrate binding sites that selectively bind to Man (8) D1D3 and Man (9) with nanomolar affinity: implications for binding to the HIV envelope protein gp120. J. Am. Chem. Soc. 123 (17), 3892 – 3902. Biek, R., Rodrigo, A.G., Holley, D., Drummond, A., Anderson Jr., C.R., Ross, H.A., Poss, M., 2003. Epidemiology, genetic diversity, and evolution of endemic feline immunodeficiency virus in a population of wild cougars. J. Virol. 77 (17), 9578 – 9589. Bjorndal, A., Deng, H., Jansson, M., Fiore, J.R., Colognesi, C., Karlsson, A., Albert, J., Scarlatti, G., Littman, D.R., Fenyo, E.M., 1997. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J. Virol. 71 (10), 7478 – 7487. Bolmstedt, A.J., O’Keefe, B.R., Shenoy, S.R., McMahon, J.B., Boyd, M.R., 2001. Cyanovirin-N defines a new class of antiviral agent targeting Nlinked, high-mannose glycans in an oligosaccharide-specific manner. Mol. Pharmacol. 59 (5), 949 – 954. Brelot, A., Heveker, N., Adema, K., Hosie, M.J., Willett, B., Alizon, M., 1999. Effect of mutations in the second extracellular loop of CXCR4 on its utilization by human and feline immunodeficiency viruses. J. Virol. 73 (4), 2576 – 2586. Brown, E.W., Miththapala, S., O’ Brien, S.J., 1993. Prevalence of exposure to feline immunodeficiency virus in exotic Felid species. J. Zoo Wildl. Med. 24 (3), 357 – 364. Brown, E.W., Yuhki, N., Packer, C., O’Brien, S.J., 1994. A lion lentivirus related to feline immunodeficiency virus: epidemiologic and phylogenetic aspects. J. Virol. 68 (9), 5953 – 5968.

73

Burkhard, M.J., Obert, L.A., O’Neil, L.L., Diehl, L.J., Hoover, E.A., 1997. Mucosal transmission of cell-associated and cell-free feline immunodeficiency virus. AIDS Res. Hum. Retroviruses 13 (4), 347 – 355. Caney, S.M., Day, M.J., Gruffydd-Jones, T.J., Helps, C.R., Hirst, T.R., Stokes, C.R., 2002. Expression of chemokine receptors in the feline reproductive tract and large intestine. J. Comp. Pathol. 126 (4), 289 – 302. Carpenter, M.A., O’Brien, S.J., 1995. Coadaptation and immunodeficiency virus: lessons from the Felidae. Curr. Opin. Genet. Dev. 5 (6), 739 – 745. Carpenter, M.A., Brown, E.W., Culver, M., Johnson, W.E., Pecon-Slattery, J., Brousset, D., O’Brien, S.J., 1996. Genetic and phylogenetic divergence of feline immunodeficiency virus in the puma (Puma concolor). J. Virol. 70 (10), 6682 – 6693. Carpenter, M.A., Brown, E.W., MacDonald, D.W., O’Brien, S.J., 1998. Phylogeographic patterns of feline immunodeficiency virus genetic diversity in the domestic cat. Virology 251 (2), 234 – 243. Carrillo, A., Ratner, L., 1996. Human immunodeficiency virus type 1 tropism for T-lymphoid cell lines: role of the V3 loop and C4 envelope determinants. J. Virol. 70 (2), 1301 – 1309. Chakrabarti, L.A., 2004. The paradox of simian immunodeficiency virus infectino in sooty mangebys: active viral replication without disease progression. Front. Biosci. 9, 521 – 539. Chen, Z., Zhou, P., Ho, D.D., Landau, N.R., Marx, P.A., 1997. Genetically divergent strains of simian immunodeficiency virus use CCR5 as a coreceptor for entry. J. Virol. 71 (4), 2705 – 2714. Chesebro, B., Wehrly, K., Nishio, J., Perryman, S., 1996. Mapping of independent V3 envelope determinants of human immunodeficiency virus type 1 macrophage tropism and syncytium formation in lymphocytes. J. Virol. 70 (12), 9055 – 9059. Choe, H., Farzan, M., Sun, Y., Sullivan, N., Rollins, B., Ponath, P.D., Wu, L., Mackay, C.R., LaRosa, G., Newman, W., Gerard, N., Gerard, C., Sodroski, J., 1996. The b-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85 (7), 1135 – 1148. Corpet, F., Gouzy, J., Kahn, D., 1998. The ProDom database of protein domain families. Nucleic Acids Res. 26 (1), 323 – 326. de Parseval, A., Elder, J.H., 2001. Binding of recombinant feline immunodeficiency virus surface glycoprotein to feline cells: role of CXCR4, cell-surface heparans, and an unidentified non-CXCR4 receptor. J. Virol. 75 (10), 4528 – 4539. de Parseval, A., Chatterji, U., Sun, P., Elder, J.H., 2004a. Feline immunodeficiency virus targets activated CD4+ T cells by using CD134 as a binding receptor. Proc. Natl. Acad. Sci. U.S.A. 101 (35), 13044 – 13049. de Parseval, A., Ngo, S., Sun, P., Elder, J.H., 2004b. Factors that increase the effective concentration of CXCR4 dictate feline immunodeficiency virus tropism and kinetics of replication. J. Virol. 78 (17), 9132 – 9143. de Parseval, A., Chatterji, U., Morris, G., Sun, P., Olson, A.J., Elder, J.H., 2005. Structural mapping of CD134 residues critical for interaction with feline immunodeficiency virus. Nat. Struct. Mol. Biol. 12 (1), 60 – 66. de Rozieres, S., Mathiason, C.K., Rolston, M.R., Chatterji, U., Hoover, E.A., Elder, J.H., 2004. Characterization of a highly pathogenic molecular clone of feline immunodeficiency virus clade C. J. Virol. 78 (17), 8971 – 8982. Deng, H.K., Lui, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., Di Marzio, P., Marmon, S., Sutton, R.E., Hill, C.M., Davis, C.B., Peiper, S.C., Schall, T.J., Littman, D.R., Landau, N.R., 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381, 661 – 666. Dey, B., Lerner, D.L., Lusso, P., Boyd, M.R., Elder, J.H., Berger, E.A., 2000. Multiple antiviral activities of cyanovirin-N: blocking of human immunodeficiency virus type 1 gp120 interaction with CD4 and coreceptor and inhibition of diverse enveloped viruses. J. Virol. 74 (10), 4562 – 4569. Diehl, L.J., Mathiason-DuBard, C.K., O’Neil, L.L., Hoover, E.A., 1996. Plasma viral RNA load predicts disease progression in an accelerated feline immunodeficiency virus model. J. Virol. 70, 2503 – 2507.

74

N. Smirnova et al. / Virology 342 (2005) 60 – 76

Donzella, G.A., Schols, D., Lin, S.W., Este, J.A., Nagashima, K.A., Maddon, P.J., Allaway, G.P., Sakmar, T.P., Henson, G., De Clercq, E., Moore, J.P., 1998. AMD3100, a small molecule inhibitor of HIV-1 entry via the CXCR4 co-receptor. Nat. Med. 4 (1), 72 – 77. Doranz, B.J., Rucker, J., Yi, Y., Smyth, R.J., Samson, M., Peiper, S.C., Parmentier, M., Collman, R.B., Doms, R.W., 1996. A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85 (7), 1149 – 1158. Dragic, T., Litwin, V., Allaway, G.P., Martin, S.R., Huang, Y., Nagashima, K.A., Cayanan, C., Maddon, P.J., Koup, R.A., Moore, J.P., Paxton, W.A., 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381 (6584), 667 – 673. Dreitz, M.J., Dow, S.W., Fiscus, S.A., Hoover, E.A., 1995. Developmental of monoclonal antibodies and capture immunoassays for feline immunodeficiency virus. Am. J. Vet. Res. 56, 764 – 768. Egberink, H.F., De Clercq, E., Van Vliet, A.L., Balzarini, J., Bridger, G.J., Henson, G., Horzinek, M.C., Schols, D., 1999. Bicyclams, selective antagonists of the human chemokine receptor CXCR4, potently inhibit feline immunodeficiency virus replication. J. Virol. 73 (8), 6346 – 6352. Elder, J.H., Dean, G.A., Hoover, E.A., Hoxie, J.A., Malim, M.H., Mathes, L., Neil, J.C., North, T.W., Sparger, E., Tompkins, M.B., Tompkins, W.A., Yamamoto, J., Yuhki, N., Pedersen, N.C., Miller, R.H., 1998. Lessons from the cat: feline immunodeficiency virus as a tool to develop intervention strategies against human immunodeficiency virus type 1. AIDS Res. Hum. Retroviruses 14 (9), 797 – 801. Feng, Y., Broder, C.C., Kennedy, P.E., Berger, E.A., 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272 (5263), 872 – 877. Gaddis, N.C., Sheehy, A.M., Ahmad, K.M., Swanson, C.M., Bishop, K.N., Beer, B.E., Marx, P.A., Gao, F., Bibollet-Ruche, F., Hahn, B.H., Malim, M.H., 2004. Further investigation of simian immunodeficiency virus Vif function in human cells. J. Virol. 78 (21), 12041 – 12046. Gupta, R., Brunak, S., 2002. Prediction of glycosylation across the human proteome and the correlation to protein function. Pac. Symp. Biocomput., 310 – 322. Gupta, R., Jensen, L.J., Brunak, S., 2002. Orphan protein function and its relation to glycosylation. Ernst Schering Res. Found Workshop (38), 276 – 294. Gupta, R., Jung, E., Brunak, S., in preparation. Prediction of N-glycosylation Sites in Human Proteins. Haining, H., McMonagle, E.L., Knapp, E., Klein, D., Willett, B.J., Hosie, M.J., 2004. 7th International Feline Retrovirus Research Symposium, Pisa, Italy. Hardy Jr., W.D., McClelland, A.J., Zuckerman, E.E., Snyder Jr., H.W., MacEwen, E.G., Francis, D., Essex, M., 1980. Development of virus non-producer lymphosarcomas in pet cats exposed to FeLv. Nature 288 (5786), 90 – 92. Harper, D.R. (Ed.), 1993. Virology LabFax 1st edR In: Hames, B.D., Rickwood, D. (Eds.), The LabFax Series. Academic Press, London, UK. Hohdatsu, T., Hirabayashi, H., Motokawa, K., Koyama, H., 1996. Comparative study of the cell tropism of feline immunodeficiency virus isolates of subtypes A, B and D classified on the basis of the env gene V3 – V5 sequence. J. Gen. Virol. 77 (Pt. 1), 93 – 100. Hosie, M.J., Broere, N., Hesselgesser, J., Turner, J.D., Hoxie, J.A., Neil, J.C., Willett, B.J., 1998. Modulation of feline immunodeficiency virus infection by stromal cell-derived factor. J. Virol. 72 (3), 2097 – 2104. Hosie, M.J., Willett, B.J., Klein, D., Dunsford, T.H., Cannon, C., Shimojima, M., Neil, J.C., Jarrett, O., 2002. Evolution of replication efficiency following infection with a molecularly cloned feline immunodeficiency virus of low virulence. J. Virol. 76 (12), 6062 – 6072. Ibrahim, J., Griffin, P., Coombe, D.R., Rider, C.C., James, W., 1999. Cellsurface heparan sulfate facilitates human immunodeficiency virus Type 1 entry into some cell lines but not primary lymphocytes. Virus Res. 60 (2), 159 – 169.

Johnston, J., Power, C., 1999. Productive infection of human peripheral blood mononuclear cells by feline immunodeficiency virus: implications for vector development. J. Virol. 73 (3), 2491 – 2498. Johnston, J.B., Power, C., 2002. Feline immunodeficiency virus xenoinfection: the role of chemokine receptors and envelope diversity. J. Virol. 76 (8), 3626 – 3636. Johnston, J.B., Olson, M.E., Rud, E.W., Power, C., 2001. Xenoinfection of nonhuman primates by feline immunodeficiency virus. Curr. Biol. 11 (14), 1109 – 1113. Joshi, A., Vahlenkamp, T.W., Garg, H., Tompkins, W.A., Tompkins, M.B., 2004. Preferential replication of FIV in activated CD4(+)CD25(+)T cells independent of cellular proliferation. Virology 321 (2), 307 – 322. Kato, K., Sato, H., Takebe, Y., 1999. Role of naturally occurring basic amino acid substitutions in the human immunodeficiency virus type 1 subtype E envelope V3 loop on viral coreceptor usage and cell tropism. J. Virol. 73 (7), 5520 – 5526. Klatzmann, D., Champagne, E., Chamaret, S., Gruest, J., Guetard, D., Hercend, T., Gluckman, J.C., Montagnier, L., 1984. T-lymphocyte T4 molecule behaves as the receptor for human retrovirus LAV. Nature 312 (5996), 767 – 768. Langley, R.J., Hirsch, V.M., O’Brien, S.J., Adger-Johnson, D., Goeken, R.M., Olmsted, R.A., 1994. Nucleotide sequence analysis of puma lentivirus (PLV-14): genomic organization and relationship to other lentiviruses. Virology 202 (2), 853 – 864. Lerner, D.L., Elder, J.H., 2000. Expanded host cell tropism and cytopathic properties of feline immunodeficiency virus strain PPR subsequent to passage through interleukin-2-independent T cells. J. Virol. 74 (4), 1854 – 1863. Levy, J.A., 1998. HIV and the Pathogenesis of AIDS, 2nd edR ASM Press, Washington, DC. Linenberger, M.L., Deng, T., 1999. The effects of feline retroviruses on cytokine expression. Vet. Immunol. Immunopathol. 72 (3 – 4), 343 – 368. Liu, H.Y., Soda, Y., Shimizu, N., Haraguchi, Y., Jinno, A., Takeuchi, Y., Hoshino, H., 2000. CD4-dependent and CD4-independent utilization of coreceptors by human immunodeficiency viruses type 2 and simian immunodeficiency viruses. Virology 278 (1), 276 – 288. Lombardi, S., Garzelli, C., Pistello, M., Massi, C., Matteucci, D., Baldinotti, F., Cammarota, G., da Prato, L., Bandecchi, P., Tozzini, F., 1994. A neutralizing antibody-inducing peptide of the V3 domain of feline immunodeficiency virus envelope glycoprotein does not induce protective immunity. J. Virol. 68 (12), 8374 – 8379. Lombardi, S., Massi, C., Tozzini, F., Zaccaro, L., Bazzichi, A., Bandecchi, P., La Rosa, C., Bendinelli, M., Garzelli, C., 1995. Epitope mapping of the V3 domain of feline immunodeficiency virus envelope glycoprotein by monoclonal antibodies. J. Gen. Virol. 76 (Pt. 8), 1893 – 1899. Maddon, P.J., Dalgleish, A.G., McDougal, J.S., Clapham, P.R., Weiss, R.A., Axel, R., 1986. The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain. Cell 47 (3), 333 – 348. Mariani, R., Chen, D., Schrofelbauer, B., Navarro, F., Konig, R., Bollman, B., Munk, C., Nymark-McMahon, H., Landau, N.R., 2003. Speciesspecific exclusion of APOBEC3G from HIV-1 virions by Vif. Cell 114 (1), 21 – 31. Masuoka, K., Toyosaki, T., Tohya, Y., Norimine, J., Kai, C., Mikami, T., 1992. Monoclonal antibodies to feline lymphocyte membranes recognize the leukocyte-common antigen (CD45R). J. Vet. Med. Sci. 54 (5), 865 – 870. McCaffrey, R.A., Saunders, C., Hensel, M., Stamatatos, L., 2004. N-linked glycosylation of the V3 loop and the immunologically silent face of gp120 protects human immunodeficiency virus type 1 SF162 from neutralization by anti-gp120 and anti-gp41 antibodies. J. Virol. 78 (7), 3279 – 3295. Miller, R.J., Cairns, J.S., Bridges, S., Sarver, N., 2000. Human immunodeficiency virus and AIDS: insights from animal lentiviruses. J. Virol. 74 (16), 7187 – 7195. Miyazawa, T., Furuya, T., Itagaki, S., Tohya, Y., Takahashi, E., Mikami, T., 1989. Establishment of a feline T-lymphoblastoid cell line highly

N. Smirnova et al. / Virology 342 (2005) 60 – 76 sensitive for replication of feline immunodeficiency virus. Arch. Virol. 108 (1 – 2), 131 – 135. Miyazawa, T., Kawaguchi, Y., Furuya, T., Itagaki, S., Takahashi, E., Mikami, T., 1990. Continuous production of feline immunodeficiency virus in a feline T-lymphoblastoid cell line (MYA-1 cells). Nippon Juigaku Zasshi 52 (4), 887 – 890. Miyazawa, T., Toyosaki, T., Tomonaga, K., Norimine, J., Ohno, K., Hasegawa, A., Kai, C., Mikami, T., 1992. Further characterization of a feline T-lymphoblastoid cell line (MYA-1 cells) highly sensitive for feline immunodeficiency virus. J. Vet. Med. Sci. 54 (1), 173 – 175. Mori, T., Boyd, M.R., 2001. Cyanovirin-N, a potent human immunodeficiency virus-inactivating protein, blocks both CD4-dependent and CD4independent binding of soluble gp120 (sgp120) to target cells, inhibits sCD4-induced binding of sgp120 to cell-associated CXCR4, and dissociates bound sgp120 from target cells. Antimicrob. Agents Chemother. 45 (3), 664 – 672. Muller, M.C., Barre-Sinoussi, F., 2003. SIVagm: genetic and biological features associated with replication. Front. Biosci. 8, D1170 – D1185. Nabatov, A.A., Pollakis, G., Linnemann, T., Kliphius, A., Chalaby, M.I., Paxton, W.A., 2004. Intrapatient alterations in the human immunodeficiency virus type 1 gp120 V1V2 and V3 regions differentially modulate coreceptor usage, virus inhibition by CC/CXC chemokines, soluble CD4, and the b12 and 2G12 monoclonal antibodies. J. Virol. 78 (1), 524 – 530. Nielsen, R., Yang, Z., 1998. Likelihood models for detecting positively selected amino acid sites and applications to the HIV-1 envelope gene. Genetics 148 (3), 929 – 936. Nishimura, Y., Nakamura, S., Goto, N., Hasegawa, T., Pang, H., Goto, Y., Kato, H., Youn, H.Y., Endo, Y., Mizuno, T., Momoi, Y., Ohno, K., Watari, T., Tsujimoto, H., Hasegawa, A., 1996. Molecular characterization of feline immunodeficiency virus genome obtained directly from organs of a naturally infected cat with marked neurological symptoms and encephalitis. Arch. Virol. 141 (10), 1933 – 1948. Nishimura, Y., Miyazawa, T., Ikeda, Y., Izumiya, Y., Nakamura, K., Cai, J.S., Sato, E., Kohmoto, M., Mikami, T., 1998. Molecular cloning and expression of feline CD3epsilon. Vet. Immunol. Immunopathol. 65 (1), 43 – 50. Nishimura, Y., Igarashi, T., Donau, O.K., Buckler-White, A., Buckler, C., Lafont, B.A., Goeken, R.M., Goldstein, S., Hirsch, V.M., Martin, M.A., 2004. Highly pathogenic SHIVs and SIVs target different CD4+ T cell subsets in rhesus monkeys, explaining their divergent clinical courses. Proc. Natl. Acad. Sci. U.S.A. 101 (33), 12324 – 12329. O’Keefe, B.R., Shenoy, S.R., Xie, D., Zhang, W., Muschik, J.M., Currens, M.J., Chaiken, I., Boyd, M.R., 2000. Analysis of the interaction between the HIV-inactivating protein cyanovirin-N and soluble forms of the envelope glycoproteins gp120 and gp41. Mol. Pharmacol. 58 (5), 982 – 992. O’Keefe, B.R., Smee, D.F., Turpin, J.A., Saucedo, C.J., Gustafson, K.R., Mori, T., Blakeslee, D., Buckheit, R., Boyd, M.R., 2003. Potent anti-influenza activity of cyanovirin-N and interactions with viral hemagglutinin. Antimicrob. Agents Chemother. 47 (8), 2518 – 2525. Obert, L.A., Hoover, E.A., 2000. Feline immunodeficiency virus clade C mucosal transmission and disease courses. AIDS Res. Hum. Retroviruses 16 (7), 677 – 688. Olmsted, R.A., Hirsch, V.M., Purcell, R.H., Johnson, P.R., 1989. Nucleotide sequence analysis of feline immunodeficiency virus: genome organization and relationship to other lentiviruses. Proc. Natl. Acad. Sci. U.S.A. 86 (20), 8088 – 8092. Olmsted, R.A., Langley, R., Roelke, M.E., Goeken, R.M., Adgerjohnson, D., Goff, J.P., Albert, J.P., Packer, C., Laurenson, M.K., Caro, T.M., Scheepers, L., Wildt, D.E., Bush, M., Martenson, J.S., Obrien, S.J., 1992. Worldwide prevalence of lentivirus infection in wild feline species-epidemiologic and phylogenetic aspects. J. Virol. 66 (10), 6008 – 6018. Overbaugh, J., Luciw, P.A., Hoover, E.A., 1997. Models for AIDS pathogenesis: simian immunodeficiency virus, simian-human immuno-

75

deficiency virus and feline immunodeficiency virus infections. Aids 11 (Suppl. A), S47 – S54. Pancino, G., Fossati, I., Chappey, C., Castelot, S., Hurtrel, B., Moraillon, A., Klatzmann, D., Sonigo, P., 1993. Structure and variations of feline immunodeficiency virus envelope glycoproteins. Virology 192 (2), 659 – 662. Pedersen, N.C., Leutenegger, C.M., Woo, J., Higgins, J., 2001. Virulence differences between two field isolates of feline immunodeficiency virus (FIV-APetaluma and FIV-CPGammar) in young adult specific pathogen free cats. Vet. Immunol. Immunopathol. 79 (1 – 2), 53 – 67. Pohlmann, S., Davis, C., Meister, S., Leslie, G.J., Otto, C., Reeves, J.D., Puffer, B.A., Papkalla, A., Krumbiegel, M., Marzi, A., Lorenz, S., Munch, J., Doms, R.W., Kirchhoff, F., 2004. Amino acid 324 in the simian immunodeficiency virus SIVmac V3 loop can confer CD4 independence and modulate the interaction with CCR5 and alternative coreceptors. J. Virol. 78 (7), 3223 – 3232. Quackenbush, S.L., Donahue, P.R., Dean, G.A., Myles, M.H., Ackley, C.D., Cooper, M.D., Mullins, J.I., Hoover, E.A., 1990. Lymphocyte subset alterations and viral determinants of immunodeficiency disease induction by the feline leukemia virus FeLV-FAIDS. J. Virol. 64 (11), 5465 – 5474. Richardson, J., Pancino, G., Merat, R., Leste-Lasserre, T., Moraillon, A., Schneider-Mergener, J., Alizon, M., Sonigo, P., Heveker, N., 1999. Shared usage of the chemokine receptor CXCR4 by primary and laboratory-adapted strains of feline immunodeficiency virus. J. Virol. 73 (5), 3661 – 3671. Roderiquez, G., Oravecz, T., Yanagishita, M., Bou-Habib, D.C., Mostowski, H., Norcross, M.A., 1995. Mediation of human immunodeficiency virus type 1 binding by interaction of cell surface heparan sulfate proteoglycans with the V3 region of envelope gp120-gp41. J. Virol. 69 (4), 2233 – 2239. Rogers, A.B., Hoover, E.A., 1998. Maternal – fetal feline immunodeficiency virus transmission: timing and tissue tropisms. J. Infect. Dis. 178 (4), 960 – 967. Rogers, A.B., Hoover, E.A., 2002. Fetal feline immunodeficiency virus is prevalent and occult. J. Infect. Dis. 186 (7), 895 – 904. Rost, B., Yachdav, G., Liu, J., 2004. The predict protein server. Nucleic Acids Res. 32, W321 – W326 (Web Server issue). Schrofelbauer, B., Chen, D., Landau, N.R., 2004. A single amino acid of APOBEC3G controls its species-specific interaction with virion infectivity factor (Vif). Proc. Natl. Acad. Sci. U.S.A. 101 (11), 3927 – 3932. Shimojima, M., Nishimura, Y., Miyazawa, T., Kato, K., Tohya, Y., Akashi, H., 2003. CD56 expression in feline lymphoid cells. J. Vet. Med. Sci. 65 (7), 769 – 773. Shimojima, M., Miyazawa, T., Ikeda, Y., McMonagle, E.L., Haining, H., Akashi, H., Takeuchi, Y., Hosie, M.J., Willett, B.J., 2004. Use of CD134 as a primary receptor by the feline immunodeficiency virus. Science 303 (5661), 1192 – 1195. Siebelink, K.H., Karlas, J.A., Rimmelzwaan, G.F., Osterhaus, A.D., Bosch, M.L., 1995. A determinant of feline immunodeficiency virus involved in Crandell feline kidney cell tropism. Vet. Immunol. Immunopathol. 46 (1 – 2), 61 – 69. Sodora, D.L., Shpaer, E.G., Kitchell, B.E., Dow, S.W., Hoover, E.A., Mullins, J.I., 1994. Identification of three feline immunodeficiency virus (FIV) env gene subtypes and comparison of the FIV and human immunodeficiency virus type 1 evolutionary patterns. J. Virol. 68 (4), 2230 – 2238. Speck, R.F., Wehrly, K., Platt, E.J., Atchison, R.E., Charo, I.F., Kabat, D., Chesebro, B., Goldsmith, M.A., 1997. Selective employment of chemokine receptors as human immunodeficiency virus type 1 coreceptors determined by individual amino acids within the envelope V3 loop. J. Virol. 71 (9), 7136 – 7139. Tanabe-Tochikura, A., Tochikura, T.S., Blakeslee Jr., J.R., Olsen, R.G., Mathes, L.E., 1992. Anti-human immunodeficiency virus (HIV) agents are also potent and selective inhibitors of feline immunodefi-

76

N. Smirnova et al. / Virology 342 (2005) 60 – 76

ciency virus (FIV)-induced cytopathic effect: development of a new method for screening of anti-FIV substances in vitro. Antivir. Res. 19 (2), 161 – 172. Terwee, J.A., Yactor, J.K., Sondgeroth, K.S., Vandewoude, S., 2005. Puma lentivirus is controlled in domestic cats after mucosal exposure in the absence of conventional indicators of immunity. J. Virol. 79 (5), 2797 – 2806. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25 (24), 4876 – 4882. Tozzini, F., Matteucci, D., Bandecchi, P., Baldinotti, F., Siebelink, K., Osterhaus, A., Bendinelli, M., 1993. Neutralizing antibodies in cats infected with feline immunodeficiency virus. J. Clin. Microbiol. 31 (6), 1626 – 1629. Troyer, J.L., Pecon-Slattery, J., Roelke, M.E., Black, L., Packer, C., O’Brien, S.J., 2004. Patterns of feline immunodeficiency virus multiple infection and genome divergence in a free-ranging population of African lions. J. Virol. 78 (7), 3777 – 3791. Troyer, J.L., Pecon-Slattery, J., Roelke, M.E., Johnson, W.E., VandeWoude, S., Vazquez-Salat, N., Brown, M., Frank, L., Woodroffe, R., Winterbach, C., Winterbach, H., Hemson, G., Bush, M., Alexander, K.A., O’Brien, S.J., 2005. Seroprevalence and genomic divergence of circulating strains of feline immunodeficiency virus (FIV) among felidae and hyaenidae species. J. Virol. (in revision). Tsai, C.C., Emau, P., Jiang, Y., Tian, B., Morton, W.R., Gustafson, K.R., Boyd, M.R., 2003. Cyanovirin-N gel as a topical microbicide prevents rectal transmission of SHIV89.6P in macaques. AIDS Res. Hum. Retroviruses 19 (7), 535 – 541. Tsai, C.C., Emau, P., Jiang, Y., Agy, M.B., Shattock, R.J., Schmidt, A., Morton, W.R., Gustafson, K.R., Boyd, M.R., 2004. Cyanovirin-N inhibits AIDS virus infections in vaginal transmission models. AIDS Res. Hum. Retroviruses 20 (1), 11 – 18. Uchiyama, T., 1997. Human T cell leukemia virus type I (HTLV-I) and human diseases. Annu. Rev. Immunol. 15, 15 – 37. Vahlenkamp, T.W., Verschoor, E.J., Schuurman, N.N., van Vliet, A.L., Horzinek, M.C., Egberink, H.F., de Ronde, A., 1997. A single amino acid substitution in the transmembrane envelope glycoprotein of feline immunodeficiency virus alters cellular tropism. J. Virol. 71 (9), 7132 – 7135. Vahlenkamp, T.W., Tompkins, M.B., Tompkins, W.A., 2004. Feline immunodeficiency virus infection phenotypically and functionally activates immunosuppressive CD4+CD25+ T regulatory cells. J. Immunol. 172 (8), 4752 – 4761. VandeWoude, S., O’Brien, S.J., Hoover, E.A., 1997a. Infectivity of lion and puma lentiviruses for domestic cats. J. Gen. Virol. 78 (Pt. 4), 795 – 800. VandeWoude, S., O’Brien, S.J., Langelier, K., Hardy, W.D., Slattery, J.P., Zuckerman, E.E., Hoover, E.A., 1997b. Growth of lion and puma lentiviruses in domestic cat cells and comparisons with FIV. Virology 233 (1), 185 – 192.

VandeWoude, S., Hageman, C.L., O’Brien, S.J., Hoover, E.A., 2000. Proceedings, 5th Intl. Feline Retrovirus Research Symposium, Cannes, France. VandeWoude, S., Hageman, C.A., O’Brien, S.J., Hoover, E.A., 2002. Nonpathogenic lion and puma lentiviruses impart resistance to superinfection by virulent feline immunodeficiency virus. J. Acquir. Immune Defic. Syndr. 29 (1), 1 – 10. VandeWoude, S., Hageman, C.L., Hoover, E.A., 2003. Domestic cats infected with lion or puma lentivirus develop anti-feline immunodeficiency virus immune responses. J. Acquir. Immune Defic. Syndr. 34 (1), 20 – 31. Verschoor, E.J., Boven, L.A., Blaak, H., van Vliet, A.L., Horzinek, M.C., de Ronde, A., 1995. A single mutation within the V3 envelope neutralization domain of feline immunodeficiency virus determines its tropism for CRFK cells. J. Virol. 69 (8), 4752 – 4757. Vodros, D., Thorstensson, R., Biberfeld, G., Schols, D., De Clercq, E., Fenyo, E.M., 2001. Coreceptor usage of sequential isolates from cynomolgus monkeys experimentally Infected with simian immunodeficiency virus (SIVsm). Virology 291 (1), 12 – 21. Vodros, D., Thorstensson, R., Doms, R.W., Fenyo, E.M., Reeves, J.D., 2003. Evolution of coreceptor use and CD4-independence in envelope clones derived from SIVsm-infected macaques. Virology 316 (1), 17 – 28. Weinberg, A.D., Evans, D.E., Thalhofer, C., Shi, T., Prell, R.A., 2004. The generation of T cell memory: a review describing the molecular and cellular events following OX40 (CD134) engagement. J. Leukocyte Biol. 75 (6), 962 – 972. Willett, B.J., Hosie, M.J., 1999. The role of the chemokine receptor CXCR4 in infection with feline immunodeficiency virus. Mol. Membr. Biol. 16 (1), 67 – 72. Willett, B., Picard, L., Hosie, M., Turner, J., Adema, K., Clapham, P., 1997a. Shared usage of the chemokine receptor CXCR4 by the feline and human immunodeficiency viruses. J. Virol. 71 (9), 6407 – 6415. Willett, B.J., Flynn, J.N., Hosie, M.J., 1997b. FIV infection of the domestic cat: an animal model for AIDS. Immunol. Today 18 (4), 182 – 189. Willett, B.J., Hosie, M.J., Neil, J.C., Turner, J.D., Hoxie, J.A., 1997c. Common mechanism of infection by lentiviruses. Nature 385 (6617), 587. Willett, B.J., Adema, K., Heveker, N., Brelot, A., Picard, L., Alizon, M., Turner, J.D., Hoxie, J.A., Peiper, S., Neil, J.C., Hosie, M.J., 1998. The second extracellular loop of CXCR4 determines its function as a receptor for feline immunodeficiency virus. J. Virol. 72 (8), 6475 – 6481. Willey, D.L., Smith, D.H., Lasky, L.A., Theodore, T.S., Earl, P.L., Moss, B., Capon, D.J., Martin, M.A., 1988. In vitro mutagenesis identifies a region within the envelope gene of the human immunodeficiency virus that is critical for infectivity. J. Virol. 62, 139 – 147. Yang, Z., 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13 (5), 555 – 556.