Expression of an apoplast-directed, T-phylloplanin-GFP fusion gene confers resistance against Peronospora tabacina disease in a susceptible tobacco

Plant Cell Rep DOI 10.1007/s00299-013-1490-6

ORIGINAL PAPER

Expression of an apoplast-directed, T-phylloplanin-GFP fusion gene confers resistance against Peronospora tabacina disease in a susceptible tobacco Antoaneta B. M. Kroumova • Dipak K. Sahoo • Sumita Raha • Michael Goodin • Indu B. Maiti • George J. Wagner

Received: 2 May 2013 / Revised: 18 July 2013 / Accepted: 25 July 2013 ! Springer-Verlag Berlin Heidelberg 2013

Abstract Key message Phylloplanins are plant-derived, antifungal glycoproteins produced by leaf trichomes. Expression of phylloplanin-GFP fusion gene to the apoplast of a blue mold susceptible tobacco resulted in increased resistance to this pathogen. Abstract Tobaccos and certain other plants secrete phylloplanin glycoproteins to aerial surfaces where they appear to provide first-point-of-contact resistance against fungi/ fungi-like pathogens. These proteins can be collected by water washing of aerial plant surfaces, and as shown for tobacco and a sunflower phylloplanins, spraying concentrated washes onto, e.g., turf grass aerial surfaces can provide resistance against various fungi/fungi-like pathogens, in the laboratory. These results suggest that naturalproduct, phylloplanins may be useful as broad-selectivity

Communicated by H. Judelson. A. B. M. Kroumova ! D. K. Sahoo ! I. B. Maiti Kentucky Tobacco Research and Development Center, College of Agriculture, University of Kentucky, Lexington, KY 40546, USA S. Raha Department of Radiation Oncology, Feinberg School of Medicine, Northwestern University, Ward- 13-002,303 East Chicago Ave, Chicago, IL 60611, USA M. Goodin Department of Plant Pathology, University of KY, 201F Plant Science Building, Lexington, KY 40546, USA G. J. Wagner (&) Department of Plant and Soil Science, Kentucky Tobacco Research and Development Center, College of Agriculture, University of Kentucky, Lexington, KY 40546, USA e-mail: [email protected]

fungicides. An obvious question now is can a tobacco phylloplanin gene be introduced into a disease-susceptible plant to confer endogenous resistance. Here we demonstrate that introduction of a tobacco phylloplanin gene—as a fusion with the GFP gene—targeted to the apoplasm can increase resistance to blue mold disease in a susceptible host tobacco. Keywords T-phylloplanin ! Resistance ! Peronospora tabacina ! Apoplastic (apo) ! Cytoplasmic (cyto) ! GFP Introduction The average annual crop loss due to pathogenic fungi and fungi-like organisms is said to be about 20 % worldwide, and 70 % of fungicides are used for agricultural applications (Gisi et al. 2000). There is a need for naturally produced (natural product) fungicides useful against fungi/ fungi-like pathogens to augment or replace chemically synthesized fungicides that are being challenged on environmental sustainability, mammalian toxicity, and acquired-resistance grounds (Brent and Hollomon 2007). Certain plants including most tobaccos secrete proteins called phylloplanins to leaf surfaces where they appear to provide a first-point-of-contact resistance against certain disease causing pathogens (Shepherd et al. 2005, 2007; Kroumova et al. 2007; Shepherd and Wagner 2012). The tobacco phylloplanin (T-phylloplanin) gene and its smalltrichome-specific promoter were isolated (Shepherd et al. 2005) and we demonstrated that RNAi knockdown of T-phylloplanin in a blue mold resistant tobacco type led to sensitivity to this disease (Kroumova et al. 2007). Blue mold disease of tobacco is caused by Peronospora

123

Plant Cell Rep

tabacina (P. tabacina D.B. Adam = syn P. hyoscyami de Bray f.sp. tabacina). We also found that aerial surface washes of tobacco and sunflower that contain phylloplanins, when sprayed onto plants, can prevent or suppress blue mold disease on tobacco, and grey leaf spot (Pyricularia grisea caused) or brown patch (Rhizoctonia solani caused) diseases on important turf grasses (King et al. 2011). The pathogens causing these diseases represent three of the four general classes of fungi/fungi-like organisms (ascomycete, basidiomycete, oomycete). Thus, these phylloplanins may have potential for use as broad-spectrum, topically applied fungicides to augment/replace currently used chemical fungicides. Field studies in 2009, 2010, and 2011 showed the efficacy of tobacco phylloplanin for controlling grey leaf spot, brown patch (King 2011; King et al. in preparation), and also dollar spot (Sclerotinia homeocarpa caused) diseases on turf grasses in the field. Phylloplanins may prove to be valuable as topical fungicides (work continues on this aspect), but endogenous resistance could allow inherent crop protection, without spraying. If crops and other plants (e.g., turf grasses) were made to produce phylloplanins internally (particularly outside cells where many fungal hyphae spread during infection), transformed plants might be made to be inherently more resistant to fungi/fungi-like pathogens. This is the strategy (including a comparison of cell wall targeting versus cytosolic targeting of phylloplanins) that we researched in this project. Numerous studies have shown that overexpression of genes encoding disease resistance biochemicals (e.g., PR proteins, defensin, snaking-1 anti-microbial peptide, polyphenol oxidase protein) or gene products involved in signaling cascades, or systemic acquired resistance in plants can lead to increased resistance to a specific microbial pathogen, broader-growth-stage pathogen resistance, increased abiotic stress resistance, or provide wider-spectrum pathogen resistance (Cao et al. 1998; Tang et al. 1999; Friedrich et al. 2001; He et al. 2001; Li and Steffens 2002; Hong and Hwang 2005; Malnoy et al. 2007; Qiu et al. 2007; Almasia et al. 2008; Portieles et al. 2010). Little evidence of co-suppression was noted in these studies, though in many of these reports overexpressed genes used were obtained from and overexpressed in the same species (e.g., At-into-At, tomato-into-tomato), and in others into a related species (e.g., potato-into-tomato), while in others into an unrelated species (e.g., pepper-into-At). However, in one case, the At-into-At transfer of SNC1 gene resulted in co-suppression of host SNC1, via an miRNAi mechanism (Yi and Richards 2007). Thus, in many published examples describing application of the overexpression strategy within the same species or between related species suggest that expression of genes that are not involved in complex signaling do not elicit gene silencing. Here, we

123

overexpressed a tobacco phylloplanin gene isolated from a blue mold resistant donor tobacco (Nicotiana tabacum T.I. 1068) in a blue mold sensitive host tobacco variety (N. tabacum cv. KY14), but used a phylloplanin-GFP fusion gene. We used plasmolysis to allow microscopic verification of apoplastic versus cytosolic expression of the fusion protein, and we compared observations with results using extracellular fluid analysis. It is noteworthy that GFP (alone and in fusion with an overexpressed gene) has been shown to positively affect transformation efficiency in some systems (El-Shemy et al. 2008). To our knowledge this is the first report describing the assessment of the impact of over expressing a phylloplanin gene on a fungi/ fungi-like disease. We also compared the targeting of T-phylloplanin-GFP to the apoplast (apo) and the cytoplasm (cyto).

Results and discussion Molecular characterization of transgenic tobacco plants expressing the T-phylloplanin-GFP fusion gene Chimeric gene constructs containing the full-length cDNA of the T-phylloplanin gene fused with a GFP(S65T) gene (Fig. 1), with and without a 2S2 apoplast-targeting sequence were introduced into the blue mold sensitive tobacco N. tabacum, cv. KY14 (constructs b and c, Fig. 1, respectively). An additional construct lacking the T-phylloplanin gene (construct a, Fig. 1) was used as a control to test the efficacy of the 2S2 apoplast-targeting sequence, the GFP used, and to determine if these genes might impact disease resistance in the absence of the T-phylloplanin gene. RT-PCR was applied to certain T2 and T3 generation plants showing resistance to blue mold (see below). Results (Fig. 2) showed the presence of the 1,224 bp T-phylloplanin-GFP fusion gene in lines apo4, apo23, apo35 (T2 plants, lanes 4–6) and in lines apo23 and apo35 (T3 plants, lanes 7 and 8). A smaller band of 1,158 bp was observed for cytoplasmic-targeted lines cyto8 and cyto20, lanes 9 and 10, as expected due to the lack of the 2S2 sequence. In the case of the control 2S2-GFP (lane 3) that possessed the 2S2 sequence, but lacked the T-phylloplanin gene, a band of expected size 789 bp was observed. Wild type DNA produced no product, as expected. These results confirm the presence of transcripts of the introduced chimeric genes. To assess expression levels in plants showing disease resistance (see below), qRT-PCR was applied to select T2 plants, using primers to detect the T-phylloplanin gene. Expression of the tobacco tubulin gene was compared to standardize (not shown). Tubulin has been shown to be a useful gene for calibration of qRT-PCR in tobacco (Cortleven et al. 2009). As shown in Fig. 3a transcript is

Plant Cell Rep

Fig. 1 Physical structures of the gene constructs. Components are listed from left to right: LT left border of T-DNA, M24 modified Mirabilis mosaic virus (MMV) full-length transcript promoter, 50 amv translational enhancer, 2S2 apoplast-targeting signal peptide from Arabidopsis thaliana; full-length T-phylloplanin coding sequence, without its own signal peptide; GFP(S65T) reporter gene, Kan R

Neomycin phosphotransferase II gene coding for kanamycin resistance, NosP nopaline synthase promoter, 30 rbcS and 30 Nos terminator sequences of rbcS and nopaline synthase genes, RT right border of TDNA, respectively. Details regarding construct assembly are given in ‘‘Experimental procedure’’ section

Fig. 2 RT-PCR analysis of RNA from lines expressing T-phylloplanin-GFP or GFP genes. PCR products were separated on a 1 % agarose gel and visualized with ethidium bromide. The full-length transcript RT-PCR products of size 1,224 bp (for apo 4, apo23, and apo35 lines), 1,158 bp (for cyto8 and cyto20 lines), or 789 bp (for the 2S2-GFP line) are indicated with arrows. The T2 and T3 generations

of plants examined are underlined. Lane 1: M-DNA size markers (Bathacharyya et al. 2003) in kb is shown on the left; lane 2, controlKY 14 wild type; lane 3, 2S2-GFP; lanes 4 thru 8: apo lines 4, 23, 35 (T2), respectively, apo 23 and 35(T3 plants); lanes 9 and 10, cyto 8 and cyto20 (T2)

present at low (endogenous) levels in control, non-transformed plants or in 2S2-GFP-9. In contrast, apo lines 4, 23, and 35 showed relatively rich message, while apo lines 14 and 21 (observed to show no substantial disease resistance, data not shown) showed lower levels. The cyto lines 8 and 20 showed intermediate levels of message. The levels of GFP found correlated with the levels of T-phylloplanin message (Fig. 3a, b). The exception was the presence of GFP protein in the 2S2-GFP control. This was expected

since the primer used in Fig. 3a experiments signaled T-phylloplanin mRNA. Extracellular fluid and post-extracellular fluid analysis of apo and cyto plants Extracellular fluid (EF) analysis was applied to selected T2 generation plants (those characterized in Fig. 3) to determine if the apoplast-targeting sequence was effective in locating

123

Plant Cell Rep

showed that in apo plants GFP appeared to adhere to membranes of the secretory pathway, while some appeared to occur in the cell wall space. Susceptibility of non-transformed control, 2S2-GFP, apo and cyto plants to blue mold infection

Fig. 3 Relative expression of the T-phylloplanin-GFP fusion gene, and GFP occurrence in 2S2-GFP, apo and cyto lines. a Relative transcript levels (using primers for T-phylloplanin) as determined by qRT-PCR. Expression in the wild-type KY14 (control) was taken as a reference (relative expression = 1). b GFP concentration (lg/g tissue) in extracts of selected lines shown in Fig. 2. Data are expressed as a mean ± standard deviation of 5 observations

the 2S2-GFP and T-phylloplanin-GFP genes to the apoplastic space. As shown in Table 1, minimal GFP signal was observed in control tissue derived EF or PEF (post-extracellular fluid). In many studies using GFP low-level signal is observed with non-transformed tissue that is attributed to auto fluorescence. In the 2S2-GFP control greater GFP concentration was observed in EF than PEF (27.6 versus 13.0), as expected, to give a PEF/EF ratio of 0.5. In apo plants 4, 23, 35, 14, and 21, levels of lg GFP/g leaf in EF were lower (ranged from *12 to 2, but PEF/EF ratios, 0.5–1.4) were similar to that in the 2S2-GFP case. In contrast, cyto plants lacking the 2S2 signal had very low EF GFP and ratios of *40. These results are consistent with the conclusion that in apo plants T-phylloplanin-GFP protein was partially secreted while in cyto plants little fusion protein was secreted. To assess the level of cytoplasmic contamination in the EF due to tissue manipulation, the amount of the strictly cytosolic enzyme NAD-malate dehydrogenase was measured in both PEF and EF, and expressed as a ratio of PEF/EF. Very high PEF/EF ratios were observed, consistent with little error due to the method used for extracellular fluid analysis. As shown below, in situ confocal microscopic evaluation of GFP

123

The susceptibility of plants overexpressing the T-phylloplanin-GFP fusion gene to P. tabacina infection is shown in Table 2. Non-transformed control plants showed an average of 69, 45, 54, and 77 % resistant spots (an average of *61 % of total spots tested) in the T1, T2, T3, and T4 generations, respectively. Clearly the leaf spot assay of this biotrophic pathogen, as used, is complex and one cannot expect 100 % infection in control plants. Results from one assay with a given set of plants, at a given time may vary. However, after many such tests we concluded that plants were worthy of the term ‘resistant’ if they showed 90 % resistant spots (\10 % infected spots). When the 2S2-GFP control was assayed we observed 70 and 59 % resistant spots in the T1 and T2 generations, respectively. The average of these (64 %) is comparable to the non-transformed, control plant average of *61 %. Thus, as expected, the introduction of apoplastic targeted GFP alone (no T-phylloplanin) did not confer blue mold resistance. We assayed several T1 lines of apoplastic targeted T-phylloplanin-GFP plants, and one plant with no infected spots was carried forward to produce the T2 generation. After blue mold susceptibility analysis, we selected lines apo 4, apo23 and apo35 that had numerous individuals with no infected spots as highly resistant. T2 plants of apo23 showed an about 89 % resistance phenotype. Seven of these were carried forward to generate T3 lines which also had a *89 % resistance phenotype. The T4 generation showed about 95 % resistance (though the control value was unusually high in this case). For the apo23 (T2 plus T3) lines, a total of 1,638 spots on 85 different plants were assayed. In the case of apo35, T2, T3, and T4 lines had resistant phenotypes at the levels of 94, 76, and 95 %, respectively. There were two T2 lines of apo35 carried forward, one of which gave 83 % resistance, while the other gave 69 % (see footnote e Table 2) leading to the high average of 76 %. A plant with complete resistance was carried forward to give a T4 generation that showed 95 % resistance. For the apo35 line, a total of 880 spots on 50 different plants were assayed. For T0 line apo4, T2, T3, and T4 lines had 96, 98, and 93 % resistance. For this line a total of 304 spots on 19 different plants were assayed. Results with cytoplasmic-targeted T-phylloplanin-GFP (cyto-8) indicated that default targeting did not provide at least easily recognized resistance. Both T1 and T2 generations had control level resistant percentages (22 and 53 % resistance). These results may or may not be due to the

Plant Cell Rep Table 1 Extracellular fluid analysis to assess the distribution of T-phylloplanin-GFP product (as GFP) in cytoplasmic versus apoplastic compartments Lines

Generation

GFP concentration (ug/g tissue) EF

Control

PEF/EF

PEF

NAD-MDH activity (Units/g tissue) EF

PEF

PEF/EF

0.007 ± 0.0

0.31 ± 0.0

0.036 ± 0.0

23.05 ± 2.2

640

2S2-GFP-9

T2

27.58 ± 2.3

13.03 ± 1.2

0.4

0.071 ± 0.0

32.4 ± 3.3

456

apo 4 apo 23

T2 T2

12.39 ± 1.2 10.92 ± 0.8

16.76 ± 1.3 6.12 ± 0.5

1.4 0.6

0.054 ± 0.0 0.039 ± 0.0

23.22 ± 2.2 24.85 ± 2.3

430 637

apo 35

T2

8.38 ± 0.9

4.47 ± 0.5

0.5

0.085 ± 0.0

25.48 ± 2.5

300

apo 14

T2

1.85 ± 0.2

2.17 ± 0.3

1.2

0.059 ± 0.0

32.49 ± 3.2

551

apo 21

T2

1.91 ± 0.3

1.62 ± 0.1

0.9

0.074 ± 0.0

21.98 ± 2.2

297

cyto 8

T2

0.17 ± 0.0

7.36 ± 0.8

42.8

0.025 ± 0.0

20.95 ± 2.2

838

cyto 20

T2

0.11 ± 0.01

5.14 ± 0.5

45.5

0.031 ± 0.0

26.83 ± 2.4

865

Leaves of selected lines characterized in Figs. 1 and 2 were examined to determine fusion protein distribution (as GFP) between extracellular fluid (EF) and post-extracellular fluid (PEF). Distribution of the soluble cytosolic marker NAD-Malate dehydrogenase was determined in parallel. Data are expressed as mean ± SD of 5 observations

Table 2 Disease susceptibility of plants expressing the T-phylloplanin-GFP gene in the blue mold leaf drop inoculation assay To % resistanceb

T1a

T2a

T3a

Control KY14

69 (172, 11)

54 (720, 43)

77.1 (432, 27)

2S2-GFP

70 (120, 7)

1c

59 (64, 4)

1c

–

–

apo 23

100 (32, 2)

1c

89.4 (320, 17)

7c

89.2 (1318, 68)d

apo 35

100 (32, 2)

c

1

93.8 (96, 6)

2

apo 4

87.5 (24, 2)

1c

95.9 (48, 3)

1c

cyto 8

22 (159, 10)

cyto 20 cyto 1

87.5 (32, 2) 81 (16, 1)

45 (224, 13)

T4a

c

1

c

76 (592, 34)

e

97.9 (96, 6)

1c

95.2 (336, 21)

1c

94.9 (592, 37)

1c

93.1 (160, 10)

53 (128, 8)

–

–

– –

– –

– –

a

Regarding segregation (measured as Kanr/Kans), T1 and T2 generation plants were primarily heterozygous, while in T3 and T4 all lines were homozygous

b

% resistance, e.g., Control KY14 69 (171, 11) is 69 % resistant spots (172 total spots, 11 separate plants)

c

Number of individual lines carried forward to next selfed generation. Plants showing 100 % resistance (no infected spots) were carried from T1 to T2, from T2 to T3, and from T3 to T4

d

Variation in these T3 lines was 94.3–14.8 %

e

Variation in these T3 lines was 83 and 69 %

lower levels of expression observed in cyto8 and cyto20 plants versus apo plants (see Fig. 3a, b). While line cyto8 was not continued beyond the T2 generation, the lack of apparently resistant T1 plants and the high average percentage of infected spots observed led us to focus attention on the success observed with apoplastic targeted T-phylloplanin-GFP transgenic plants. Also, additional T1 lines cyto20 and cyto1 did not show promising resistance levels. The Student’s t test was applied to % infection data obtained for T2, T3, and T4 generation apo lines to assess statistical significance of differences between % resistance in control versus transgenic plants. Since % resistance data of Table 2 represent data totals for a particular generation of a particular line that were derived from several different

leaf drop assays made with different batches of plants (usually 3–5 batches) on different dates (usually over several weeks) we analyzed variation between separate assays. The p values obtained for T2, T3, and T4 plants of apo23, apo35 and apo4 were all \0.05. We conclude that there may be advantage to targeting T-phylloplanin-GFP to the apoplasm, but further study is needed to determine the potential of cytoplasmic targeting, if default targeted fusion protein may be turned over, or if other factors present in field grown plants may be important in optimizing expression to optimize resistance. But, it is logical that a normally surface secreted and accumulated antibiotic factor would be more effective outside of the cytoplasm. Clearly a next step is to test promising apo lines

123

Plant Cell Rep

Fig. 4 Confocal images of tobacco leaf epidermal cells expressing GFP or T-phylloplanin-GFP in the apoplasm and cytoplasm. Figures are merged images taken to image red fluorescence of chloroplasts and imaging of GFP. a and b Leaf epidermal cells of the model, high GFP expressing N. tabacum cv. Samsun [expressing construct: M2450 amv-GFP(S64T)], and c and d N. tabacum cv. KY14 leaf epidermal cells expressing M2450 amv-2S2-T-phylloplanin-GFP (apo35). a GFP fluorescence of the nucleoplasm (NP), within cytosol within transvacuolar strands (TVS), and in the layer of cytoplasm (at the periphery of the cells). b Dark intercellular spaces (IS) are seen, chloroplasts (red) are imbedded in the cytoplasmic layer. c Apoplastic

GFP fluorescence is detected in the cytoplasmic layer at the periphery of guard cells (GC) and GMC. GFP is not apparent throughout the nucleoplasm or prominent in transvacuolar strands, but is clearly associated with the nuclear membrane (NM) as expected for a secreting protein product, or a secreted product that did not exit the secretory system. d The magnified view of epidermal cells in apo35 leaf epidermis shown in 4c clearly shows the punctate nature of plasmalemma fluorescence (P) that is often speculated to represent the association of GFP with plasmodesmata, or aggregates with plasmalemma proteins. Scale bars are shown for each panel

in the field. As a final point, we do not know if there would be advantage or disadvantage to expressing T-phylloplanin alone (not as a fusion protein) to confer blue mold resistance. Further work is needed to test this question.

(see Fig. 3; Table 1) to allow meaningful microscopic examination. However, Fig. 4a, b was obtained using a similar construct containing the M24 promoter, the 50 amv enhancer, the GFP(565T) gene and the same selectable marker sequences as in the cyto construct, but in the tobacco species N. tabacum cv.Samsun NN (Maiti, unpublished) that provided high fluorescence yield. As shown in Fig. 4a, cytoplasmic-targeted GFP was located throughout periphery of the protoplasm of leaf epidermal cells, within transvacuolar strands (TVS), and throughout the nucleoplasm (NP), as expected for default (cytoplasmic) targeted expression using the M24 promoter. Intracellular spaces (IS) in view appear to lack GFP fluorescence. The more highly magnified view in Fig. 4b shows more clearly that intracellular spaces (IS) do not

Confocal microscopy The subcellular location of T-phylloplanin-GFP fusion protein (observed as GFP fluorescence) was monitored in non-plasmolyzed leaf epidermal tissue, and observations were compared with results of extracellular fluid analysis. The tissues represented in Fig. 4a, b were not from plants expressing the cyto construct shown in Fig. 1 (i.e., those used for data presented elsewhere in this paper). Fluorescence yield of the cyto constructs (T1 plants) was too low

123

Plant Cell Rep

Fig. 5 Confocal images of leaf trichomes expressing T-phylloplaninGFP in the cytoplasm and apoplasm, after plasmolysis. a and b Leaf trichome of a cyto8 plant expressing T-phylloplanin-GFP that was incubated with 10 % sucrose. a Bright field image. The greatly plasmolyzed protoplasm (Pp) is indicated in the stalk cell adjacent to the gland cell (G). b GFP imaging of the same trichome as in a shows weak fluorescence of membranes of the plasmolyzed protoplasm (Pp) of this stalk cell and an apparent lack of staining in its cell wall area. Green auto fluorescence of guard cell chloroplasts is evident. c and d Leaf trichome of an apo35 plant that was incubated with 10 % sucrose. c Bright field image. The nucleus (N) and plasmolyzed protoplasm (Pp) are apparent and the protoplasm is seen to fill about half the cell volume. d GFP fluorescence in the same stalk cell. The

nuclear membrane (NM) but not the nucleoplasm shows GFP fluorescence, as expected for a secreting protein product, or a secreted product that did not exit the secretory system. e and f Leaf trichome of a different apo35 plant that was incubated with 10 % sucrose. e Bright field image showing extensive protoplasmic plasmolysis in the stalk cell adjacent to the gland (G), with the nucleus (N) clearly visible. The adjacent stalk cell also was clearly plasmolyzed. f GFP fluorescence in this trichome is seen around the periphery of the plasmolyzed protoplasm (Pp), around the plasma membrane (PM), but not throughout the nucleoplasm. Perhaps lowlevel GFP fluorescence is observed at the periphery of the cell in the cell wall space (IS). The scale bar in e applies to all

show GFP fluorescence. Similar observations were reported for Arabidopsis expressing GFP-Aequorin in the cytoplasm (Gao et al. 2004). Note also the lack of punctate staining at the periphery of cells in Fig. 4 a, b. Results with the apo35 plants (Fig. 4c, d) showed the presence of GFP at the periphery of guard cells (GC) and adjacent guard mother cells (GMC). GFP is not apparent throughout the nucleoplasm, but only with the nuclear membrane, as expected for a secreted protein product, or a secreted product that did not exit the secretory system. Note the apparent punctate nature of plasmalemma staining (P) as is often seen with apoplast targeted GFP. A magnified view (Fig. 4d) clearly shows the punctate nature of staining which is often speculated to represent association of GFP with plasmodesmata, or as aggregates with plasmalemma proteins. Results shown in Fig. 4 are consistent with EF data analysis (Table 1) in that they indicate that the apo

construct led to successful secretion of T-phylloplanin-GFP outside the cytoplasm. In contrast, as noted above, the cyto construct provided for weak default/cytoplasmic expression of this fusion gene. We conducted plasmolysis experiments to determine in greater detail the distribution of secreted T-phylloplaninGFP between secretory pathway membranes and the cell wall space. Somewhat surprisingly, results suggested extensive retention in membranes of the secretory system, but with perhaps some evidence of GFP in the cell wall space. A similar phenomenon was observed in plasmolyzed epidermal cells of onion expressing the citrine reporter directed by the promoter of the secreted apoplastic protein OsRMC (Zhang et al. 2008). We found that plasmolysis was much more easily observed in trichome stalk cells than in other epidermal cells, so results with trichomes are shown. Figure 5a shows, in bright field, a trichome from

123

Plant Cell Rep

leaf tissue of a cyto8 plant that was incubated with 10 % sucrose. The greatly plasmolyzed protoplasm (Pp) is indicated in the stalk cell adjacent to the gland cell (G). Without plasmolysis the protoplasm of such stalk cells completely fills its cell volume (not shown). Figure 5b indicates slight GFP staining of membranes of the plasmolyzed protoplasm (Pp) of this stalk cell and a lack of staining in its cell wall area. Green auto fluorescence of gland cell (G) chloroplasts is seen. Figure 5c shows a plasmolyzed trichome stalk cell of an apo35 plant. The nucleus (N) and plasmolyzed protoplasm (Pp) are observed to about half fill the cell volume. The GFP fluorescence in this stalk cell is seen in Fig. 5d. The nuclear membrane (but not the nucleoplasm) shows GFP fluorescence as expected for a secreting protein product, or a product that did not exit the secretory system. In Fig. 5e a different trichome shows extensive protoplasmic plasmolysis in the stalk cell adjacent to the gland (G), with the nucleus (N) clearly visible. The adjacent stalk cell was also clearly plasmolyzed. GFP fluorescence in this trichome is seen in Fig. 5f around the plasmolyzed protoplasm (Pp), around the plasma membrane (PM), but not throughout the nucleoplasm. Perhaps some GFP fluorescence is observed at the periphery of the cell in the intracellular space (IS). Results of plasmolysis experiments are consistent with successful secretion of the apoplast targeted T-phylloplanin-GFP fusion gene product, but significant retention of this product in the membranes of the secretory system. Like Fig. 4 data, results are consistent with results of EF analysis and indicate that the fusion protein is not totally soluble in the extracellular space. Perhaps greater fusion protein release was evident from EF analysis due to the presence of high salt (50 mM NaCl) in that analysis. We speculate that in apo plants, T-phylloplanin is anchored at the periphery of the plasmalemma, and as such may be as effective as cell wall-space soluble T-phylloplanin in intercepting fungal hyphae before they penetrate the PM to initiate infection. In addition, we speculate that T-phylloplanin-GFP fusion protein may be retained in secretory system membranes because of the highly hydrophobic nature of T-phylloplanin protein (49 % hydrophobic amino acid residues, Shepherd et al. 2005). Some of us have speculated that T-phylloplanin, like a number of surfacelocated, animal anti-microbial peptides may have evolved physical properties that cause them to position at air-tissue interfaces (Shepherd and Wagner 2012). In human skin and lung epithelia this would be at the outer surface adjacent to air, and in plants it would be outside the cuticle in contact with air where phylloplanins are naturally found. Such localization may be required for their anti-microbial activity. We speculate that this may explain low accumulation/activity found here for cytoplasmic-targeted T-phylloplanin-GFP.

123

In summary, we have shown that resistance to blue mold disease can be enhanced in a blue mold sensitive tobacco variety by overexpression of a T-phylloplanin gene isolated from a blue mold resistant tobacco, when this gene is expressed as a fusion gene with GFP and targeted to the apoplasm. Our hypothesis was that since invasive hyphae of blue mold (P. tabacina) and other airborne pathogenic fungi are thought to invade tissue through the apoplastic space (of at least the 1st epidermal cell invaded, Ribot et al. 2008), resistance might be improved by intercepting invading hyphae before they penetrate the plasmalemma or plasmodesmata of intact cells. This hypothesis predicts that apoplastic targeting would confer greater resistance than cytoplasmic targeting. We assumed that GFP (28 kDa) fusions would not interfere with the ability of T-phylloplanins (13–26 kD family, Shepherd et al. 2005; Shepherd and Wagner 2007) to reduce resistance to the blue mold fungus. We note that a fusion of a small protein (histone 2B, 18 kD) with a GFP derivative (RFP, 29 kD) does not affect the function of this small protein in a tobacco host (Chakrabarty et al. 2007). Here we report that targeting of T-phylloplanin-GFP to the apoplastic space did confer increased resistance of plants to infection by P. tabacina, the blue mold pathogen and that this resistance is stable in homozygous plants thru at least the T4 generation. Our results are consistent with the tentative conclusion that wall targeting has advantages over cytosolic targeting in that it appears to confer higher and more stable resistance. Results suggest that the fusion protein is largely retained in the membranes of the secretory system. This further suggests that the presence of T-phylloplanin at the outer face of the plasmalemma is capable of conferring resistance against invading hyphae of P. tabacina.

Experimental procedures Construction of expression vectors: 2S2-GFP, apo and cyto The native T-phylloplanin full-length cDNA, lacking its signal sequence, but containing its start codon (Shepherd et al. 2005), was fused with the GFP(S65T) gene (gi 1289375, Heim et al. 1995) and incorporated into constructs with and without the apoplast-targeting sequence 2S2 (Krebbers et al. 1988) to provide for apoplastic (apo) or cytoplasmic (cyto) expression, respectively. Figure 1 diagrams three constructs, the first being 2S2-GFP which is a control plasmid used to demonstrate the effectiveness of the 2S2 wall targeting sequence, the usefulness as a reporter of the particular GFP gene used, and to demonstrate the inability of apoplastic targeted GFP alone to effect blue

Plant Cell Rep

mold disease resistance. The second plasmid, ‘‘apo’’, was used to target the T-phylloplanin-GFP fusion protein to the apoplasm, and the third, ‘‘cyto’’ for default expression of the fusion protein in the cytoplasm. A PCR amplified fragment of GFP (physical structure 50 -SalI-GFP) and native T-phylloplanin (physical structure 50 -NcoI-phylloplaninlinker-SalI-30 ) were cloned into the corresponding sites of the pBluescript derivative pBS50 amv-2S2 and pBS50 amv. The plasmids pBS50 amv-2S2 (physical structure 50 -XhoI50 amv-2S2–NcoI-SalI-SstI-30 ) and pBS50 amv (physical structure 50 -XhoI-50 amv–NcoI-SalI-SstI-30 ) included the translational enhancer (50 amv, Jobling and Geghrke 1987) fused with 2S2 sequence. The forward (50 -T-phylloplanin primer phyllo, 50 -GCGGGCCCATGGGTATACTTGTTCC AACACTT-30 , NcoI site underlined) and reverse (30 -phyllo, 50 -ATGCAGGTCGACCCGTTCGGGTACTGGTACTGG TTGTACATCGGGCCGATGGCATTGATGTTAAGATT AAG-30 , SalI site underlined) primers were used to PCR amplify the phylloplanin fragment (physical structure 50 NcoI-phylloplanin-linker-SalI-30 ). Reporter cDNA of the GFP gene was PCR amplified using appropriately designed primers to insert restriction sites SalI and Sst I at the 50 - and 30 -ends, respectively. The assembled 50 XhoI-SstI-30 gene construct fragment was gel purified and cloned into the corresponding sites of the binary vector pKM24KH (GenBank Accession No. HM036220). The resulting gene construct ‘‘apo’’ had the general structure 50 -EcoRI-M24 promoterHindIII-XhoI-50 amv-2S2-NcoI-phylloplanin-SalI-GFP-SstI30 . The gene construct ‘‘cyto’’ had the general structure 50 -EcoRI-M24 promoter-HindIII-XhoI-50 amv-NcoI-phylloplanin-SalI-GFP-SstI-30 (Fig. 1). The modified Mirabilis mosaic virus (MMV) full-length transcript promoter (M24, Dey and Maiti 1999a, b) was used to promote expression of fusion genes. The construct 2S2-GFP was generated by inserting the PCR amplified GFP sequence of physical structure 50 NcoI-GFP-SstI-30 into the corresponding site of pBS50 amv2S2. The resulting fragment with physical structure 50 XhoI-50 amv-2S2-NcoI-GFP-SstI-30 was inserted into the corresponding site of plant expression vector pKM24KH (GenBank accession # HM036220) to prepare the plasmid 2S2-GFP. Leaf disc transformation and formation of T0, T1, T2, T3, and T4 generation transgenic plants Agrobacterium tumefaciens strain GV3101 was transformed with the recombinant plasmids using triparental mating (Maldonaldo-Mendoza et al. 1996) and maintained under kanamycin, rifampicin and gentamycin selection. Bacterial colonies were secondarily tested for the presence of plasmids using PCR, with the forward T-phylloplanin primer (50 -CCCCAAGTTTTTCCTAATGCA-30 ) and reverse-GFP

(50 -CCGTCCTCCTTGAAGTCGATG-30 ) primers. Leaf discs from sterile plantlets were transformed using the method of Horsch et al. (1988). Regeneration MS medium (Murashige and Skoog 1962) was supplemented with Gamborg B5 vitamins, 6-benzylaminopurine (BA) 1.0 mg/l, Kanamycin 200 mg/l, and Cefotaxime 400 mg/l. Plantlets were transferred to a rooting medium (as the above, but without BA, and with 100 mg/l kanamycin). Rooted plants were maintained on peat-based growth medium. Primary transformants (T0) were PCR tested for the presence of transgenes, tested for blue mold resistance (drop inoculation assay, see below), and those with complete resistance (or minimal infection) were allowed to produce self-seed. Seeds (T1 generation, of at least 20 separate plants) were germinated on MS medium, containing 200 mg/l of kanamycin. The procedure was repeated, selecting only completely resistant progeny plants to obtain T2, T3 and T4 generation plants and to establish homozygosity (complete kanamycin resistance). In all cases T3 and T4 plants tested as homozygous. Isolation of DNA, RNA and RT-PCR analysis Total DNA from primary transgenic plants (T0 plants) and wild-type KY14 plants was isolated using the DNeasy Plant Mini Kit (QIAGEN, Chatsworth, GA, USA), according to the manufacturer’s instructions. We used the forward T-phylloplanin, plus reverse-GFP primers defined above. Total RNA from transgenic tobacco seedlings was isolated using the RNeasy Plant Mini Kit (QIAGEN,). Two lg RNA was treated with RNase free DNase (Sigma, USA) as per the manufacturer’s instructions and was used for synthesis of first-strand cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad, USA), according to the manufacturer’s instructions. For the no-reverse-transcriptase control, an individual reaction was performed in parallel. One ll of the RT reactions was used in the subsequent RT-PCR reaction with forward (#1225—50 -ATGGGCGCCAACAAGCTCTTC-30 ) and reverse (#1230—50 -TCACTTGTACAGCTCGTCCAT30 ) primers for the detection of the full-length T-phylloplaninGFP transcript. As a negative control, the primer pair was tested against DNase-treated RNA to confirm cDNA dependence of amplification. PCR products were separated on ethidium bromide-stained agarose gels. Real-time quantitative reverse transcription PCR (qRT-PCR) The expression level of phylloplanin mRNA in transgenic plants was evaluated by real-time quantitative RT-PCR using phylloplanin-specific primers (#1225 above and #1227, 50 -GAGTTGCAACAACTAAATTGC-30 ). The qPCR assays were performed using iTaq SYBR Green

123

Plant Cell Rep

Supermix with ROX (Bio-Rad, USA) according to manufacturer’s instructions. Tobacco tubulin was used as an internal control to normalize the expression of phylloplanin (primers 50 -ATGAGAGAGTGCATATCGAT-30 and 50 TTCACTGAAGAAGGTGTTGAA-30 ). The comparative Ct method (Applied Biosystems Bulletin) was used to measure the expression levels of the transcripts compared with the control Ky14 wild plants (as used by Sahoo et al. 2012). The specificity of the primer pairs was verified by determining the melting curve of PCR products at the end of each run. Blue mold resistance test via leaf drop inoculation assay Transgenic T.I. KY14 seeds were germinated on MS medium containing 200 mg/l kanamycin. After plants were about 1 month old, dark green, vigorous seedlings were transferred into pots containing peat-based growth medium. One month later plants were subjected to inoculation with spores in a BL2-P security growth chamber with negative pressure of -0.12 inch of water, using a modification of the method described by Addepalli et al. (2006). Two to eight plants per transgenic line and non-transgenic KY14 control plants were used. Spores from P. tabacina isolate KY79 were collected from infected leaves of KY14 plants and their concentration was adjusted to 100,000 spores/ml (Addepalli et al. 2006; Kroumova et al. 2007). Two to three leaves were inoculated per plant and eight 4-ll drops of spore suspension were applied as separate spots (0.5 cm) per leaf, aside the midrib (see Shepherd et al. 2005). The percentage of infected spots (yellow) was determined on the 7th day after inoculation.

and was expressed as mg protein per g (fresh) tissue. The EF and PEF fluids were assayed for the soluble cytoplasmic marker NAD-MDH activity as previously described (Yan et al. 1997). One unit of MDH is the conversion of 1 mM NADH per min at 22 !C. GFP assay Quantitative fluorometric assay of GFP was made according to Remans et al. (1999). The GFP concentration (expressed in lg GFP per g fresh tissue) was measured in leaf tissue, EF and PEF fractions of leaf tissue from transgenic and control plants using the Turner Biosystems Luminometer, with a GFP-UV module. Results were expressed as the mean ± standard deviation of values obtained from five different plants of the same line. Bright field and fluorescence microscopy In situ GFP fluorescence (and bright field imaging) of plant leave cells was monitored with laser scanning confocal microscope (Olympus FV 1000, excitation line 448 nm). The objective used was an Olympus PLAPO60XWLSM (NA 1.0). Image acquisition was conducted at a resolution of 512 9 512 pixels with a scan rate of 10 ms/pixel. Olympus FLUOVIEW 1.5 was used to control the microscope, image acquisition, and export of TIFF files (Martin et al. 2009). Acknowledgments We are grateful to the Kentucky Tobacco Research and Development Center for financial support (Grant # 1235412670). We thank J.T. Hall for providing blue mold spores. Conflict of interest of interest.

The authors declare that they have no conflict

Extracellular fluid analysis Extracellular fluid (EF) was extracted from leaves of 8-week-old transgenic and control plants grown in the greenhouse using the general method as described by Verwoerd et al. (1995). In brief, after removing the midribs, 3 leaves were weighed and submerged in 5 mM Hepes/NaOH, pH 6.3, containing 50 mM NaCl. A vacuum of 760 mm Hg was applied and released several times until the leaves became translucent. Leaves were removed and EF was recovered by centrifugation of the solution at 1,5009g for 20 min at 4 !C. To prepare soluble, postextracellular fluid (PEF), the leaves from which EF was prepared were homogenized in EF buffer (above) and centrifuged at 10,000g for 20 min at 4 !C. EF and PEF samples were diluted with 0.1 M Na2CO3, pH 9.6 in above homogenization buffer for GFP estimation (see below). Protein content in plant fractions was determined using the Bradford method, with BSA as standard (Bradford 1976),

123

References Addepalli B, Xu R, Dattaroy T, Li B, Bass TW, Li QQ, Hunt AG (2006) Disease resistance in plants that carry a feedbackregulated yeast poly(A) binding protein gene. Plant Mol Biol 61:383–397 Almasia NI, Bazzini AA, Hopp HS, Vazquez-Rovere C (2008) Overexpression of snaking-1 gene enhances resistance to Rhizoctonia solani and Erwinia carotovora in transgenic potato plants. Mol Plant Pathol 3:329–338. doi:10.1111/J.1364-3703. 2008.00469.X Bathacharyya S, Pattanaik S, Maiti IB (2003) Intron-mediated enhancement of gene expression in transgenic plants using chimeric constructs composed of the Peanut chlorotic streak virus (PCISV) promoter-leader and the antisense orientation of PCISV ORF VII (p7R). Planta 218:115–124 Bradford MM (1976) Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Brent KJ, Hollomon DW (2007) Fungicide resistance in crop pathogens: How can it be managed? Fungicide Resistance

Plant Cell Rep Action Committee FRAC Monograph No. 1 (second revised edition) Cao J, Li X, Dong X (1998) Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proc Natl Acad Sci USA 95:6531–6536 Chakrabarty R, Banerjee R, Chung SM, Farman M, Citovsky V, Hogenhout SA, Tzfira T, Goodin M (2007) PSITE vectors for stable integration or transient expression of autofluorescent protein fusions in plants: probing Nicotiana benthamianavirus interactions. Mol Plant Microbe Interact 20(7): 740–750 Cortleven A, Remans T, Brenner WG, Walcke R (2009) Selection of plasmid- and nuclear-encoded reference genes to study the effect of altered endogenous cytokinin content on photosynthesis genes in Nicotiana tabaccum. Photosynth Res 102:21–29 Dey N, Maiti IB (1999a) Structure and promoter/leader deletion analysis of mirabilis mosaic virus (MMV) full-length transcript promoter in transgenic plants. Plant Mol Biol 40:771–782 Dey N, Maiti IB (1999b) Further characterization and expression analysis of Mirabilis mosaic virus (MMV) full-length transcript promoter with single and double enhancer domains in transgenic plants. Transgenics 3:61–70 El-Shemy HA, Mutasim M, Khalafalla MM, Ishimoto M (2008) The role of green fluorescent protein (GFP) in transgenic plants to reduce gene silencing phenomena. Curr Issues Mol Biol 11(Suppl 1):i21–i28 Friedrich L, Lawton K, Dietrich R, Willits M, Cade R, Ryals J (2001) NIM1 overexpression in Arabidopsis prtentiates plant disease resistance and results in enhanced effectiveness of fungicides. MPMI 14:1114–1124 (publ. no. M-2001-0611-02R) Gao D, Knight MR, Trewavas AJ, Sattelmacher B, Plieth C (2004) Self-reporting Arabidopsis expressing pJ and [Ca2?] indicators unveil ion dynamics in the cytoplasm and in the apoplast under abiotic stress. Plant Physiol 134:898–908. doi:10.1104/pp.103. 032508 Gisi U, Chin KM et al (2000) Recent developments in elucidating models of resistance to phenylamide, DMI and strobilurin fungicides. Crop Prot 19:863–872 He P, Warren RF, Zhao T, Shan L, Zhu L, Tang X, Zhou JM (2001) Overexpression of Pti5 in tomato potentiates pathogen-induced defense gene expression and enhances disease resistance to Preudomonas syringae pv. tomato. Mol Plant Microbe Interact 14:1453–1457 Heim R, Cubitt AB, Tsien RY (1995) Improved green fluorescence. Nature 373:663–664 Hong JK, Hwang BK (2005) Induction of enhanced disease resistance and oxidative stress tolerance by overexpression of pepper basic PR-1 gene in Arabidopsis. Physiol Plantarum 124:267–277 Horsch RB, Fry J, Hoffmann N, Neidermeyer J, Rogers SG, Fraley RT (1988) Leaf disc transformation. In: Gelvin SB, Schilperoort RA (eds) Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht, pp A5/1–A5/9 Jobling SA, Geghrke L (1987) Enhanced translation of chimaeric messenger RNAs containing a plant viral untranslated leader sequence. Nature 325:622–625. doi:10.1038/325622a0 King B (2011) T-phylloplanin and cis-abienol, two natural products from tobacco have broad spectrum, anti-fungal activities. University of Kentucky Graduate School, Dissertation King B, Williams D, Wagner GJ (2011) Phylloplanins reduce the severity of gray leaf spot and brown patch diseases on turfgrasses. Crop Sci 51:2829–2839 King B, Williams D, Wagner GJ (in preparation) Krebbers E, Herdies L, De Clercq A, Seurinck J, Leemans J, Van Damme J, Segura M, Gheysen G, Van Montagu M, Vandekerckhove J (1988) Determination of the processing sites of an

Arabidopsis 2S albubin albumin and characterization of the complete gene family. Plant Physiol 87:859–866 Kroumova AB, Shepherd RW, Wagner GJ (2007) Impacts of T-Phylloplanin gene knockdown and of Helianthus and Datura phylloplanins on Peronospora tabacina spore germination and disease potential. Plant Physiol 144:1843–1851 Li L, Steffens JC (2002) Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance. Planta 215:239–247. doi:10.1007/s00425-002-0750-4 Maldonaldo-Mendoza IE, Lopez-Mayer M, Nessler CL (1996) Transformation of tobacco and carrot using Angrobacterium tumefaciens and expression of the b-glucuronidase (GUS) reporter gene, pp 261–274. In: Trigiano RN, Gray DJ (eds) Plant Tissue Culture Concepts and Laboratory Exercises. CRC Press, Inc., Boca Raton Malnoy M, Jin Q, Borejsza-Wysocka EE, He SY, Aldwinckle HS (2007) Overexpression of the apple MpNPR1 gene confers increased disease resistance in Malux x Domestica. PMPI 20:1568–1580. doi:10.1094/MPMI-20-12-1568 Martin K, Kopperud K, Chakrabarty R, Banerjee R, Brookd R, Goodin MM (2009) Transient expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition of protein localization, movement and interactions in planta. Plant J. doi:10.1111/j.1365-313X.2009.03850.x Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plantarum 15:73–97 Portieles R, Ayra C, Gonzalez E, Gallo A, Rodriguez R, Chacon O, Lopez Y, Rodriguez M, Castillo J, Pujol M, Enriquez G, Borroto C, Trujillo L, Thomma B, Borras-Hidalgo O (2010) NmDef02, a novel antimicrobial gene isolated from Nicotiana megalosiphon confers high-level pathogen resistance under greenhouse and field conditions. Plant Biotech J 8:678–690 Qiu D, Xiao J, Ding X, Xiong M, Cai M, Cao Y, Li X, Xu C, Wang S (2007) OsWRKY13 Mediated rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. MPMI 20:492–499. doi:10.1094/MPMI-20-50492 Remans T, Schenk PM, Manners JM, Grof CPL, Elliott AR (1999) A protocol for the fluorometric quantification of mGFP5-ER and sGFP(S65T) in transgenic plants. Plant Mol Biol Rep 17:385–395 Ribot C, Hirsch J, Balzergue S, Tharreau D, Notteghem JL, Lebrun MH, Morel JB (2008) Susceptibility of rice to the blast fungus, Magnaprothe grisea. J Plant Physiol 165:114–124 Sahoo DK, Stork J, DeBolt S, Maiti IB (2012) Manipulating cellulose biosynthesis by expression of mutant Arabidopsis proM24:CESA3ixr1-2 gene in transgenic tobacco. Plant Biotechnol J 11:362–372 Shepherd RW, Wagner GJ (2007) Phylloplane proteins: emerging defenses at the aerial frontline? Trends Plant Sci 12:51–56 Shepherd RW, Wagner GJ (2012) Fungi and leaf surfaces. In: Southworth D (ed) Biocomplexity of plant–fungal interactions. Wiley-Blackwell Press, New Jersey, pp 131–154 Shepherd RW, Bass T, Houtz RL, Wagner GJ (2005) Phylloplanins of tobacco are defensive proteins deployed on aerial surfaces by short glandular trichomes. Plant Cell 17:1851–1861 Tang X, Xie M, Kim YJ, Zhou J, Klessig DF, Martin GB (1999) Overexpression of Pto activated defense responses and confers broad resistance. Plant Cell 11:15–29 Verwoerd TC, van Paridon PA, van Ooyen AJ, van Lent JW, Hoekema A, Pen J (1995) Stable accumulation of Aspergillus niger phytase in transgenic tobacco leaves. Plant Physiol 109:1199–1205 Yan X, Gonzales RA, Wagner GJ (1997) Gene fusions of signal sequences with a modified [beta]-glucuronidase gene results in

123

Plant Cell Rep retention of the [beta]-glucuronidase protein in the secretory pathway/plasma membrane. Plant Physiol 115:3915–3924 Yi H, Richards EJ (2007) A cluster of disease resistance genes in Arabidopsis is coordinately regulated by transcriptional activation and RNA silencing. Plant Cell 19:2929–2939

123

Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2008) Identification of an apoplastic protein involved in the initial phase of salt stress response in rice root by two-dimensional electrophoresis. Plant Physiol 149:9160928