Expression of a Second Ecto-5′Nucleotidase Variant Besides the Usual Protein in Symptomatic Phase of Experimental Autoimmune Encephalomyelitis Irena Lavrnja, Danijela Laketa, Danijela Savic, Iva Bozic, Ivana Bjelobaba, Sanja Pekovic & Nadezda Nedeljkovic Journal of Molecular Neuroscience ISSN 0895-8696 J Mol Neurosci DOI 10.1007/s12031-014-0445-x
1 23
Your article is protected by copyright and all rights are held exclusively by Springer Science +Business Media New York. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.
1 23
Author's personal copy J Mol Neurosci DOI 10.1007/s12031-014-0445-x
Expression of a Second Ecto-5′-Nucleotidase Variant Besides the Usual Protein in Symptomatic Phase of Experimental Autoimmune Encephalomyelitis Irena Lavrnja & Danijela Laketa & Danijela Savic & Iva Bozic & Ivana Bjelobaba & Sanja Pekovic & Nadezda Nedeljkovic
Received: 4 September 2014 / Accepted: 13 October 2014 # Springer Science+Business Media New York 2014
Abstract Ecto-5′-nucleotidase/cluster of differentiation 73 (CD73) (eN) is a 70-kDa glycoprotein expressed in several different mammalian tissues and cell types. It is the rate-limiting enzyme of the purine catabolic pathway, which catalyzes the hydrolysis of AMP to produce adenosine with known anti-inflammatory and immunosuppressive actions. There is strong evidence for lymphocyte and endothelial cell eN having a role in experimental autoimmune encephalomyelitis (EAE), but the role of eN in cell types within the central nervous system is less clear. We have previously shown that eN activity significantly increased in the lumbar spinal cord during EAE. The present study is aimed to explore molecular pattern of the eN upregulation over the course of the disease and cell type(s) accountable for Irena Lavrnja and Danijela Laketa contributed equally to this work. I. Lavrnja : D. Savic : I. Bozic : I. Bjelobaba : S. Pekovic Institute for Biological Research “Sinisa Stankovic”, University of Belgrade, Boulevard Despot Stefan 142, Belgrade 11060, Serbia
the induction. EAE was induced in Dark Agouti (DA) rats by immunization with the spinal cord tissue homogenate and adjuvant. Animals were sacrificed 8, 15, and 28 days following immunization (D8, D15, and D28), i.e., at time points which corresponded to the presymptomatic, symptomatic, and postsymptomatic phases of the disease, respectively. Significant increase in eN activity and its upregulation at the gene and the protein levels were demonstrated at D15 and less prominently at D28 in comparison to control. Additionally, reactive astrocytes abundantly present in the lumbar spinal cord parenchyma were identified as principal cell type with significantly elevated eN expression. In all experimental groups, eN was expressed as a 71-kDa protein band of uniform abundance, whereas the overexpression of eN at D15 and D28 was associated with the expression of a second 75-kDa eN variant. The possible outcome of eN upregulation during EAE as a part of protective astrocyte repertoire contributing to the resolution of the disease is discussed.
I. Lavrnja e-mail:
[email protected] D. Savic e-mail:
[email protected]
Keywords Ecto-5′-nucleotidase/CD73 . Astrocytes . EAE . Neuroinflammation . Adenosine . Glycosylation
I. Bozic e-mail:
[email protected] I. Bjelobaba e-mail:
[email protected] S. Pekovic e-mail:
[email protected] D. Laketa : N. Nedeljkovic (*) Institute for Physiology and Biochemistry, Faculty of Biology, University of Belgrade, Studentski trg 3, Belgrade 11001, Serbia e-mail:
[email protected] D. Laketa e-mail:
[email protected]
Abbreviations ATP Adenosine triphosphate CNS Central nervous system D Days after immunization EAE Experimental autoimmune encephalomyelitis eN Ecto-5′-nucleotidase ENT Equilibrative nucleoside transporter MS Multiple sclerosis NTPDase Nucleoside triphosphate diphosphohydrolase Panx1 pannexin 1
Author's personal copy J Mol Neurosci
Introduction Multiple sclerosis (MS) is a chronic neurodegenerative disease, characterized by a progressive loss of neurological functions due to immune-mediated demyelination and axonal loss in multiple areas of the brain and spinal cord (Keegan and Noseworthy 2002; Lassmann et al. 2007). Although there is evidence for both genetic and environmental components of susceptibility to MS (Niino et al. 2007; Ascherio and Munger 2007), the common effector phase in development and progression of MS is widespread and continuous or recurring inflammation driven by autoreactive T cells that infiltrate the central nervous system (CNS). However, the lack of lymphocyte recruitment after the initial relapsing phase of the disease points to other factors which may drive the pathology in later phases, and there is increasing evidence implicating resident glial cells in the mechanism of the disease. Among resident cells within the CNS, astrocytes are receiving increasing attention for their complex roles in neuroinflammation associated with MS (Brück 2005; Voskuhl et al. 2009; Lavrnja et al. 2012; Ingram et al. 2014). Although, widespread reactive astrogliosis in different areas of the brain and spinal cord is the prominent feature of MS (Eng et al. 1970; Liedtke et al. 1998; Hostenbach et al. 2014), roles of reactive astrocytes during peripherally initiated, adaptive, or acquired immune CNS inflammation in vivo are not fully understood. Astrocytes establish close contact with blood vessels, regulate leukocyte entry to the CNS (John et al. 2005; Mills et al. 2008, 2012), and produce number of proinflammatory chemokines, cytokines, and various reactive oxygen species (ROS), thus acting as mediators of neuroinflammation (Dong and Benveniste 2001; Chen and Swanson 2003; Farina et al. 2007; Nair et al. 2008). However, scarforming reactive astrocytes may protect CNS tissue by limiting the spread of immune and inflammatory leukocytes into CNS parenchyma and by producing anti-inflammatory cytokines and ROS scavengers (Aloisi et al. 1997; Nair et al. 2008; Voskuhl et al. 2009). The role of purinergic signaling in MS is another promising area of the research. Extracellular adenosine triphosphate (ATP) has been recognized as damage-associated molecular pattern (Virgilio et al. 2009; Fiebich et al. 2014), with important role in inflammation and immune responses associated with MS (Matute 2011). Excessive ATP signaling through multiple P2X and P2Y receptors can be deleterious to neurons and oligodendrocytes (Franke et al. 2012). ATP acts as proinflammatory agent, recruiting neutrophils and monocytes, facilitating leukocyte adhesion to the endothelium (Henttinen et al. 2003), and potentiating the release of proinflammatory cytokines (Hide et al. 2000; Bours 2006). ATP also acts as a chemoattractant to microglia and astrocytes (Franke et al. 2012). The role of ATP in neuroinflammation is closely related to its final breakdown product, nucleoside
adenosine, which performs several important roles in the immunity. Adenosine exhibits strong anti-inflammatory and immunosuppressive actions by inhibiting T cell proliferation (Kobie et al. 2006), secretion of cytokines, and migration of leukocyte across endothelial barriers (Thompson et al. 2008). The interrelation between ATP and adenosine is additionally based on the co-expression and co-localization of their respective purinoreceptors, P2 and P1, and their metabolizing enzymes at all neuronal and glial cell types. Specifically, the a c t i on s o f e x t r a c el l u l a r AT P a r e t e r m i n at e d b y ectonucleotidase enzyme cascade, which sequentially removes phosphate groups from ATP to produce adenosine (Zimmermann et al. 2012). Nucleotides ATP and ADP are hydrolyzed by ecto-nucleoside triphosphate diphosphohydrolase 1–3 (NTPDase1–3), whereas the final step of the conversion is catalyzed by ecto-5′-nucleotidase, which produces adenosine (Zimmermann and Braun 1999). Ecto-5′-nucleotidase (eN/Cluster of differentiation 73 (CD73)) is a divalent cation-dependent AMP-hydrolyzing enzyme. The protein is glycosyl phosphatidylinositol (GPI)linked membrane-bound glycoprotein, with its active site facing the extracellular compartment. In rodents, the enzyme comprises 576 amino acids with a predicted molecular mass of 57–59 kDa (Wada et al. 1986). The rat protein possesses five potential sites for N-glycosylation (Misumi et al. 1990), whose total or partial occupation along with the changing composition of the N-linked oligoglycans explains the wide diversity of eN variants (Vogel et al. 1991; Zimmermann 1992). The varying oligosaccharides may be responsible for the reported differences in size and kinetic behavior of eN variants in distinct tissues and cell types, between healthy and pathological tissues, and, even, between eN components arising from the same cell type (Wada et al. 1986; Vogel et al. 1991; Misumi et al. 1990; Zimmermann 1992; Cunha et al. 2000; Grkovic et al. 2014). The enzyme belongs to the cluster of differentiation family (CD73) and has role as cell adhesion molecule implicated in a variety of biological processes, including cell adhesion, spreading, growth, and migration (Vogel et al. 1991; Zimmermann et al. 2012). Several lines of evidence suggest involvement of eN/CD73 in the neuroinflammatory process associated with MS. Specifically, CD73−/− mice are highly resistant to induction of experimental autoimmune encephalomyelitis (EAE), a well-defined immune-driven model for MS (Mills et al. 2008). The resistance is due to lack of eN/CD73 and adenosine receptor signaling, which are both required for efficient entry of lymphocytes into the CNS during EAE development (Mills et al. 2008, 2012). On the other hand, a disease phasespecific enhancement of eN activity was demonstrated in the lumbar spinal cord tissue over the course of EAE (Lavrnja et al. 2009). Several inflammatory factors associated with development and progression of MS/EAE regulate the
Author's personal copy J Mol Neurosci
expression of eN by astrocytes in vitro (Brisevac et al. 2012), whereas IFN-β, one of the most effective therapeutics for MS, upregulates eN expression on endothelial cells in vivo and in vitro (Airas et al. 2007; Niemela et al. 2008). Therefore, the aim of present study was to describe the pattern of eN expression at molecular and cellular level over the course of EAE. Significant induction of eN at transcriptional level was shown in the lumbar spinal cord during acute symptomatic and postsymptomatic phases of clinical EAE. The upregulation of eN at the protein level and increase in the enzyme activity were demonstrated as well, wherein the upregulation at the protein level was associated with the appearance of a second eN variant with slightly different apparent molecular weight. Based on immunofluorescence data, it was demonstrated that reactive astrocytes were preeminent source of eN during EAE. Since abundant localization of eN at highly hypertrophied astrocytes was manifested in the symptomatic and postsymptomatic phases of this monophasic disease, collected data indicate that overexpression of eN by reactive astrocytes may be part of protective astrocyte repertoire during acute innate inflammation.
EAE grading scale, with 0.5 points for intermediate neurological findings: 0, unaffected; 0.5, partial loss/reduced tail tone, characterized by inability to curl the distal end of the tail; 1, tail atony; 1.5, slightly/moderately clumsy gait, impaired righting ability or combination; 2, hind limb weakness; 2.5, partial hind limb paralysis; 3, complete hind limb paralysis; 3.5, complete hind limb paralysis and fore limb weakness; 4, tetraplegic; and 5, moribund state or death. To ensure impartiality and avoid errors arising from bias, blind scoring was performed by two independent experimenters who were unaware of the protocol. Scores for each animal were averaged and plotted as daily mean clinical score (Fig. 1). After immunization, animals developed acute monophasic disease with 100 % incidence. First signs of the disease appeared, on average, at D9. The values peaked at D14 and decreased afterwards during the period of recovery, with all rats completely recovered at D24. Neurological scores are given in Table 1. According to neurological scoring, the time points selected for the analysis, D8, D15, and D28, represent late presymptomatic (score 0), acute symptomatic (2–3), and postsymptomatic (score 0) phase of the disease, respectively.
Materials and Methods
Tissue Preparation
Induction of EAE
Rats were deeply anesthetized with Zoletil® 50 (Virbac, France; 30 mg/kg i.p.). Animals from EAE group were sacrificed at D8, D15, and D28 (three/group). Age-matched naive animals were used as control. Spinal cords were rapidly dissected on ice. Lumbar region of the spinal cords was used for all further tissue processing.
All experiments were conducted using 2-month-old male rats of Dark Agouti inbred strain from the local colony. Animal procedures were approved by the Ethical Committee for the Use of Laboratory Animals of Institute for Biological Research “Sinisa Stankovic” (Belgrade, Serbia), as being in compliance with the EEC Directive (86/609/EEC) on the protection of animals used for experimental and other scientific purposes. Animals were housed (3–5/cage) under conventional conditions (constant temperature and humidity, 12-h light/dark cycle) and had free access to food and water. During period of paralysis, animals were watered manually. Animals were randomly divided into two groups. EAE group was injected with 100 μL of an encephalitogenic emulsion of rat spinal cord homogenate (50 % w/v in saline) mixed with an equal volume of complete Freund’s adjuvant containing 0.5 mg/mL Mycobacterium tuberculosis (CFA; Sigma, St. Louis, MO, USA). The dosage was divided in halves and s u b cu t an e ou s l y i n j ec t e d i n b ot h h i n d f oo t pa d s . Immunization was performed under ether anesthesia. The group of age-matched intact animals was used as a control. Disease Severity Assessment Each morning, animals were examined, weighed, and scored for neurological signs of EAE for 28 days after immunization (D). Disease severity was assessed according to standard 0–5
eN Assay Animals were sacrificed under deep anesthesia, and lumbar spinal cords were dissected and pooled (three/group) for crude plasma membrane preparation (Gray and Whittaker 1962). Ecto-5′-nucleotidase (eN) was assayed in a reaction medium containing (in mmol/L): 100 Tris–HCl, pH 7.4, and 10 MgCl2 and 50 μg of crude membrane preparation proteins in the final volume of 200 μL. The reaction mixtures were preincubated for 10 min at 37° and then incubated for 30 min in the presence of 1 mM AMP. The reactions were stopped by addition of 20 μL of 3 mol/L perchloric acid. The samples were chilled on ice, and amount of inorganic phosphate (Pi) released as a result of the enzyme reaction was determined by Malachite Green Phosphate assay kit (Bioassay system, Hayward, CA, USA). Incubation time and protein concentration were chosen in order to ensure the linearity of the reaction. All samples were run in triplicate in n-independent determinations. Enzyme activities were expressed as nmol Pi/mg of protein/min.
Author's personal copy J Mol Neurosci Table 2 Primer sequences used for qRT-PCR Target gene
Primer sequence (5′→3′)
eN/CD73
(f): CAAATCTGCCTCTGGAAAGC (r): ACCTTCCAGAAGGACCCTGT (f): TCAAGGACCCGTGCTTTTAC (r): TCTGGTGGCACTGTTCGTAG (f): TGCTTCGACACAGATCACCT (r): GATGAACAGCCCTGTGATGA (f): GTGATTTGGGCTGTGAAGGT (r): GAGCTCTGGGTGAGGATGAG (f): GTGTTTGGGATTCACTTTGATA (r): TCTGCTTGTAGTAGTGCCTCTT (f): AGAAGAGTGACTACCTCAAGCA (r): ACAGTTCCAGTTGATGATGACT (f): CCTCACCGACAAGGACATA (r): ACACCCAGCCGATCTTAAT (f): TCCTGATAAGACCAGCATTT (r): CAAGAGGGTGAAGTTTTCTG (f): CAAATCTCTACTGTCCCATCTT
NTPDase1 NTPDase2 AdoR1 Fig. 1 Disease severity scores. EAE was induced in DA rats following immunization with rat spinal cord homogenate (50 %w/v emulsion in saline) in complete Freund’s adjuvant. Naive rats served as a control. Animals were scored for neurological signs of EAE according to the standard 0–5 EAE grading scale. Animals (9/group) were sacrificed at D8, D15, and D28, which corresponded to the presymptomatic, acute symptomatic, and postsymptomatic phases, respectively. Data are expressed as the mean clinical score±SEM
Real-Time PCR
P2X1 P2X2 P2X3 P2X4 P2X5
Animals were sacrificed at D8, D15, and D28 (three/group). Lumbar spinal cord was dissected, and the tissue was immediately frozen in liquid nitrogen and kept at −80 °C until RNA extraction. Gene expression analyses were performed by quantitative reverse transcription (qRT)-PCR using SYBR Green PCR Master Mix and standardized protocol. Briefly, total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). The RNA concentration was assessed by determining optical density (OD) 260, whereas the purity was evaluated based on OD260/OD280 ratio (1.8–2.1, for all samples) and gel inspection. RNA was reverse transcribed using High-capacity complementary DNA (cDNA) RT kit (Applied Biosystems, Carlsbad, CA, USA). Reactions were performed in a 25-μL reaction mixture containing SYBR Green PCR Master Mix and the cDNA template (10 ng of RNA converted to cDNA). Reactions were carried out in the ABI Prism 7000 Sequence Detection System (Applied Biosystems, USA) under the optimized conditions. Primer sequences are given in Table 2 (Invitrogen, Germany). As the validity of the method critically depends on the constant expression of a reference gene, the condition was tested in preliminary experiments with the use of four reference Table 1 EAE neurological scores Neurological parameter
Score
Incidence Disease onset (D±SEM) Duration of the disease (mean days±SEM) Duration of paralysis (mean days±SEM) Mean maximum severity score
29/29 (100 %) 9.3±0.4 10.3±0.8 1.9±0.3 2.3±0.2
P2X7 Panx1 ENT1 ENT2 TGF-β IL-10 TNF-α Vimentin GFAP GAPDH
(r): TAGTAGTGTGGGTTGCATTTAG (f): TCGGAGAGAACTTTACAGAGG (r): ACAGGGACTCATTGGTGTACT (f): CCACCGAGCCCAAGTTCAA (r): GGAGAAGCAGCTTATCTGGGT (f): CACTTCCTTCGCTGTTAGGG (r): TGTCCCCCTACCACTCTGAC (f): CCCTCATGACCTTCTTCCTG (r): CCAAGAGACCCGGTATAGCA (f): ACGGTGATGCGGAAGCAC (r): CCCTGCCCCTACATTTGG (f): GCTCAGCACTGCTATGT (r): GTCTGGCTGACTGGGAAGTG (f): CTCCCAGAAAAGCAAGCAAC (r): CGAGCAGGAATGAGAAGAGG (f): CGTACGTCAGCAATATGAAAGTGTG (r): TCAGAGAGGTCAGCAAACTTGGA (f): CTCCTATGCCTCCTCCGAGACGAT (r): GCTCGCTGGCCCGAGTCTCTT (f): TGGACCTCATGGCCTACAT (r): GGATGGAATTGTGAGGGAGA
genes: cyclophilin A (CycA), hypoxanthine-guanine phosphoribosyltransferase (HPRT), glyceraldehyde-3phosphate dehydrogenase (GAPDH), and actin. The most consistent expression was obtained with GAPDH, which was used for quantification by the ΔCt method. Relative expression of target genes was calculated by comparing the Ct values in each sample with the Ct values of the internal standard, and data were expressed as the ratio of the amount of each transcript vs. concentration of GAPDH. Melting curves
Author's personal copy J Mol Neurosci
and gel electrophoresis of the PCR products were routinely performed to determine this specificity of the PCR reaction (not shown). Western Blot Animals were sacrificed under deep anesthesia, and lumbar spinal cords were dissected and pooled (three/group) for crude plasma membrane preparation (Gray and Whittaker 1962). The tissue was homogenized in the isolation buffer (0.32 mol/L sucrose, 5 mmol/L Tris, pH 7.4) and centrifuged at 1,000×g for 10 min at 4 °C. Resulting supernatant was centrifuged at 12,000×g for additional 30 min, and the pellet was resuspended and homogenized in 5 mmol/L Tris, pH 7.4, and kept on −70 °C until use. The protein contents were determined using Micro BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, USA), according to the manufacturer’s instruction. Crude plasma membrane samples were diluted 1:1 in 2× sample buffer (Bio-Rad, USA), and equivalent amounts (24 μg of proteins) were resolved on 7.5 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to a PVDF support membrane. After blocking with 5 % bovine serum albumin (BSA, Sigma-Aldrich, USA) in Tris-buffered saline/Tween 20 (TBST), the blots were probed overnight at 4 °C with the rabbit monoclonal anti-eN antibodies (1:1 500 dilution in 2 % BSA/TBST; Cell Signaling, USA). Bands were visualized on X-ray films (Kodak) with the use of chemiluminescence, after incubating support membrane for 2 h at room temperature in donkey antigoat IgG-horseradish peroxidase-conjugated secondary antibodies (1:5,000 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The intensity of the bands was evaluated by densitometric analysis using ImageQuant 5.2 software. The optical density of each protein band was normalized against optical density of the β-actin band on the same lane and expressed relative to control (100 %). Data are expressed as mean effect±SEM from eight separate determinations.
Santa Cruz Biotechnology, Santa Cruz, CA, USA), followed by incubation with the antibodies against specific cell markers: rabbit anti-GFAP (1:500, DAKO, Glostrup, Denmark), mouse anti-ED1 (1:200, Abcam, MA, USA), or goat-anti-Iba1 (1:200, Abcam, MA, USA) antibodies. Immune complexes were visualized with donkey anti-goat Alexa Fluor 555 (1:200), donkey anti-rabbit Alexa Fluor 488 (1:200), donkey anti-mouse IgG Alexa Fluor 488 (1:200), donkey anti-rabbit Alexa Fluor 555 (1:200), and donkey anti-goat Alexa Fluor 488 (1:200), all purchased from Invitrogen (Carlsbad, CA, USA). Sections incubated with appropriate secondary antibodies without the primary antibody were used as negative control. The sections were mounted in Mowiol (Calbiochem, Millipore, Germany) and captured on Zeiss Axiovert fluorescent microscope equipped with camera and EC Plan-Apochromat 100× objective, using the Apotome system for obtaining optical sections.
Data Analysis Statistical analysis was performed by using R version 2.8.1 software (The R Foundation for Statistical Computing, Vienna, Austria) and Origin version 7.4 software. A oneway analysis of variance (ANOVA) followed by Tukey’s post hoc test (considering p
