Gene Therapy (2008) 15, 1139–1146 & 2008 Macmillan Publishers Limited All rights reserved 0969-7128/08 $30.00 www.nature.com/gt
ORIGINAL ARTICLE
Ex vivo adenoviral transfer of bone morphogenetic protein 12 (BMP-12) cDNA improves Achilles tendon healing in a rat model M Majewski1, O Betz2, PE Ochsner3, F Liu2, RM Porter2 and CH Evans2 1
Department of Orthopaedic Surgery and Traumatology, Universita¨tsklinik Basel, Basel, Switzerland; 2Center for Molecular Orthopaedics, Harvard Medical School, Boston, MA, USA and 3Department of Orthopaedic Surgery, Sankt Anna Klinik, Luzern, Switzerland
The aim of our study was to evaluate the histological and biomechanical effects of BMP-12 gene transfer on the healing of rat Achilles tendons using a new approach employing a genetically modified muscle flap. Biopsies of autologous skeletal muscle were transduced with a type-five, first-generation adenovirus carrying the human BMP-12 cDNA (Ad.BMP-12) and surgically implanted around experimentally transected Achilles tendons in a rat model. The effect of gene transfer on healing was evaluated by mechanical and histological testing after 1, 2, 4 and 8 weeks. One week after surgery, the maximum failure load of the healing tendons was significantly increased in the BMP12 group, compared with the controls, and the tendon stiffness was significantly higher at 1, 2 and 4 weeks. Moreover, the size of the rupture callus was increased in the presence of BMP-12 and there was evidence of accelerated remodeling of the lesion in response to BMP-12. Histological examination showed a much more organized and homogeneous pattern of collagen fibers at all time points in lesions
treated with the BMP-12 cDNA muscle graft. Both single fibrils and the collagen fibers had a greater diameter, with a higher degree of collagen crimp than the collagen of the control groups. This was confirmed by sirius red staining in conjunction with polarized light microscopy, which showed a higher shift of small yellow-green fibers to strong yelloworange fibers after 2, 4 and 8 weeks in the presence of BMP12 cDNA. There was also an earlier shift from fibroblasts to fibrocytes within the healing tendon, with less fat cells present in the tendons of the BMP-12 group compared with the controls. Treatment with BMP-12 cDNA-transduced muscle grafts thus produced a promising acceleration and improvement of tendon healing, particularly influencing early tissue regeneration, leading to quicker recovery and improved biomechanical properties of the Achilles tendon. Further development of this approach could have clinical applications. Gene Therapy (2008) 15, 1139–1146; doi:10.1038/gt.2008.48; published online 24 April 2008
Keywords: bone morphogenetic protein; growth and differentiation factor; Achilles tendon; tendon healing
Introduction Tendons are the functional connection between the dynamic and static components of the locomotive apparatus. Disturbance of the propagation of force from the muscle to the bone is associated with a considerable loss of function of the extremity. Achilles tendon ruptures are common sports injuries.1–3 According to the estimations of Suchak et al.,4 up to 2500 Achilles tendon ruptures occur in a small country like Switzerland each year. During healing, the ruptured tendon forms a functional tendon regenerat within 6–8 weeks but despite intensive remodeling over the following months, complete regeneration of the tendon is never achieved.5–8 Up to 10% of the Achilles tendon rerupture during healing.6 This results in a significant cost to Correspondence: Dr M Majewski, Department of Orthopeadic Surgery and Traumatology, University of Basel, Spitalstrasse 21, Basel CH-4031, Switzerland. E-mail:
[email protected] Received 23 July 2007; revised 22 December 2007; accepted 10 February 2008; published online 24 April 2008
individuals and society in reduced quality of life and lost work productivity. Certain cytokines have been shown to promote tendon healing.9–11 Bone morphogenetic proteins (BMPs) are a family of highly related molecules that form a subgroup under the transforming growth factor-b superfamily.12 BMP-12, a human homolog of murine growth and differentiation factor-7 (GDF-7), induces the formation of tendon- and ligament-like tissue and is thus of considerable interest in the context of enhancing tendon repair.13 It has been reported that BMP-12-transfected mesenchymal stem cells differentiate into tenocytes and that BMP-12 gene transfer augments the repair of lacerated tendon.14,15 The effects of BMP-12 on tendon healing thus merit further investigation.16 However, it is very difficult to deliver proteins such as BMP-12 in a focused and sustained manner. The local transfer and expression of a BMP-12 cDNA offers a potential method for overcoming such delivery problems. Of the vectors that are available for gene transfer in the present context, adenovirus offers several advantages. It
BMP-12 gene transfer on rat Achilles tendon healing M Majewski et al
is straightforward to prepare at high titers, and transgenes are typically expressed at high levels when a strong viral promoter is used. The virus does not integrate into the DNA and transgene expression in vivo usually persists for up to 6 weeks, which may appear well suited to sustain the endogenous repair process. Although direct injection of adenovirus vectors into tendons and ligaments successfully transduces the cells within them, these tissues have low cellularity and the net production of the transgene will therefore be low. Moreover, after rupture of the tendon or ligament, the cell population in and around the lesion will fluctuate. To obviate these limitations, we have used a novel delivery method using transduced, isogenic muscle biopsies (isograft). Taking advantage of the ability of adenovirus to transduce skeletal muscle, this abbreviated ex vivo procedure introduces no vector directly into the body, thereby enhancing safety and reducing immunogenicity. The aim of our study was to evaluate the histological and biomechanical effects of this new approach on the healing of rat Achilles tendons using an experimental transection model.
Results Expression of BMP-12 following adenoviral delivery To demonstrate the activity of the Ad.BMP-12 vector, C3H10T1/2 cells were infected with 0, 1 103 or 1 104 viral particle (vp) per cell virus and 4-day conditioned media examined for BMP-12 secretion by Western blot. As shown in Figure 1a, immunoreactive proteins of the same molecular weight as recombinant BMP-12 were produced after viral transduction in a dose-dependent manner. The ability of the vector to transduce muscle and express BMP-12 in vivo was confirmed by implanting adenovirus carrying the human BMP-12 cDNA(Ad.BMP-12) transduced muscle grafts subcutaneously, recovering these grafts after 3 days and analyzing the total RNA isolate by reverse transcriptase-PCR. Viral transduction visibly enhanced the abundance of BMP-12 transcripts relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Figure 1b). Biomechanical testing The maximum failure load of a normal rat Achilles tendon was found to be 60–80 N. All tendons, whether exposed to Ad.BMP-12-transduced muscle grafts or not, attained this value after 2 weeks through endogenous healing processes (Figure 2). However, tendons exposed to Ad.BMP-12-transduced muscle grafts showed significantly greater strength (P ¼ 0.0379) than controls at 1 week (Figure 2). All tendons reached normal or greater than normal strength at 4 and 8 weeks. The stiffness of normal tendons was found to be 36–86 N mm1. Tendon stiffness was significantly higher in rats exposed to Ad.BMP-12-transduced muscle grafts at 1, 2 and 4 weeks (Figure 3) and reached the normal range of values by 2 weeks. Control tendons, in contrast, only achieved normal stiffness values after 8 weeks. Tendon thickness During inspection at 1 week, tendons exposed to Ad.BMP-12-transduced muscle grafts appeared to be Gene Therapy
1
2
3
4 ~20 kDa
1
2
3 200 bp
Control
200 bp
Ad.BMP-12
BMP-12 per GAPDH (Arbitrary Units)
1140
2
1
0 Control
Ad.BMP-12
Figure 1 Expression of BMP-12 following transduction with Ad.BMP-12. (a) Western blot of conditioned medium. C3H10T1/2 cells were transduced with 0 (lane 2), 1 103 (lane 3) or 1 104 (lane 4) viral particles Ad.BMP-12 per cell and cultured in low-serum medium. After 4 days, conditioned medium was collected, diluted with 2X Laemmli buffer and run alongside 50 ng recombinant murine BMP-12 (lane 1). Probing the resulting blots using a polyclonal anti-human BMP-12 antibody, a prominent band at 15– 20 kDa was detected for the high dose of adenovirus. (b) RT-PCR of muscle transduced with Ad.BMP-12. Muscle flaps were transduced with a saline solution containing 1 109 viral particles Ad.BMP-12, which were then implanted subcutaneously as described in the Materials and methods. After 3 days, RNA was extracted from muscle flap explants and resulting cDNA samples were probed for human BMP-12 (177 bp) and rat GAPDH (200 bp) sequences. The resulting agarose gel bands were imaged and analyzed by densitometry, and BMP-12 band intensities are presented relative to GAPDH intensity. Ad.BMP-12, adenovirus carrying the human BMP-12 cDNA; BMP-12, bone morphogenetic protein 12; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcriptase-PCR.
N 140 120 100 P=0.0379 *
80 60 40 20 0
1 week
l l le ro scle -12 ro 12 nt usc PP u M BM Co M BM
nt
Co
2 weeks
4 weeks
8 weeks
l l le ro scle -12 ro 12 nt usc PP u M BM Co M BM
nt
Co
Figure 2 Effect of BMP-12 cDNA delivery on the maximum load to failure of rat Achilles tendon at progressive times after transection. The thick horizontal bars within each box indicate the median, the top and bottom of each box indicate the upper quartile and the lower quartile, and the outer bars show the highest and lowest values that were measured. Statistical significance is indicated by an asterisk. The range of load to failure values for uninjured rat Achilles tendon is shown in bold on the y-axis. BMP-12, bone morphogenetic protein 12.
BMP-12 gene transfer on rat Achilles tendon healing M Majewski et al
1141 mm
N/mm 125
6
P=0.017 P=0.0175
100
*
P=0.014
* P=0.0253
5
*
P= 0.0006
* *
4
75
3
P=0.0262
50
*
2
25 1
0
2 weeks
1 week
nt
l ro
Co
2 cle -1 us MP M B
r
nt
Co
ol
2 cle -1 us MP M B
8 weeks
ol
ol
r
nt
Co
4 weeks
2 cle -1 us MP M B
r
nt
Co
2 cle -1 us MP M B
Figure 3 Effect of BMP-12 cDNA delivery on the stiffness of rat Achilles tendon at progressive times after transection. The thick horizontal bars within each box indicate the median, the top and bottom of each box indicate the upper quartile and the lower quartile, and the outer bars show the highest and lowest values that were measured. Statistical significance is indicated by an asterisk. The range of load to failure values for uninjured rat Achilles tendon is shown in bold on the y-axis. BMP-12, bone morphogenetic protein 12.
much larger and in a more advanced state of healing. Tendon thickness, measured with precision calipers at the former site of tendon injury, confirmed that tendons in the BMP-12 group were thicker than controls at this time (Figure 4). Thereafter, the tendons in the BMP-12 group reduced in thickness by 8 weeks and became smaller than controls. Normal tendon thickness was measured as 1.6–2.1 mm (Figure 4). All operated tendons were thicker than normal at all time points.
Histology Histological examination showed a much more organized and homogeneous pattern of collagen fibers over all time points in the BMP-12 group. The single fibrils as well as fibers grew to bigger bundles much earlier with a higher degree of collagen crimp than within the control groups. There was also an earlier shift from fibroblast to fibrocytes with fewer fat cells within the BMP-12 group compared with the controls (Figure 5). However, after 8 weeks, there was one tendon with an enchondral ossification at the experimental group. No unexpected signs of inflammation were seen within the BMP-12 group compared with controls at all time points. Cross polarization microscopy Examination of tendons stained with sirius red and then viewed by polarized light microscopy showed initially a loose connective tissue matrix within the repair site. After 2 weeks, the matrix from the group exposed to Ad.BMP-12-transduced muscle grafts began to organize into a more structured matrix as shown by the presence of a greater number of fibrils staining red-orange. This process continued in the BMP-12 group for the entire 8 weeks of the experiment (Figures 6 and 7). Remodeling of the matrix was much slower in the control groups and
0
1 week l e ro cl -12 P nt us o M C BM
2 weeks l e ro cl -12 P nt us o M C BM
4 weeks l e ro cl -12 P nt us o M C BM
8 weeks l e ro cl -12 P nt us o M C BM
Figure 4 Effect of BMP-12 cDNA delivery on the thickness of the repair site in the rat Achilles tendon. The thick horizontal bars within each box indicate the median, the top and bottom of each box indicate the upper quartile and the lower quartile, and the outer bars show the highest and lowest values that were measured. Statistical significance is indicated by an asterisk. The range of load to failure values for uninjured rat Achilles tendon is shown in bold on the y-axis. BMP-12, bone morphogenetic protein 12.
a higer amount of thinner, green-staining fibers persisted at 8 weeks (Figures 6 and 7).
Discussion Although the human Achilles tendon has the capacity to repair spontaneously, this process fails to regenerate authentically; the repaired tendon is weaker than normal, and thus prone to rerupture. Moreover, the imperfections of endogenous repair often leave the patient symptomatic and unable to return to full activity. The gene transfer approach described in this paper offers a novel way to accelerate tendon repair and improve the quality of the repair tissue. A genetically modified muscle graft served as a convenient vehicle for ex vivo gene delivery to a site that is otherwise difficult to target. As a result of this gene transfer, the severed Achilles tendons healed more rapidly and more completely than controls. This was signaled by an increase in strength at 1 week and an increase in stiffness at weeks 1, 2 and 4. These changes correlated with accelerated collagen maturation within the matrix. The early stages of tendon healing involve the formation of a large callus that gets resorbed as healing progresses. As shown in Figure 4, treatment of the BMP12 cDNA muscle graft produces an enlarged callus at 1 week that, unlike that of controls, is undergoing resorption by week 8. If pertinent to an eventual clinical application of this technology, the collective data suggest that patients treated in this manner might be able to return to normal activities at an earlier time than is presently prudent, with a lower risk of rerupture. These findings agree well with those of Lou et al.15 who noted that transfer of BMP-12 cDNA improved Gene Therapy
BMP-12 gene transfer on rat Achilles tendon healing M Majewski et al
1142 Ratio: red-orange/pale-green
Control Muscle BMP12
11 10 9 8 7 6 5 4 3 2 1 0 1 week
2 weeks
4 weeks
8 weeks
Figure 6 Effect of BMP-12 cDNA delivery on collagen fiber thickness ratio. The ratio of thick fibers (stained red-orange under sirius red-polarized light microscopy) to thin fibers (stained green under sirius red-polarized light microscopy) was calculated at each time point. (control group: light gray line (median), light gray area (minimum and maximum values); muscle group: dark gray line (median), dark gray area (minimum and maximum values); BMP-12 group: black line (median), black area (minimum and maximum values)). BMP-12, bone morphogenetic protein 12.
Figure 5 Effect of BMP-12 cDNA delivery on the histologic appearance of the repair site in the rat Achilles tendon. Sections were made from tendons recovered 4 weeks after surgery and stained with hematoxylin and eosine. Repair tissue formed in the presence of BMP-12 (panel 3) appears more structured, with a more developed crimp pattern and bigger collagen bundles than controls (panels 1 and 2). The tissue is also less woven (panel 2) with less fibroblasts and fat cells (panel 1). Magnification: 200. BMP-12, bone morphogenetic protein 12.
Gene Therapy
healing in a chicken digital flexor tendon laceration model. Like us, these authors used a first generation adenovirus vector for gene transfer but, unlike us, they delivered the transgene to the healing tendon by direct, in vivo injection. They found a twofold increase in ultimate force and stiffness between tendons receiving direct Ad.BMP-12 injections into the tendon compared with controls.16 At least a part of the improvement in the mechanical properties of tendon repair noted in the presence of BMP-12 may be accounted for by the increased representation of larger collagen fibers. The small collagen fibers noted at early times after tendon transection, which appear green under sirius red-polarized light microscopy, are likely to comprise type III collagen, which correlate inversely with tensile strength. Maturation of the repair tissue involves the replacement of these small fibrils with large fibers of type I collagen that stain red-orange under sirius red-polarized light microscopy. These collagen I fibers impart high tensile strength. Of interest, Lou et al.,16 noted that type I collagen synthesis was increased 30% by tendon cells transduced in vivo with an Ad.BMP-12 construct. In this regard, it is relevant to note the reduction of collagen fibril size within the Achilles tendons of GDF-7/BMP-12 deficient mice, as reported by Mikic et al.20 Enchondral ossification seen after 8 weeks is a well-known phenomenon during rat Achilles tendon healing and therefore may not be related to BMP-12.21 However, one weakness of this study is the absence of a control group of rats that received an empty adenovirus vector. This would have provided information on responses that were triggered by the adenovirus rather than the transgene. Overall, our study and data from the literature strongly suggest that BMP-12 has a beneficial effect on the healing of the Achilles tendon. Of particular value is the ability of gene transfer to achieve the local, sustained synthesis of this growth factor, or other regenerative gene
BMP-12 gene transfer on rat Achilles tendon healing M Majewski et al
products, within or around the site of injury. Although we used an adenovirus-based delivery system, others have successfully employed naked DNA, liposomes, retrovirus, adeno-associated virus and herpes simplex virus to deliver genes to a variety of different ligaments and tendons. Moreover, there are a number of additional candidate cDNAs whose expression might improve tendon healing. These include GDF-5,22 BMP-14,23 FGF-224 and PDGF.25 Rickert et al.22 injected an adenovirus carrying GDF-5 (Ad.GDF-5) into the proximal tendon stump of transected rat Achilles tendons. This adenovirus treatment caused maximum GDF-5 expression at week 4. Tendon regenerate thickness, assessed at week 8, was greater than that of control tendons and GDF-5-treated tendons tended to have higher tensile strength. It is conceivable that GDF-5 expression would occur earlier if the Ad.GDF-5 construct was introduced by way of muscle graft, thereby causing better tendon strengths and allowing regenerate remodeling to occur as it did with our approach. Bolt et al.23 injected an adenovirus carrying BMP-14 at the site of the repaired tendon. With this procedure, a significantly increased tensile strength was apparent at week 2. Even though no adverse immunological response to the adenoviral vector occurred, introducing the virus by muscle graft would minimize such risk when used in humans. Other growth-factor-bearing viral constructs have been described that carry the bFGF or PDGF gene, respectively.24,25 As these vectors increased growth factor expression in tenocytes in vitro, they would likely enhance Achilles tendon healing in vivo. These viral vectors should be evaluated using the muscle graft approach described to minimize any potential adverse effects to virus that is directly administered to patients. There may also be value in transferring a cDNA encoding BMP-12 to promote differentiation along ligamentogenic lineages, in combination with cDNAs encoding transforming growth factor-b or some other strong inducer of connective tissue synthesis and deposition. The method we have developed for abbreviated ex vivo gene delivery using transduced muscle grafts has several functional advantages including practicability and potential for easy intraoperative use.
1143
Materials and methods
Figure 7 Appearance of the repair site, examined by sirius redpolarized light microscopy, 8 weeks after transection in the presence or absence of BMP-12. Sections were made from tendons recovered 8 weeks after surgery and stained with sirius red. Under these optics, large collagen fibers stain orange red, and small fibrils stain green. Remodeling of the matrix was much slower in the control groups (panels 1 and 2) and a greater representation of thinner, green-staining fibers persisted compared to a greater number of mature red-orange fibers at the BMP-12 group (panel 3). Magnification: 400. BMP-12, bone morphogenetic protein 12.
Study design The animal study was performed at Harvard Medical School, Boston, USA according to an experimentation protocol approved by HMA Standing Committee on Animals. One hundred and thirty-two adult male Sprague–Dawley rats, each weighing 400–425 g, were used in this study. Two animals were housed in a cage. Each group contained 40 rats. The first group of 40 animals (surgical control) received neither vector nor DMEM-incubated muscle graft after transection and surgery of the tendon. The second group (muscle control) did not receive virus but did receive a DMEM-incubated muscle graft after transection and repair of the tendon. The third group (Ad.BMP-12 group) received a DMEMincubated muscle graft transduced with a first generaGene Therapy
BMP-12 gene transfer on rat Achilles tendon healing M Majewski et al
1144
tion, serotype 5 recombinant adenovirus, carrying the human BMP-12 cDNA after transection and repair of the tendon. Ten rats were killed 1, 2, 4 and 8 weeks post surgery. Seven animals were used for biomechanical testing and three animals for histological examination. Twelve donor rats were used for muscle harvesting to confirm the ability of the vector, to transduce muscle and express BMP-12 in vivo as well as biomechanical testing of normal Achilles tendon.
Vector preparation A first generation, serotype 5 recombinant adenovirus, carrying the human BMP-12 cDNA under the transcriptional regulation of the human cytomegalovirus immediate early promoter (Ad.BMP-12) was kindly provided by Wyeth Pharmaceuticals (Cambridge, MA, USA). The virus was amplified by propagation in 293 cells using standard protocols and purified by three rounds of banding by cesium chloride centrifugation. Optical density measurements were used to estimate viral titers. A viral preparation containing 1012 vp ml1 was used for this study. The activity of the vector was confirmed by infection of murine C3H10T1/2 cells (American Type Tissue Culture, Manassas, VA, USA). Briefly, cells at subconfluence were transduced for 2 h in serum-free DMEM with 0, 1 103 or 1 104 vp per cell Ad.BMP-12 and cultured in low-serum DMEM (0.2% fetal bovine serum). After 4 days, conditioned medium was collected and diluted 1:2 with 2 Laemmli buffer (Bio-Rad, Hercules, CA, USA). Sample aliquots (50 ml) were resolved alongside 50 ng recombinant murine BMP-12 (in non-conditioned medium; R&D Systems, Minneapolis, MN, USA) on 15% polyacrylamide gels and transferred to a polyvinylidene difluoride membrane. Blots were blocked with 5% milk in Tris-buffered saline containing 0.1% Tween-20 for 30 min and immunodetection was achieved by overnight incubation (4–8 1C) with a rabbit anti-human BMP-12 (Wyeth #L7024) diluted 1:500 in blocking buffer. Blots were subsequently incubated with HRP-conjugated goat anti-rabbit immunoglobulin G (Chemicon, Temecula, CA, USA) diluted 1:5000 in blocking buffer, and antibody levels were visualized using Western Lighting Chemiluminescence Reagent (PerkinElmer, Waltham, MA, USA). Transduction of muscle To confirm the ability of the vector to transduce muscle and express BMP-12 in vivo, muscle flaps were incubated with 1 109 vp Ad.BMP-12 in saline and implanted subcutaneously into the same rats. Three days later, the animals were euthanized and the transduced muscle flap was excised. Following homogenization in TRI Reagent (Ambion, Austin, TX, USA), RNA was isolated by phenol/chloroform extraction. One microgram aliquots of RNA were reverse transcribed using a Superscript II First Strand Synthesis kit (Invitrogen, Carlsbad, CA, USA), following instructions for oligo(dT)-primed synthesis. The resulting cDNAs were used for PCR with reagents from a Taq PCR Master Mix kit (Promega, Madison, WI, USA). Primer pairs specific for cDNAs encoding human BMP-12 (GenBank accession number NM_182828) and GADPH (GenBank number NM_002046) were formulated using the Primer 3 web interface (http://primer3.sourceforge.net/). The primer Gene Therapy
sequences and corresponding target sizes are as follows: BMP-12 forward ¼ TGGACTACGAGGCGT ACCAC, BMP-12 reverse ¼ CGTCGATGTAGAGGATG CTG, BMP-12 product size 177 bp; GAPDH forward ¼ ACCCAGAAGACTGTGGATGG, GAPDH reverse ¼ TC TAGACGGCAGGTCAGGTC, GAPDH product size ¼ 200 bp. Target templates were amplified using the following protocol: initial denaturation ¼ 95 1C for 5 min; 30 thermal cycles ¼ 95 1C for 1 min, 56 1C for 1 min, 72 1C for 30 s; final elongation ¼ 72 1C for 10 min. PCR products were resolved on 1.8% agarose gels, stained in 1 mM ethidium bromide and imaged on Kodak Gel Image Station 2000 MM (Eastman Kodak, Rochester, NY, USA). BMP-12 band intensities were measured by densitometry using ImageJ software (http://rsb.info. nih.gov/ij/) and normalized by corresponding GAPDH bands. Skeletal muscle tissue was harvested with a round punch of 4-mm diameter from a donor rat 3 days before Achilles tendon surgery. To transduce the muscle discs, 5 1011 particles of Ad.BMP-12 were dropped on the surface of the muscle and allowed to incubate in 1 ml DMEM medium containing 5% fetal bovine serum in 24well plates for 24 h.
Surgical procedure Rats were placed under general anesthesia by the administration of isofluorane with a small animal anesthesia machine. The animals then received intramuscular injections of 20 mg kg1 Cefazolin (an antibiotic) and 0.03–0.06 mg kg1 buprenorphine (analgesic) into the left thigh. Each animal’s right hind leg was shaved and disinfected with Betadine-Scrub 3x using aseptic techniques and rinsed with 70% alcohol. Subsequently, it was placed in a sterile field on a heated surgery table and covered with a sterile surgical drape such that only the prepared limb was exposed. A 3 cm incision was made above the right Achilles tendon. The superficial Achilles tendon was exposed. The peritendon was opened and the tendon transected with a No. 15 scalpel blade perpendicular to the collagen fibers, creating a 5 mm gap proximal to the calcaneal insertion of the tendons. The plantar tendon was transected to prevent an internal splint phenomenon. After transection, the Achilles tendon was sutured back together with PDS II 0–2 with a Kessler– Kirchmeyer stitch. The muscle graft for groups two and three was placed with two single stitches with PDS II 0–5 around the side of tendon injury after end-to-end suture repair. The subcutaneous layer and the skin were closed by continuous suture technique with prolene 0–4. Postoperative treatment The animals woke up on a heating pad to aid the return to normal body temperature. During the subsequent 3 days, each animal received a 20 mg kg1 intramuscular injection of cefazolin twice per day, and a 0.06 mg kg1 intramuscular injection of buprenorphine twice per day. For the duration of the experiment, all animals were monitored for signs of pain and infection. Pain was indicated by tenderness, lack of locomotion and/or vocal distress. The animals were fed rat chow and water ad libitum. No cast or dressing was applied and the animals were allowed unrestricted cage movement.
BMP-12 gene transfer on rat Achilles tendon healing M Majewski et al
Sacrifice Groups of animals were killed after 7, 14, 28 and 56 days. Each animal was euthanized by CO2 asphyxiation under general anesthesia and subsequent bilateral thoracotomy. Rats were exposed to CO2 from cylinders and remained within the container for several minutes after breathing ceased. Muscle-Achilles tendon-bone units were harvested by transection of the middle part of the gastrocnemius muscle and of the calcaneus. Mechanical testing The muscle-tendon-bone-unit were wrapped in cotton gauze soaked in lactated Ringer’s solution and stored at 20 1C before testing. On the day of testing, the specimens were thawed in Ringer’s solution for 4 h. Before testing, tendon thickness was measured with a precision caliper at the site of tendon repair. The muscle-tendonbone-unit were fastened in the clamping device by freezing the muscular segment between the cryo-jaws and by fixing the bony segment between the copper clamp.17 The clamping device was attached to an electrohydraulic materials testing machine (Fa. Zwick, Einsingen-Ulm, Germany). The tendons were not preconditioned or cyclically stretched before tensile testing. The room temperature was kept constant at 25 1C (77 1F). To prevent the specimens from dehydrating, they were kept moist with Ringer’s solution. Both reservoirs of the cryo-jaws were filled with liquid nitrogen. The experiment was started as soon as the expansion of the freezing zone reached the border of the metal clamp but did not extend into the tendon substance or into the repair site (registered manually with a metal needle). The displacement rate was set at 1000 mm min1. Force-displacement curves were recorded and transferred to an IBMcompatible computer for subsequent data analysis. Load to failure (N) (peak of the curve) and stiffness (N mm1) were measured. Histology Three specimens per group were examined histologically at each time point. The tendons were immediately fixed in 4% buffered formalin (pH 7.4) for 24 h, dehydrated and embedded in paraffin wax. Longitudinal sections (5 mm) at the midsubstance of the tendon were stained with hematoxylin and eosin. Cross polarization microscopy For cross polarization microscopy, 5 mm sections were stained for 1 h in picrosirius solution (0.1%. solution of sirius red F3BA in saturated aqueous picric acid, pH 2) according to the method of Junqueira.18 The sections were washed for 2 min in 0.01 N hydrochloric acid, dehydrated, cleared and mounted in synthetic resin. To analyze collagen ratios, tissue samples were observed under polarized light microscopy. Thicker mature collagen fibers, including type I collagen fibers, appeared red-orange, whereas thinner collagen fibers, including type III collagen) appeared pale-green.19 For each sample, five regions (center of tendon, left border, right border, 2 mm above tendon center and 2 mm below tendon center) within the interface (400 , area 100 100 mm) were captured by a digital camera (Olympus C-3030, Hamburg, Germany). Collagen ratios were obtained by measuring the area of thicker mature
red-orange versus thinner pale-green using a digital image analyzing software (Image-Pro Plus, Media Cybernetics, Silver Spring, MD, USA). Results are expressed as ratio of area of collagen.
1145
Statistics The Mann–Whitney test was used to test statistically significant differences between the cohorts. The level of significance was set to Pp0.05.
Acknowledgements This work was supported by Swiss National Science Foundation (310000-112033). We are grateful to Mrs H Schaller and Mrs C Pilapil for histology preparation, Dr H Clahsen and Mrs E Krott for assistance during histology examination, PD Dr L Du¨rselen for help during biomechanical testing, R Flu¨ckiger Ph.D. for critical reading the paper and Wyeth Pharmaceuticals (Cambridge MA) for kindly providing the adenovirus carrying the human BMP-12 cDNA.
References 1 Jozsa L, Kvist M, Balint BJ, Reffy A, Jarvinen M, Letho M et al. The role of recreational sport activity in Achilles tendon rupture. A clinical, pathoanatomical and sociological study of 292 cases. Am J Sports Med 1989; 17: 338–343. 2 Richter J, Pommer A, Hahn M, Da´vid A, Muhr G. Mo¨glichkeiten und Grenzen der funktionell konservativen Therapie akuter Achillessehnenrupturen. Chirurg 1997; 68: 517–524. 3 Schepsis AA, Jones H, Haas AL. Achilles tendon disorders in athletes. Am J Sports Med 2002; 30: 287–305. 4 Suchak AA, Spooner C, Reid DC, Jomha NM. Postoperative rehabilitation protocols for Achilles tendon ruptures: a metaanalysis. Clin Orthop 2006; 445: 216–221. 5 Majewski M, Rickert M, Steinbru¨ck K. Die frische Achillessehnenruptur. Eine prospektive Untersuchung zur Beurteilung verschiedener Therapiemo¨glichkeiten. Orthopa¨de 2000; 29: 670–676. 6 Majewski M, Widmer KH, Steinbru¨ck K. Die Achillessehnenruptur—Erfahrungen aus 25 Jahren sportorthopa¨discher Behandlung. Sportver Sportsch 2002; 4: 1–7. 7 Majewski M, Lehmann M, Dick W, Steinbru¨ck K. Wertigkeit der sonographische Heilungsverlaufskontrolle nach Achillessehnenrupturbehandlung—Vergleich konservative Therapie, perkutanen und offene Naht. Unfallchirurg 2003; 106: 556–560. 8 Majewski M, Rohrbach M, Czaja St, Ochsner P. Avoiding sural nerve injuries using percutaneous Achilles tendon repair. Am J Sports Med 2006; 34: 793–798. 9 Chan BP, Chan KM, Mafulli N, Webb S, Lee KK. Effect of basic fibroblast growth factor: an in vitro study of tendon healing. Clin Orthop 1997; 342: 239–247. 10 Duffy FJ, Seiler JG, Gelberman RH, Hergrueter CA. Growth factors and canine flexor tendon healing: initial studies in uninjured and repair models. J Hand Surg 1995; 20: 645–649. 11 Evans CH. Cytokines and the role they play in the healing of ligaments and tendons. Sports Med 1999; 28: 71–76. 12 Ducy P, Karsenty G. The family of bone morphogenetic proteins. Kidney Int 2000; 57: 2207–2214. 13 Wolfman NM, Hattersley G, Cox K, Celeste AJ, Nelson R, Yamaji N et al. Ectopic induction of tendon and ligament in rats by growth and differentiation factors 5, 6, and 7, members of the TGF-beta gene family. J Clin Invest 1997; 100: 321–330. Gene Therapy
BMP-12 gene transfer on rat Achilles tendon healing M Majewski et al
1146 14 Wang QW, Chen ZL, Piao YJ. Mesenchymal stem cells differentiat into tenocytes by bone morphogenetic protein (BMP) 12 gene transfer. J Biosci Bioeng 2005; 4: 418–422. 15 Lou J, Tu Y, Ludwig FJ, Zhang J, Manske PR. Effect of bone morphogenetic protein-12 gene transfer on mesenchymal progenitor cells. Clin Orthop Relat Res 1999; 369: 333–339. 16 Lou J, Tu Y, Burns M, Silva MJ, Manske P. BMP-12 gene transfer augmentation of lacerated tendon repair. J Orthop Res 2001; 19: 1199–1202. 17 Wieloch P, Buchmann G, Roth W, Rickert M. A cryo-jaw designed for in vitro tensile testing of the healing Achilles tendons in rats. J Biomechanics 2004; 37: 1719–1722. 18 Janqueira LC, Bignolas G, Brentani RR. Picrosirus staining plus polarization microscopy, a specific method for collagen detection in tissue sections. Histochem J 1979; 11: 447–455. 19 Junquera LC, Crossermelli W, Brentani R. Differential staining of collagens type II I, and II by Sirius Red and polarization microscopy. Arch Histol Jpn 1978; 41: 267–274.
Gene Therapy
20 Mikic B, Bierwert L, Tsou D. Achilles tendon characterization in GDF-7 deficient mice. J Orthop Res 2006; 24: 831–841. 21 Rooney P, Gant ME, McClure J. Endochondral ossification and de novo collagen synthesis during repair of rat Achilles tendon. Matrix 1992; 12: 274–281. 22 Rickert M, Wang H, Wieloch P, Lorenz H, Steck E, Sabo D et al. Adenovirus-mediated gene transfer of growth and differentiation factor-5 into tenocytes and the healing rat Achilles tendon. Connect Tissue Res 2005; 46: 175–183. 23 Bolt P, Clerk AN, Luu HH, Kang Q, Kummer JL, Deng ZL et al. BMP14 gene therapy increases tendon tensile strength in a rat model of Achilles tendon injury. J Bone Joint Surg Am 2007; 89: 1315–1320. 24 Wang XT, Liu PY, Xin KQ, Tang JB. Tendon healing in vitro: bFGF gene transfer to tenocytes by adeno-associated viral vectors promotes expression of collagen genes. J Hand Surg Am 2005; 30: 1255–1261. 25 Wang XT, Liu PY, Tang JB. Tendon healing in vitro: genetic modification of tenocytes with exogenous PDGF gene and promotion of collagen gene expression. J Hand Surg Am 2004; 29: 884–890.
