INFECTION AND IMMUNITY, Oct. 2005, p. 6283–6289 0019-9567/05/$08.00⫹0 doi:10.1128/IAI.73.10.6283–6289.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 73, No. 10
Enteropathogenic Escherichia coli Type III Effectors EspG and EspG2 Alter Epithelial Paracellular Permeability Takeshi Matsuzawa,1,2 Asaomi Kuwae,1,2 and Akio Abe1,2* Laboratory of Bacterial Infection, Kitasato Institute for Life Sciences, Kitasato University, 5-9-1, Shirokane, Minato-ku, Tokyo 108-8641, Japan,1 and The Kitasato Institute, 5-9-1, Shirokane, Minato-ku, Tokyo 108-8642, Japan2 Received 7 January 2005/Returned for modification 3 March 2005/Accepted 2 June 2005
Enteropathogenic Escherichia coli (EPEC) delivers a subset of effectors into host cells via a type III secretion system. Here we show that the type III effector EspG and its homologue EspG2 alter epithelial paracellular permeability. When MDCK cells were infected with wild-type (WT) EPEC, RhoA was activated, and this event was dependent on the delivery of either EspG or EspG2 into host cells. In contrast, a loss of transepithelial electrical resistance and ZO-1 disruption were induced by infection with an espG/espG2 double-knockout mutant, as was the case with the WT EPEC, indicating that EspG/EspG2 is not involved in the disruption of tight junctions during EPEC infection. Although EspG- and EspG2-expressing MDCK cells exhibited normal overall morphology and maintained fully assembled tight junctions, the paracellular permeability to 4-kDa dextran, but not the paracellular permeability to 500-kDa dextran, was greatly increased. This report reveals for the first time that a pathogen can regulate the size-selective paracellular permeability of epithelial cells in order to elicit a disease process. sulted in an increase in paracellular diffusion of a low-molecular-weight tracer without any accompanying loss of transepithelial electrical resistance (TER). Certain pathogenic bacteria and viruses trigger the disruption of TJs during infection, and enteropathogenic Escherichia coli (EPEC) also has the ability to induce dysfunction of the barrier function by exploitation of the type III secretion system
Epithelial cells interact with each other and with the underlying extracellular matrix using a molecular structure composed of transmembrane proteins and distinct sets of cytoplasmic plaque proteins that serve as connections to the cytoskeleton (5, 22). Tight junctions (TJs) are the most apical of the intercellular junctions, and they regulate selective paracellular diffusion and restrict the intermixing of apical and basolateral membranes. TJs are comprised of membrane proteins, such as occludin, claudins, and members of immunoglobulin (Ig) superfamilies JAM and CAR, and cytoplasmic plaques consisting of many different proteins that interact among themselves and interconnect the transmembrane proteins to form large complexes. Junctional plaques are formed by different types of proteins that include adapters, such as the ZO proteins, and signaling components, such as small GTPases. The membrane proteins mediate cell adhesion and are thought to constitute the intramembrane and paracellular diffusion barriers. The actin cytoskeleton plays a crucial role in the regulation of TJs by mechanisms that involve the regulation of cortical actin contraction and direct interactions between the actin cytoskeleton and certain TJ components. Rho family GTPases, such as RhoA, Rac1, and Cdc42, are central regulators of the actin cytoskeleton (15). Recently, the participation of Rho family GTPases in TJ assembly and function has been reported (2, 4). The effect of RhoA activation on TJs covers a wide spectrum of effects and appears to depend on the extent of activation. For example, the overexpression of constitutively active RhoA has been shown to cause structural and functional damage to TJs (17). However, RhoA stimulation via a transfected prostaglandin receptor (16) or by overexpression of guanine nucleotide exchange factor H1 (GEF-H1) (3) re-
FIG. 1. EspG2 was secreted via the TTSS. (A) Whole-cell lysates (Whole) or secreted proteins (Sup.) of the EPEC WT strain or mutants of this strain were subjected to SDS-PAGE. The total proteins were then stained with Coomassie brilliant blue (left panel) or subjected to Western blot analysis (WB) with anti-EspG2 antibodies (right panel).
* Corresponding author. Mailing address: Laboratory of Bacterial Infection, Kitasato Institute for Life Sciences, Kitasato University, 5-9-1, Shirokane, Minato-ku, Tokyo 108-8641, Japan. Phone: 81-35791-6123. Fax: 81-3-5791-6125. E-mail:
[email protected]. 6283
6284
MATSUZAWA ET AL.
INFECT. IMMUN.
FIG. 2. EspG2 was injected into host cells via the TTSS. (A) Whole-cell lysates (Whole) (upper panel) or secreted proteins (Sup.) (lower panel) of the EPEC WT strain or mutants of this strain expressing TEM-1 fusion proteins were subjected to SDS-PAGE and Western blot analysis (WB) with anti-TEM-1 antibodies. (B) HeLa cells were infected with the EPEC WT strain or the espB mutant expressing different TEM-1 fusion proteins. After infection, the cells were stained with CCF2/AM, and then the cells were observed with a fluorescence microscope with a DAPI filter set.
(TTSS) (13, 26). When polarized epithelial cells were infected with EPEC, redistribution of the TJ-associated protein occludin was observed, and this redistribution was correlated with disruption of the TJ barrier (29, 33). Much has been reported about a TTSS that is engaged in the disruption of the epithelial barrier by EPEC (13). Furthermore, the type III effectors EspF and Map are known to be required for TJ disruption during EPEC infection (8, 24). On the other hand, we previously reported that EspG and its homologue Orf3 promote the destabilization of host microtubules (MTs), and EspG/Orf3 activates the RhoA signaling pathway via GEF-H1 activity (21). In this study, we demonstrated that the type III effectors EspG and Orf3 activate RhoA in MDCK monolayer cells. Moreover, both of these effectors are able to increase sizeselective epithelial paracellular permeability without disrupting the TJ architecture. Thus, EspG and Orf3, which is designated EspG2 here, alter the function of epithelial TJs as channels for paracellular fluxes. MATERIALS AND METHODS Bacterial strains, plasmids, and mammalian cell lines. The bacterial strains used in this study were EPEC O127:H6 strain E2348/69, which is a wild-type (WT) strain (20), and nonpolar mutants of this strain, including strains with
mutations affecting espB, escN, and espG/espG2 (21, 28). Plasmids p99-EspG and p99-EspG2 (21) were used for the complementation analysis. Plasmid pCX340 was kindly provided by Eric Oswald (6). Plasmid pBAD-DEST49 (Invitrogen, Carlsbad, CA) was digested with BbcI and SalI, and then the resulting DNA was self-ligated to obtain pBAD-DEST49⌬ccdB. A gene containing the attR1 and attR2 sites was amplified by PCR with primers 5⬘-GGAATTCCATATGCTGG GAATTATCACAAGTTTG-3⬘ and 5⬘-CGGGGTACCACCACTTTGTACAA GAAAGC-3⬘ and pBAD-DEST49⌬ccdB as the DNA template, and this DNA fragment was cloned into pCX340 digested with NdeI and KpnI to obtain pCX/attR. Briefly, each gene (i.e., cesT, orf19 [encoding Map], and espG2) was amplified by PCR with primers 5⬘-AAAAAGCAGGCTTCAGAGAACAACGT TGCAGC-3⬘ and 5⬘-AGAAAGCTGGGTATCTTCCGGCGTAATAATG-3⬘ (for cesT), primers 5⬘-AAAAAGCAGGCTCCTATAAATAGTGCTTGGAG G-3⬘ and 5⬘-AGAAAGCTGGGTACAGCCGAGTATCCTGCAC-3⬘ (for orf19), or primers 5⬘-AAAAAGCAGGCTTCTGTCTGCCAGAATTTAAG-3⬘ and 5⬘-AGAAAGCTGGGTTATTCCTCGAATATGCTTCAG-3⬘ (for espG2) and WT EPEC genomic DNA as the DNA template. Using a Gateway cloning system (Invitrogen), the DNA fragments were cloned into pCX/attR to obtain pCX-CesT, pCX-Map, and pCX-EspG2, respectively. The DNA fragments encoding full-length EspG or EspG2 with a C-terminal FLAG tag were amplified by PCR with primers 5⬘-AACTGCAGATGATACT TGTTGCCAAATTGTG-3⬘ and 5⬘-ACGCGTCGACCTACTTATCGTCGTCA TCCTTGTAATCCTCGAGAGTGTTTTGTAAGTACGTTTC-3⬘ (for EspG) or primers 5⬘-AACTGCAGATGATAAATGGCATTTCTCAAC⬘ and 5⬘-ACG CGTCGACCTACTTATCGTCGTCATCCTTGTAATCCTCGAGATTCCTC GAATATGCTTCAGATG-3⬘ (for EspG2) and WT EPEC genomic DNA as the DNA template. These DNA fragments were subcloned into the pBI-G Tet vector (Clontech, Palo Alto, CA) to obtain pBIG-EspG and pBIG-EspG2. These plas-
VOL. 73, 2005
EspG AND EspG2 ALTER PARACELLULAR PERMEABILITY
6285
mids were introduced into MDCK Tet-Off cells with pTK-Hyg (Clontech) by using Lipofectamine 2000 reagent (Invitrogen) to obtain stably transfected MDCK cell lines. Preparation of secreted proteins. Bacteria were grown in Dulbecco’s modified Eagle’s medium (DMEM) (GIBCO, Grand Island, N.Y.), and the proteins in the culture supernatants were precipitated by addition of trichloroacetic acid at a final concentration of 10%. After concentration by centrifugation, the pellets were suspended in sodium dodecyl sulfate (SDS) sample buffer and were subjected to SDS-polyacrylamide gel electrophoresis (PAGE). Western blot analysis was then carried out using anti-Orf3 (EspG2) antibodies and horseradish peroxidase (HRP)-conjugated protein A (Amersham Pharmacia Biotech, Piscataway, NJ). Proteins that immunoreacted specifically were visualized with the ECL system (Amersham Pharmacia). Infection and translocation assay. A translocation assay was performed as described previously (6). On the day before infection, HeLa cells were seeded on coverslips in six-well plates with DMEM containing 10% fetal calf serum. Overnight bacterial cultures were inoculated at a 1/100 dilution into DMEM containing 10% fetal calf serum. The bacteria were grown at 37°C for 3 h, and then the cells were infected with the bacteria. After 30 min, isopropyl--D-thiogalactopyranoside (IPTG) (1 mM) was added to the cultures, and the infection was allowed to proceed for an additional 1 h. The infected cells were then washed and stained with a CCF2/AM loading kit (Invitrogen). The cells were then observed with a Zeiss fluorescence microscope with a 4⬘,6⬘-diamidino-2-phenylindole (DAPI) filter set (365-nm excitation and 397-nm long-pass emission). TER and immunofluorescence staining. TER measurements for MDCK monolayers grown on 24-well Transwell filters were obtained using a MillicellERS (Millipore Corporation, Bedford, MA). For immunofluorescence staining, the cells were fixed with 3% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min and were permeabilized with 0.5% Triton X-100 in PBS for 5 min. In addition, anti-ZO-1 antibodies and anti-claudin-1 antibodies (both obtained from Zymed Laboratories, South San Francisco, CA), as well as antiFLAG antibodies (Sigma, St. Louis, MO), were used. The cells were visualized using Alexa 488-conjugated anti-rabbit IgG and Alexa 594-conjugated antimouse IgG (both obtained from Molecular Probes, Eugene, OR) as the secondary antibodies. GST-RBD pull-down assay. MDCK cells were seeded and cultured for 24 h. The cells were washed with serum-free DMEM and were then incubated in the same medium for 2 days at 37°C. The cells were infected with the EPEC WT strain or mutants of this strain for 3 h. The cells were then lysed in RIPA buffer (50 mM Tris, pH 7.5, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 500 mM NaCl, 10 mM MgCl2, 10 g/ml of leupeptin, 10 g/ml of aprotinin, 1 mM phenylmethylsulfonyl fluoride [PMSF]). The GTP-bound RhoA was coprecipitated with the glutathione S-transferase (GST)-fused Rho-binding domain (RBD) of rhotekin (GST-RBD). The amount of RhoA was analyzed by Western blotting using anti-RhoA antibodies (26C4; Santa Cruz Biotechnology, Santa Cruz, CA) and HRP-conjugated antibodies against mouse IgG. The intensity of bands was quantified using the NIH Image software. Analysis of TJ function and transcytosis. MDCK Tet-Off or stably transfected MDCK cells were plated on 24-well Transwell filters and were cultured for at least 7 days in the presence of 1 g/ml of doxycycline (Clontech, Palo Alto, CA). After this culture period, all transfected cell lines exhibited stable TER values that did not significantly change from one day to the next. In order to express EspG or EspG2, the cells were further incubated in the absence of doxycycline for 24 h. The expression levels of FLAG-tagged EspG and EspG2 were confirmed by immunofluorescence staining with anti-FLAG antibodies and Alexa 594-conjugated anti-mouse IgG. Analysis of TJ functions and transcytosis were performed as described previously (1, 3). Fluorescein isothiocyanate (FITC)dextran of various sizes, HRP (Sigma, St. Louis, MO), or epidermal growth factor (EGF) (Sigma) was dissolved in P buffer (10 mM HEPES, pH 7.4, 1 mM sodium pyruvate, 10 mM glucose, 3 mM CaCl2, 145 mM NaCl) or P/EGTA buffer [10 mM HEPES, pH 7.4, 1 mM sodium pyruvate, 10 mM glucose, 145 mM
FIG. 3. EspG/EspG2 induced RhoA activation without TJ disruption. (A) MDCK cells were infected with the EPEC WT strain or mutants of this strain for 3 h in the presence or absence of taxol (5 M). The cells were lysed, and the GTP-bound RhoA, the active form of RhoA, was coprecipitated with GST-RBD. The amount of RhoA bound to RBD and RhoA in the whole-cell lysates was analyzed by Western blotting with anti-RhoA antibodies. The intensity of bands
was quantified using the NIH Image software, and the results are expressed as fold increases in the band for active RhoA in nonstimulated cells. (B) TER of polarized MDCK monolayers which were infected with the EPEC WT strain, the escN mutant, or the espG/ espG2 mutant or were not infected. The values are means ⫾ standard deviations for three independent experiments. (C) MDCK monolayers were infected with the EPEC WT strain or mutants of this strain for 3 h, and then the cells were fixed and stained with anti-ZO-1 antibodies.
6286
MATSUZAWA ET AL.
INFECT. IMMUN.
FIG. 4. Functional analysis of TJs of cells expressing EspG or EspG2. (A) EspG and EspG2 were expressed in the presence or absence of taxol (5 M). Cells were lysed, and the active form of RhoA was coprecipitated with GST-RBD. The amount of RhoA bound to the RBD and the amount of RhoA in the whole-cell lysates were analyzed by Western blotting with anti-RhoA antibodies. The intensity of bands was quantified using the NIH Image software, and the results are expressed as fold increases in the band for active RhoA in nonstimulated cells. (B) EspG- or EspG2-expressing MDCK cells were fixed and stained with anti-FLAG M2 monoclonal antibodies (used to detect the expression of FLAG-EspG and -Orf3), anti-ZO-1 antibodies, or anti-claudin-1 antibodies. (C) The TER of polarized MDCK monolayers was measured prior to treatment or expression, and the estimated values were adjusted to 100% TER. MDCK monolayers were treated with 50 M Y27632 or 2 mM EGTA (P/EGTA) for 2 h. Cells were also incubated in the absence of doxycycline for 24 h to express EspG or EspG2. Then the TER of polarized MDCK monolayers was estimated. P buf., P buffer; Non., nonstimulated cells. (D and E) Apical and basolateral cell culture media were replaced by P buffer containing FITC-dextran (10 mg/ml) and P buffer alone, respectively. P/EGTA buffer containing FITC-dextran (10 mg/ml) and P/EGTA
VOL. 73, 2005
EspG AND EspG2 ALTER PARACELLULAR PERMEABILITY
NaCl, 2 mM ethylene glycol-bis(-aminoethyl ether)-N,N,N⬘,N⬘-tetraacetic acid (EGTA)]. In order to measure the paracellular flux, the apical and basolateral cell culture media were replaced by P buffer containing FITC-dextran (10 mg/ml) and P buffer alone, respectively. P/EGTA buffer containing FITC-dextran (10 mg/ml) and P/EGTA buffer were used as positive controls. After incubation for 3 h, the amounts of FITC-dextran in the basolateral media were measured with a fluorometer (excitation at 492 nm and emission at 520 nm). To measure fluid-phase transcytosis, cells grown on filters were allowed to internalize HRP (10 mg/ml) or EGF (50 ng/ml) and HRP (10 mg/ml) for 10 min at 37°C. Internalization was stopped by cooling the cells on ice, and the cells were then washed six times for 3 min with cold PBS containing 0.5% bovine serum albumin. After incubation for 2 h at 37°C, the transcytosed HRP in the basolateral medium was measured by a colorimetric assay (23).
RESULTS AND DISCUSSION EspG2 is secreted via TTSS. To date, six effectors that are translocated into host cells via TTSS have been identified and characterized in EPEC; these effectors include Tir (18), EspF (24), EspG (10), EspH (31), Map (19), and Cif (6). In addition, an EspG-Orf3 homolog, which is encoded in the EspC pathogenicity islet in the EPEC genome and exhibits 43.5% identity with EspG, is thought to be an effector (10). To confirm that Orf3 is secreted via TTSS, secreted proteins were prepared from bacterial culture supernatant, and a Western blot analysis was carried out using anti-Orf3 antibodies (Fig. 1). Orf3 was detected in the secreted proteins of WT EPEC and in an espB mutant (defective in TTSS-mediated pore formation on the host plasma membrane). In contrast, Orf3 secretion into culture supernatant was not detected in the case of the escN mutant (defective in the secretion of type III secreted proteins). These results clearly indicate that Orf3 is a type III secreted protein in EPEC. We designated Orf3 EspG2. EspG2 is translocated into host cells via TTSS. To demonstrate that EPEC has the ability to inject EspG2 into the host cell via TTSS, a fluorescence-based reporter system employing TEM-1 -lactamase (6) was used. The use of this system confirmed that type III effectors, such as Map and EspF, were translocated into host cells. Plasmids that encoded TEM-1fused proteins were introduced into EPEC, and then the secretion of TEM-1-fused proteins was confirmed (Fig. 2A). As was the case for secretion of TEM-fused proteins with the Map effector (Map-TEM), TEM-1-fused EspG2 (EspG2-TEM) secretion was dependent on the TTSS. We next carried out an infection assay using these strains of bacteria. Cells infected with the EPEC WT strain expressing TEM-1 alone or CesT (a chaperone for Tir and Map)-TEM exhibited green fluorescence, indicating that there was not TEM-1 activity in these cells (Fig. 2B). In contrast, the cells that were infected with WT EPEC expressing EspG2-TEM or Map-TEM (as a positive control) exhibited blue fluorescence, indicating that EspG2TEM was translocated into the host cells. The espB mutant retained the ability to secrete EspG2-TEM into the culture supernatant (Fig. 2A), but this mutant strain was unable to
6287
inject both EspG2- and Map-TEMs into the host cells (Fig. 2B), thus indicating that EspG2 is translocated via pores formed by EspB on the host plasma membrane. These results confirm that EspG2 is secreted and translocated into host cells via the TTSS. RhoA was activated in MDCK cells infected with EPEC. Recently, we demonstrated that EspG and EspG2 induce MT destabilization, resulting in the release of GEF-H1 from MT networks, and this effect triggered an increase in GEF-H1 activity (21). Subsequently, it was observed that EspG/EspG2 induces activation of the GEF-H1-mediated RhoA-Rho kinase (ROCK) signaling pathway in HeLa cells. In this study, we particularly focused on a major physiological function of EspG/ EspG2 at the epithelial cell junction, which plays an important role in EPEC-mediated diarrhea. Therefore, an infection assay was carried out using polarized MDCK cells. To determine whether RhoA is activated in MDCK cells infected with EPEC, the RBD of rhotekin, which can bind to active RhoA (GTP-bound RhoA), was used. The level of the active form of RhoA in WT EPEC-infected cells was higher than the level in cells infected with the espG/espG2 double-knockout mutant (espG/espG2 mutant) (Fig. 3A). Moreover, complementation of the espG/espG2 mutant with p99-EspG or p99-EspG2 restored RhoA activation activity. The activation of RhoA, caused by EPEC infection, was completely inhibited by MT stabilization with taxol. In a previous study, we confirmed that taxol had no effect on EPEC adhesion to host cells (data not shown). These findings indicate that not only in HeLa and COS-7 cells (21) but also in MDCK cells, RhoA is activated by EPEC infection, and this event is dependent both on EspG/ EspG2 activity and on MT destabilization. espG/espG2 mutant retained induction of TJ disruption. To analyze the effects of EspG/EspG2 on epithelial cell junctions, polarized MDCK monolayers were infected with WT EPEC or with the espG/espG2 mutant (Fig. 3B and C), and the TER of the MDCK monolayer was measured. A decrease in TER was accompanied by altered disruption of TJs but was not associated with cell death. The TER of the MDCK monolayer was decreased by infection with WT EPEC, and this decrease was dependent on the TTSS. Again, the epithelial TER was reduced by infection with the espG/espG2 mutant (Fig. 3B). Moreover, ZO-1 disruption was also induced by infection with either the espG/espG2 mutant or the EPEC WT strain (Fig. 3C). Although two effectors, EspF and Map, have been shown to play an important role in TJ disruption in EPEC (8), our results demonstrated that EspG and EspG2 are not involved in TJ disruption. EspG/EspG2 induces RhoA activation but not TJ disruption. It is well known that seven effectors are translocated into the host cell and at least two effectors, EspF and Map, are involved in disruption of the intestinal barrier function. To rule
buffer were used as positive controls (P/EGTA in panel E). After 3 h of incubation, the basolateral media were collected, and FITC-dextran was measured. The results are expressed as fold increases in the FITC-dextran permeability of nonstimulated cells. The values are means and standard deviations for three independent experiments. (F) Fluid-phase transcytosis was measured after cells were labeled for 10 min at 37°C with HRP (10 mg/ml) from the apical side. As a positive control, apical cell culture medium was replaced by P buffer containing HRP (10 mg/ml) and EGF (50 ng/ml). Internalization was stopped by cooling the cells on ice, and then the cells were washed. After incubation for 2 h at 37°C, the basolateral medium was collected, and the transcytosed HRP was measured. The results are expressed as fold increases in HRP transcytosis of nonstimulated cells. The values are means and standard deviations for three independent experiments.
6288
MATSUZAWA ET AL.
out involvement of the EPEC type III effectors other than EspG/EspG2, Tet-Off-inducible MDCK cell lines were used for further analysis of EspG/EspG2 function (Fig. 4). The EspG or EspG2 protein was expressed in polarized MDCK cells for 24 h, and then the TER of the cell monolayers was measured. Neither expression of EspG nor expression of EspG2 was found to have any effect on the epithelial TER (Fig. 4C), and neither protein induced the distribution of the TJ-associated proteins ZO-1 and claudin-1 (Fig. 4B). Recent studies have shown that ROCK and extracellular calcium are necessary for TJ function as an epithelial barrier (12, 32). Thus, the epithelial TER was reduced by treatment with Y27632, a ROCK inhibitor, or EGTA (Fig. 4C). However, expression of EspG/EspG2 did not affect the epithelial TER, indicating that EspG- or EspG2-expressing MDCK cells have normal overall morphology and probably maintain fully assembled TJs. However, the level of the active form of RhoA in EspG- and EspG2-expressing MDCK cells was significantly higher than that in cells in which the vector alone was introduced, and RhoA activation was significantly inhibited by MT stabilization with taxol (Fig. 4A). These results are consistent with the results shown in Fig. 3, suggesting that EspG/EspG2 activates RhoA in an MT destabilization-dependent manner, but this signaling does not in turn lead to the disruption of TJ strands. EspG/EspG2 alters the TJ function as a channel for paracellular fluxes. Next, in order to determine whether expression of EspG and EspG2 has any influence on the TJ barrier function, paracellular permeability was measured in MDCK monolayers expressing EspG or EspG2, as described in Materials and Methods. Fivefold upregulation of the paracellular permeability to 4-kDa FITC-dextran was observed in cells expressing EspG or EspG2 (Fig. 4D). In contrast, the paracellular permeability to 500-kDa FITC-dextran was not affected (Fig. 4E). Furthermore, the endocytotic pathway was upregulated, as measured by the transcytosis of HRP, when an MDCK monolayer was incubated with EGF (Fig. 4F). However, expression of EspG or EspG2 had no effect on the transcytosis of HRP, indicating that the observed increase in 4-kDa FITCdextran permeability was not due to increased fluid-phase transcytosis (Fig. 4F). These findings clearly indicate that the EPEC type III effectors EspG and EspG2 alter epithelial paracellular permeability, which is specific for low-molecularweight tracers. Recently, it has been demonstrated that TJs are indeed channels for paracellular fluxes (2, 27). TJs consist of an anastomosing network of strands that form irregular interstrand compartments. Assuming that the TJ pores open and close randomly, TJ strands organized in this way could account for a logarithmic relationship between the number of strands and TER. TER is an instantaneous measure of ion flux, whereas measurement of the flux of a noncharged solute, such as lowmolecular-weight dextran, is a much slower process. The noncharged solute may traverse a different junctional pathway, and this flux has been measured over a period of minutes to hours. We found that EspG and EspG2 can increase size-selective paracellular permeability without disruption of the TJ architecture. Thus, EspG and EspG2 alter the TJ channel, resulting in paracellular fluxes. Recently, Tomson et al. reported that EspG induces MT disruption in human intestinal epithelial cells, such as T84 and
INFECT. IMMUN.
Caco-2 cells (30). Although deletion of espG alone did not affect the decrease in the TER, deletion of both espG and espG2 caused a delay in the decrease in the TER (30). In contrast, EspG and EspG2 were not involved in TJ disruption in this study. We used a canine kidney (MDCK) cell line to obtain stable cell lines for the Tet-Off system. Based on our findings, a certain amount of EspG/EspG2 might affect the TJ function in human epithelial cells. Besides EPEC, enterohemorrhagic E. coli (EHEC) and Citrobacter rodentium (a natural mouse pathogen) are also attaching and effacing (A/E) bacterial pathogens that attach to the host intestinal epithelium and efface brush border microvilli, forming A/E lesions (7, 11). Many key virulence factors shared by the A/E pathogens are found at the site of enterocyte effacement (14). Because EPEC and EHEC are human pathogens, efforts aimed at elucidating the functions of the virulence factors have been restricted to in vivo studies. C. rodentium infection of mice has been used as an animal model for studying EPEC and EHEC. Recent studies have shown that in C. rodentium both EspG and EspF are required for the pathogen to achieve full virulence in this mouse model (9, 25). We demonstrated here that EPEC regulates epithelial paracellular permeability in a size-selective manner by delivery of EspG/ EspG2 into host cells. Our results provide new insight into the regulation of TJs by virulence factors. The modulation of paracellular permeability and TJ disruption during EPEC infection are independently regulated by EspG/EspG2 and EspF/Map (8), respectively. The synergistic effects caused by multiple effectors are expected to contribute to triggering EPEC-mediated diarrhea. ACKNOWLEDGMENTS We thank E. Oswald for the generous gift of a plasmid encoding TEM-1 -lactamase and S. Narumiya for a plasmid encoding GSTRBD. This research was partially supported by operating grants from the All Kitasato Project Study and by Ministry of Education, Science, Sports and Culture Grant-in-Aid for Young Scientists (B), 14770123, 2002; Scientific Research (C), 16590370, 2004; COE Research. T.M. is a research fellow of the Japan Society for the Promotion of Science. REFERENCES 1. Balda, M. S., J. A. Whitney, C. Flores, S. Gonzalez, M. Cereijido, and K. Matter. 1996. Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical-basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein. J. Cell Biol. 134:1031–1049. 2. Bazzoni, G., and E. Dejana. 2004. Endothelial cell-to-cell junctions: molecular organization and role in vascular homeostasis. Physiol. Rev. 84:869–901. 3. Benais-Pont, G., A. Punn, C. Flores-Maldonado, J. Eckert, G. Raposo, T. P. Fleming, M. Cereijido, M. S. Balda, and K. Matter. 2003. Identification of a tight junction-associated guanine nucleotide exchange factor that activates Rho and regulates paracellular permeability. J. Cell Biol. 160:729–740. 4. Braga, V. M. 2002. Cell-cell adhesion and signalling. Curr. Opin. Cell Biol. 14:546–556. 5. Cereijido, M., L. Shoshani, and R. G. Contreras. 2000. Molecular physiology and pathophysiology of tight junctions. I. Biogenesis of tight junctions and epithelial polarity. Am. J. Physiol. Gastrointest Liver Physiol. 279:G477– G482. 6. Charpentier, X., and E. Oswald. 2004. Identification of the secretion and translocation domain of the enteropathogenic and enterohemorrhagic Escherichia coli effector Cif, using TEM-1 beta-lactamase as a new fluorescencebased reporter. J. Bacteriol. 186:5486–5495. 7. Clarke, S. C., R. D. Haigh, P. P. Freestone, and P. H. Williams. 2003. Virulence of enteropathogenic Escherichia coli, a global pathogen. Clin. Microbiol. Rev. 16:365–378. 8. Dean, P., and B. Kenny. 2004. Intestinal barrier dysfunction by enteropathogenic Escherichia coli is mediated by two effector molecules and a bacterial surface protein. Mol. Microbiol. 54:665–675.
VOL. 73, 2005
EspG AND EspG2 ALTER PARACELLULAR PERMEABILITY
9. Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A. Vazquez, J. Barba, J. A. Ibarra, P. O’Donnell, P. Metalnikov, K. Ashman, S. Lee, D. Goode, T. Pawson, and B. B. Finlay. 2004. Dissecting virulence: systematic and functional analyses of a pathogenicity island. Proc. Natl. Acad. Sci. USA 101:3597–3602. 10. Elliott, S. J., E. O. Krejany, J. L. Mellies, R. M. Robins-Browne, C. Sasakawa, and J. B. Kaper. 2001. EspG, a novel type III system-secreted protein from enteropathogenic Escherichia coli with similarities to VirA of Shigella flexneri. Infect. Immun. 69:4027–4033. 11. Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S. Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol. Microbiol. 30:911–921. 12. Gonzalez-Mariscal, L., R. G. Contreras, J. J. Bolivar, A. Ponce, B. Chavez De Ramirez, and M. Cereijido. 1990. Role of calcium in tight junction formation between epithelial cells. Am. J. Physiol. 259:C978–986. 13. Gruenheid, S., and B. B. Finlay. 2003. Microbial pathogenesis and cytoskeletal function. Nature 422:775–781. 14. Hacker, J., and J. B. Kaper. 2000. Pathogenicity islands and the evolution of microbes. Annu. Rev. Microbiol. 54:641–679. 15. Hall, A. 1998. Rho GTPases and the actin cytoskeleton. Science 279:509– 514. 16. Hasegawa, H., H. Fujita, H. Katoh, J. Aoki, K. Nakamura, A. Ichikawa, and M. Negishi. 1999. Opposite regulation of transepithelial electrical resistance and paracellular permeability by Rho in Madin-Darby canine kidney cells. J. Biol. Chem. 274:20982–20988. 17. Jou, T. S., E. E. Schneeberger, and W. J. Nelson. 1998. Structural and functional regulation of tight junctions by RhoA and Rac1 small GTPases. J. Cell Biol. 142:101–115. 18. Kenny, B., R. DeVinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B. Finlay. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91:511–520. 19. Kenny, B., S. Ellis, A. D. Leard, J. Warawa, H. Mellor, and M. A. Jepson. 2002. Co-ordinate regulation of distinct host cell signalling pathways by multifunctional enteropathogenic Escherichia coli effector molecules. Mol. Microbiol. 44:1095–1107. 20. Levine, M. M., E. J. Bergquist, D. R. Nalin, D. H. Waterman, R. B. Hornick, C. R. Young, and S. Sotman. 1978. Escherichia coli strains that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet i:1119–1122. 21. Matsuzawa, T., A. Kuwae, S. Yoshida, C. Sasakawa, and A. Abe. 2004.
Editor: J. B. Bliska
22. 23. 24.
25.
26. 27. 28.
29. 30.
31. 32.
33.
6289
Enteropathogenic Escherichia coli activates the RhoA signaling pathway via the stimulation of GEF-H1. EMBO J. 23:3570–3582. Matter, K., and M. S. Balda. 2003. Signalling to and from tight junctions. Nat. Rev. Mol. Cell Biol. 4:225–236. Matter, K., E. M. Yamamoto, and I. Mellman. 1994. Structural requirements and sequence motifs for polarized sorting and endocytosis of LDL and Fc receptors in MDCK cells. J. Cell Biol. 126:991–1004. McNamara, B. P., A. Koutsouris, C. B. O’Connell, J. P. Nougayrede, M. S. Donnenberg, and G. Hecht. 2001. Translocated EspF protein from enteropathogenic Escherichia coli disrupts host intestinal barrier function. J. Clin. Investig. 107:621–629. Mundy, R., L. Petrovska, K. Smollett, N. Simpson, R. K. Wilson, J. Yu, X. Tu, I. Rosenshine, S. Clare, G. Dougan, and G. Frankel. 2004. Identification of a novel Citrobacter rodentium type III secreted protein, EspI, and roles of this and other secreted proteins in infection. Infect. Immun. 72:2288–2302. Sawada, N., M. Murata, K. Kikuchi, M. Osanai, H. Tobioka, T. Kojima, and H. Chiba. 2003. Tight junctions and human diseases. Med. Electron Microsc. 36:147–156. Schneeberger, E. E., and R. D. Lynch. 2004. The tight junction: a multifunctional complex. Am. J. Physiol. Cell Physiol. 286:C1213–C1228. Sekiya, K., M. Ohishi, T. Ogino, K. Tamano, C. Sasakawa, and A. Abe. 2001. Supermolecular structure of the enteropathogenic Escherichia coli type III secretion system and its direct interaction with the EspA-sheath-like structure. Proc. Natl. Acad. Sci. USA 98:11638–11643. Simonovic, I., J. Rosenberg, A. Koutsouris, and G. Hecht. 2000. Enteropathogenic Escherichia coli dephosphorylates and dissociates occludin from intestinal epithelial tight junctions. Cell. Microbiol. 2:305–315. Tomson, F. L., V. K. Viswanathan, K. J. Kanack, R. P. Kanteti, K. V. Straub, M. Menet, J. B. Kaper, and G. Hecht. 2005. Enteropathogenic Escherichia coli EspG disrupts microtubules and in conjunction with Orf3 enhances perturbation of the tight junction barrier. Mol. Microbiol. 56:447–464. Tu, X., I. Nisan, C. Yona, E. Hanski, and I. Rosenshine. 2003. EspH, a new cytoskeleton-modulating effector of enterohaemorrhagic and enteropathogenic Escherichia coli. Mol. Microbiol. 47:595–606. Walsh, S. V., A. M. Hopkins, J. Chen, S. Narumiya, C. A. Parkos, and A. Nusrat. 2001. Rho kinase regulates tight junction function and is necessary for tight junction assembly in polarized intestinal epithelia. Gastroenterology 121:566–579. Yuhan, R., A. Koutsouris, S. D. Savkovic, and G. Hecht. 1997. Enteropathogenic Escherichia coli-induced myosin light chain phosphorylation alters intestinal epithelial permeability. Gastroenterology 113:1873–1882.
