Bioelectromagnetics 28:231^237 (2007)
Effects Of 50 Hz Sinusoidal Magnetic Fields On Hsp27, Hsp70, Hsp90 Expression in Porcine Aortic Endothelial Cells (PAEC) Chiara Bernardini,1* Augusta Zannoni,1 Maria Elena Turba,1 Maria Laura Bacci,1 Monica Forni,1 Pietro Mesirca,2 Daniel Remondini,1 Gastone Castellani,1 and Ferdinando Bersani2 1
Department of Veterinary Morphophysiology and Animal Production DIMORFIPA, Bologna University, Bologna, Italy 2 Department of Physics, Bologna University, Bologna, Italy
The aim of the present study was to investigate the influence of 50 Hz sinusoidal magnetic field on Hsp27, Hsp70, and Hsp90 expression in a model of primary culture of porcine aortic endothelial cells (PAEC). We took into consideration the Hsp profile in terms of mRNA expression, protein expression and protein localization inside the cells. The choice of the cell system was motivated by the involvement of the endothelial cells in the onset of many diseases; moreover, only few reports describe the effects of extremely low frequency magnetic fields (ELF-MFs) on such cells. ELF-MF exposure induced an increase in the mRNA levels of the three proteins, which was statistically significant for Hsp70. On the contrary, we did not observe any influence on Hsp27, Hsp70, and Hsp90 protein levels. Analysis in situ by immunofluorescence revealed that ELF-MF exposure affected the cellular distribution of Hsp27; in particular a partial relocalization in the nucleus was observed. Bioelectromagnetics 28:231–237, 2007. 2006 Wiley-Liss, Inc. Key words: ELF-MF; heat shock proteins; endothelial cells
INTRODUCTION
MATERIALS AND METHODS
It is well known that all organisms, from bacteria to mammals, share a common stress response system at molecular level, leading to a deep alteration in the pattern of Hsp gene expression [Morimoto et al., 1994]. Several studies demonstrated that extremely low frequency magnetic fields (ELF-MFs) induce Hsp expression [Goodman and Blank, 1998; Miyakawa et al., 2001; Malagoli et al., 2004; Tokalov and Gutzeit, 2004]. Junkersdorf et al. [2000] found an increase of Hsp only when an ELF-MF stimulus was associated with physical stressors like heat. On the contrary, other studies failed in inducing heat shock response [Kang et al., 1998; Shi et al., 2003; Coulton et al., 2004]. Since only few reports describe the effects of ELF-MF on vascular endothelial cells [Tepper et al., 2004; Takahashi et al., 2005; Alfieri et al., 2006] and considering that endothelial integrity is fundamental to avoid the development of many diseases, the aim of the present study was to investigate whether ELF-MFs influence Hsp27, Hsp70, and Hsp90 expression in a model of primary culture of vascular endothelial cells.
Cell Culture Porcine aortic endothelial cells (PAEC) were isolated as previously described [Bernardini et al., 2005]. Cells were cultured in human endothelial basal growth medium (Gibco-Invitrogen, Paisley, UK) supplemented with 5% fetal bovine serum (FBS, Gibco-Invitrogen) and 1% antibiotics/antimicotics
2006 Wiley-Liss, Inc.
————— — Grant sponsor: Italian Ministry of Education; Grant sponsor: The ‘Fondazione del Monte di Bologna e Ravenna’ ‘Studio degli effetti biologici dei campi elettromagnetici e la valutazione del loro impatto sulla salute umana’; Grant sponsor: ISPESL; Grant number: B81-1/DML/02; Grant sponsor: MIUR PRIN (2005). *Correspondence to: Chiara Bernardini, Via Tolara di Sopra 50, 40064 Ozzano dell’Emilia, Bologna, Italy. E-mail:
[email protected] Received for review 15 March 2006; Final revision received 17 July 2006 DOI 10.1002/bem.20299 Published online 1 November 2006 in Wiley InterScience (www.interscience.wiley.com).
232
Bernardini et al.
(Gibco-Invitrogen). Cell number and viability (85%– 90%) were determined using a Thoma chamber under a phase-contrast microscope after vital staining with trypan blue dye. Approximately 3 105 cells were placed in T-25 tissue culture flasks (T25-Falcon, Beckton–Dickinson, Franklin Lakes, NJ) in a 5% CO2 atmosphere at 38.5 8C. The cells were maintained in a logarithmic growth phase by routine passages every 2–3 days at a 1:3 split ratio. Exposure System The exposure system (Fig. 1) consisted of two identical apparatuses each consisting of four coaxial circular coils, placed horizontally, and thus parallel with respect to the surface of the culture well plates. The diameter of the external coils (top and bottom) was 18 cm, while that of the two internal ones was 20 cm. The geometry of the coil system was numerically calculated in order to optimize the extension of the magnetic field uniformity [Gottardi et al., 2003]. In particular, the distances between the external and the internal coils from the center of symmetry were 9 and 3 cm, respectively. According to these conditions the uniformity was better than 2% within a cylindrical region of approximately 11 cm (along the coil axis) 9 cm, thus allowing a simultaneous exposure of a maximum of six-culture wellplates (24-well microplate). Coils were wound by a pair of parallel wires, outer coils 42 turns and inner coils 37 turns, so that, according to different connections, the current could either flow in the same direction ‘‘wound configuration’’ or in the opposite direction ‘‘counter-wound configuration.’’ In the latter case the magnetic fields produced by
Fig. 1. The exposure setup.On the left, the field generation system isshown.Ontheright, theincubatorisshownwith thetwo coilssystem inside.
counter-wound coils cancel each other, allowing a ‘‘true’’ sham system, in which the current and the power dissipation are the same as in the ‘‘wound configuration,’’ but the magnetic flux density is theoretically zero [Kirschvink, 1992]. In the real system, due to small differences in the wire turns, the total magnetic flux density was not exactly zero, but it never exceeded 1/100 of the corresponding value in the ‘‘wound configuration’’ for the same current flow. One exposure system was used as sham and the other for field exposure. The four coils of the two systems were connected in series and powered by a house-made power amplifier connected to a function generator (TTi TG550). The magnetic flux density was monitored by a Hall probe gaussmeter (Bell, model 7010), the wave shape visualized by means of a digital oscilloscope (Hitachi V-1065C) and the current flowing through the systems controlled by a multimeter (MeterMan 34XR). The frequency and the flux density of the sinusoidal field were maintained at 50 Hz and 1.0 mT rms, respectively. The exposure and sham-exposure systems were put in the same incubator (Model 311, Thermo Electron Corp., Waltham, MA) at 37 8C and 5% CO2 in humidified atmosphere. All the experiments were performed blind. The magnetic field was monitored inside the incubator, thus taking into account the interference between the two systems. In order to decrease this interference a m-metal foil was placed between the two systems to shield the sham-exposure system from the stray field produced by the exposure system. According to this condition a stray field reduction of about 30% was obtained: 5 mT in sham-exposure versus 1 mT in exposure system. The background field was also measured: the local geomagnetic field was 37 mT (as measured by the Bell 7010 Gaussmeter) and the AC background field was of the order of 3 mT, as measured by an EMDEX II (ENERTECH Consultants) probe. Temperature was monitored by a couple of thermoresistors alumel-chromel connected to a thermometer (DeltaOhm, model HD8704). The results showed no significant differences in temperature inside the culture medium between sham and field exposure. Cell Preparation and Exposure Conditions Cells between third and eighth passage were grown in flat bottom 24-well assay plates (Falcon Multiwell Primaria 24-well, Beckton–Dickinson), size 12.5 cm 8.5 cm, internal diameter of the cylindrical wells 1.5 cm, or in eight-well slide chambers (Human Fibronectin Cellware eight-well culture slide, Beckton–Dickinson), size 5.5 cm 2.5 cm with
Effect of ELF-MFs on HSPs Expression in Endothelial Cells
1 cm-side square wells. Taking into account the size of the wells, the estimated maximum induced electric field is of the order of 1.2 mV/m. The wells were filled with 1 and 0.5 ml of human endothelial basal growth medium (Gibco-Invitrogen) supplemented with 5% fetal bovine serum (FBS, Gibco-Invitrogen) and 1% antibiotics/antimicotics (Gibco-Invitrogen), respectively. Cells at 70%–80% of confluence were exposed to sinusoidal ELF-MF (50 Hz, 1 mT) for 4 h, then were recovered in standard culture conditions for additional 0, 3, 6, 24 h. At the end of each experimental time point, cells were trypsinized then collected and stored at 80 8C until assays. Real-Time PCR Quantification of Hsp27, Hsp70, and Hsp90 mRNA Total RNA was isolated using RNeasy Mini Kits 50 (Qiagen Sciences, Inc., MD) and treated with RNase-free DNase set (Qiagen) according to the manufacturer’s instruction. RNA concentration was spectrophotometrically quantified (A260 nm) and its quality was determined by gel electrophoresis on 2% agarose. One microgram of total RNA was reverse-transcribed to cDNA using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., CA), in a final volume of 20 ml. Transcription reactions without reverse transcriptase were performed to check for possible DNA contamination. Swine primers for Hsp27, Hsp70, Hsp90, and the housekeeping gene hypoxanthine phosphoribosyltransferase (HPRT) were designed to span one intron, to avoid genomic DNA amplification, using the Beacon Designer 2.07 Software (Premier Biosoft International, Palo Alto, CA). Their sequences, expected PCR product length and accession number in the EMBL database, are shown in Table 1. Real-time quantitative PCR was performed in the iCycler Thermal Cycler (Bio-Rad) using SYBR green I detection. A master-mix of the following reaction components was prepared to indicate end-concentrations: forward primer (0.2 mM), reverse primer (0.2 mM), and IQ SYBR Green BioRad Supermix 1 (Bio-Rad). All samples were performed
in duplicate. The real-time PCR protocol employed was the following: initial denaturation for 3 min at 95 8C, 40 cycles of 95 8C for 15 s, and 60 8C for 30 s, followed by a melting step with a slow heating from 55 8C–95 8C with a rate of 0.5 8C/s. The housekeeping HPRT was used to normalize the amount of RNA. The relative amount of the target genes in the exposed group compared to the sham group, was calculated using the DDCT method (ABI Prism 7700 Sequence detection System User Bulletin no. 2. Relative quantification of gene expression; 1997 and 2001). Real-time efficiency for each primers set was acquired by amplification of a standardized cDNA dilution series. The specificity of the amplified PCR products was verified by analysis of the melting curve, which is sequence-specific, and by agarose gel electrophoresis run. Western Blot Analysis of Hsp27, Hsp70, Hsp90 Cells were harvested and lysated in SDS buffer (Tris-HCl 62.5 mM pH 6.8; SDS 2%, glicerol 20%). Protein content of cell lysates was determined by a Protein Assay Kit (Sigma Chemical Company, MO). Aliquots containing 10 mg of proteins were separated onto NuPage 10% Bis-Tris Gel (Gibco-Invitrogen) for 50 min at 200 V. Proteins were then electrophoretically transferred onto a nitrocellulose membrane. Blots were washed in PBS and protein transfer was checked by staining the nitrocellulose membranes with 0.2% Ponceau Red and gels with Comassie Blue. Nonspecific protein binding on nitrocellulose membranes was blocked with 3% milk powder in PBS-T20 (phosphate buffer saline-0.1% Tween-20) for 3 h at room temperature (RT). Membranes were then incubated with a 1:1000 dilution of an anti-Hsp70 (SPA 810, StressGen, Victoria, Canada), or an anti-Hsp90 (SPA 830, StressGen) or an anti-Hsp27 (SPA 803, StressGen) antibody in tris buffered saline-T20 (TBS-T20 20 mM Tris-HCl, pH 7.4, 500 mM NaCl, 0.1% Tween-20) overnight at 4 8C. After several washings with PBS-T20
TABLE 1. Forward and Reverse Primers Sequences, RT-PCR Product Length and Accession Number in the EMBL Database Primer Hsp70 Hsp27 Hsp90 HPRT
233
Sequence (50 –30 ) For: GTGGCTCTACCCGCATCCC Rev: GCACAGCAGCACCATAGGC For: AGGAGCGGCAGGATGAG Rev: GGACAGGGAGGAGGAGAC For: CGCTGAGAAAGTGACCGTTATC Rev: ACCTTTGTTCCACGACCCATAG For: GGACAGGACTGAACGGCTTG Rev:GTAATCCAGCAGGTCAGCAAAG
RT-PCR length (bp)
Accession number
114
M29506
101
NM_001007518
126
NM_213973
115
AF143818
234
Bernardini et al.
the membranes were incubated with the secondary biotin-conjugate antibody and then with a 1:1000 dilution of an antibiotin horseradish peroxidase (HRP)-linked antibody. Western blots were developed using a chemiluminescent substrate (Bio-Rad) according to the manufacturer’s instructions. Membranes were stripped and reprobed for b-tubulin (sc-5274 Santa Cruz Biotechnology, Inc., Santa Cruz, CA) in order to normalize the results. The relative protein content was determined by the density of the resultant bands and expressed in arbitrary units (AU) relative to the b-tubulin content, using the Quantity One Software (Bio-Rad). Immunofluorescence Staining After treatment, cells were fixed with ethanol and acetic acid (2:1) and permeabilized with 0.1% Triton X-100. Thereafter, cells were washed with PBS three times and blocked with 10% FBS in PBS for 1 h at RT. Primary antibodies: 1:200 anti-Hsp27, 1:200 antiHsp90, 1:100 anti-Hsp70 were added in a humidified chamber at 4 8C overnight. After several washes with PBS, appropriate dilutions of FITC-conjugated secondary antibodies were added. The cells were then counterstained with propidium iodide and examined under an epifluorescence microscope (Eclipse E600 Nikon, Japan) equipped with fluorescein (FITC) and tetramethylrhodamine (TRITC) filters and with a Nikon digital camera. A minimum of 200 cells were evaluated for each experimental point. Statistical Analysis Each treatment was replicated six times. Normalized protein (AU) and mRNA (DCt) values were analyzed using two-way ANOVA (SPSS program version 13.0, SPSS, Inc., Chicago, IL); t-test was employed for evaluating significant differences of treated versus sham group at each time point. A probability P
