Med Microbiol Immunol (2003) 192: 79–83 DOI 10.1007/s00430-002-0149-7
O RI GI N AL IN V ES T IG A T IO N
Nina Mejlhede Æ Amanda Montha´n Æ Michael Theisen Michael Ibba
Differentiation of Borrelia burgdorferi sensu lato strains using class I lysyl-tRNA synthetase-encoding genes Received: 26 June 2002 / Published online: 25 September 2002 Springer-Verlag 2002
Abstract The essential protein lysyl-tRNA synthetase (LysRS) exists in two unrelated forms, a class I and a class II-type aminoacyl-tRNA synthetase. Comparative genome sequence analysis revealed that Borrelia burgdorferi sensu lato, the etiological agent of Lyme disease, contains a class I-type LysRS, whereas its tick and mammalian hosts would be expected to contain a class II-type protein. To investigate the utility of the class I LysRS as a diagnostic target for Lyme disease, the corresponding gene (lysK) was cloned and sequenced from B. afzelii, B. garinii, and B. hermsii. These lysK sequences were then used to design a primer set that could detect and genotype B. burgdorferi sensu strictu, B. afzelii, and B. garinii in one single polymerase chain reaction, while showing no cross reactivity with examples of other Borrelia or spirochetes. Keywords Borrelia Æ Lyme disease Æ Lysine Æ LysyltRNA Æ Synthetase
N. Mejlhede Æ A. Montha´n Æ M. Ibba (&) Center for Biomolecular Recognition, Department of Medical Biochemistry and Genetics, Laboratory B, The Panum Institute, Blegdamsvej 3c, 2200, Copenhagen N, Denmark E-mail:
[email protected] Tel.: +1-614-2922120 Fax: +1-614-2928120 M. Theisen Department of Clinical Biochemistry, Statens Serum Institut, Artillerivej 5, 2300, Copenhagen S, Denmark N. Mejlhede Æ M. Theisen Æ M. Ibba Department of Infectious Disease Immunology, Statens Serum Institut, Artillerivej 5, 2300, Copenhagen S, Denmark M. Ibba Department of Microbiology, The Ohio State University, 484 West 12th Avenue, Columbus, Ohio 43210–1292, USA
Introduction The etiological agent of Lyme borreliosis, the spirochete Borrelia burgdorferi sensu lato, is transmitted to humans by the bite of an infected Ixodes tick [2, 3, 17]. The initial manifestation of infection in humans is mild constitutional symptoms, often associated with erythema migrans, a red rash expanding from the site of the tick bite. The spirochetes then spread hematogenously to additional body tissue, and the disease can progress to chronic neurological, cardiac, cutaneous, and arthritic manifestations if it is left untreated [19]. The late manifestations of the disease seem to be associated with three distinct human pathogenic genospecies of B. burgdorferi sensu lato. B. burgdorferi sensu stricto is associated with arthritis, B. afzelii with cutaneous symptoms, and B. garinii with neuroborreliosis [22]. Routine laboratory diagnosis of Lyme borreliosis depends on serological detection of B. burgdorferi specific antibodies. However, the sensitivity of this method during early infection is low and antibody concentrations decrease only slowly after therapy [9]. PCR has proven its diagnostic value for detection of borrelia in patient samples [6, 7, 13, 14, 16, 18], but the genetic variation and resulting broad heterogeneity of the B. burgdorferi sensu lato complex at the species and subspecies level has made the construction of primer sets that can detect and differentiate all human pathogenic subspecies difficult [1, 24]. The enzyme that adds lysine to its corresponding tRNAs, the lysyl-tRNA synthetase (LysRS), is an essential component of gene expression. LysRS is highly unusual among the aminoacyl-tRNA synthetases, in that the enzyme, dependent on the organism, is found as one of two structurally distinct protein classes. In eukarya and most bacteria LysRS is found as a class II aminoacyltRNA synthetase, whereas in archea and certain bacteria, including the human pathogens B. burgdorferi, Treponema pallidum, and Rickettsia prowazeckii, the enzyme belongs to class I [10, 12]. The genome of B. burgdorferi sensu stricto strain B31 has been fully sequenced and the
80
gene encoding the class I LysRS, lysK, has been identified [5, 11]. Here we report the sequences of lysK from Danish B. afzelii and B. garinii strains, as well as lysK from B. hermsii, a related Borrelia that causes relapsing fever, and use these genes to suggest a primer set and PCR reaction that may be useful in the diagnosis of Lyme borreliosis.
Materials and methods Amplification and sequencing of lysK from spirochetes Genomic DNAs from B. afzelii DK26, B. garinii DK6, and B. burgdorferi B31 were purified as previously described [8, 15]. B. valaisiana POTIB1 and POTIB2 and B. lusitaniae VS116 were kindly provided by Dr. G. Barranton (Institut Pasteur, Paris).
Fig. 1 Alignment of Borrelia lysK nucleotide sequences. Positions corresponding to specific primer sites are underlined. Sequences shown are from B. burgdorferi B31 (BblysK), B. afzelii DK26 (BalysK), B. garinii DK6 (BglysK), and B. hermsii (BhlysK)
Genomic DNAs from B. hermsii and T. pallidum were kindly provided by Dr. P.A. Rosa (National Institute of Allergy and Infectious Diseases, Hamilton, Montana) and Dr. S.J. Norris (University of Texas at Houston Medical School, Houston, Texas), respectively. All other genomic DNA samples have been previously described [20]. PCR amplification of lysK from B. afzelii, B. garinii, and B. hermsii was performed using primers designed on the basis of the lysK sequence of B. burgdorferi sensu stricto B31. PCR was performed at low anneal temperature (25 cycles; 95C 30 s, 35C 30 s, 72C 2 min), with a reaction mixture of 10 ng genomic DNA, 50 pmol of each primer, 400 lM dNTP and 5 units Taq polymerase (Sigma), in the provided PCR buffer (total volume 100 ll). The primers used were antisense primer BBKRS2 (GATAAAGATTTGGATCCCATTAAACATTAC) annealing 140 base pairs downstream of the translation stop and sense primer NM18 (GAAAAGAAATAAAATCAATAG) annealing 208 base pairs (bp) 5¢ of the translation start codon (for B. afzelii and B. garinii) or sense primer NM9 (ATGGTGAAAACAGCACACTGGG) annealing 19 bp 3¢ of the start codon (for B. hermsii). The resulting PCR products were resolved by agarose gel electrophoresis and the bands of expected sizes, approximately 1,600 bp in length, were eluted and purified. The resulting DNA was then sequenced by ABI Prism Dye Terminator Cycle Sequencing (Perkin Elmer). Sequencing was performed on both strands of two individual PCR products using the primers described above for initial PCR amplification.
81
Fig. 3 Gel electrophoresis of PCR products using genomic DNA from spirochetes as template (20 ll of each reaction mixture was electrophoresed on a 1.35% agarose gel and stained with ethidium bromide). From left to right: 100 bp DNA ladder (lane 1), B. afzelii DK26 (2), B. burgdorferi B31 (3), B. garinii DK6 (4), B. hermsii (5), and Treponema pallidum (6) mixtures consisted of 10 ng genomic DNA, 50 pmol species-specific primer mixture, 400 lM dNTP, and 5 units Taq polymerase (Sigma), in the provided PCR buffer (total volume 100 ll). PCR was run with a program of 25 cycles (95C 30 s, 55C 30 s, 72C 1 min). PCR products were run on 1.3% agarose gels at 150 V for 1 h. The genospecies specificity of the procedure was investigated using a panel of B. burgdorferi sensu latu strains. In order to investigate the sensitivity of the method, amplification was repeated using serial dilutions of template corresponding to a range of approximately 1 to 106 chromosomal copies. Fig. 2 Alignment of Borrelia LysRS amino acid sequences. Sequences shown are from B. burgdorferi (BbKRS) B31, B. afzelii DK26 (BaKRS), B. garinii DK6 (BgKRS), and B. hermsii (BhKRS)
Table 1 Distance matrix indicating similarity between Borrelia lysK DNA sequences and LysRS amino acid sequences (b B. burgdorferi, a B. afzelii, g B. garinii, h B. hermsii)
Accession numbers The sequences of the lysK genes reported here have been deposited in the EMBL Nucleotide Sequence Database and have the following accession numbers: B. afzelii, AJ416851; B. garinii, AJ416852; B. hermsii, AJ416853.
Results and discussion
% DNA similarity b % Amino acid similarity
b a g h
95 93 76
a
g
h
92
92 93
74 75 74
94 77
76
Similarity values were calculated from sequence alignments generated using ClustalW [21] Species-specific primers and PCR reaction The three 5¢ primers, NM29 (CCACAAAACAAGTTATGCAA GG) specific for B. burgdorferi sensu stricto, s5dk26 (CAAACAATATACCAACGGTGT) specific for B. afzelii, and s5dk6 (AGCTTTAAAAGACTCTGGATCGC) specific for B. garinii, and the degenerate 3¢ broad specific primer NM30 (GTARATYCTCTCAAAYYTGTCG) specific for all three genospecies were used to make a species-specific primer mixture with 50 pmol of each primer. Genbank searching with primer pairs only showed significant homology to the desired target sequences. Initial PCR
DNA and protein sequence alignment Sequence alignment of the encoding nucleotide sequences of lysyl-tRNA synthetase from B. burgdorferi sensu stricto, B. afzelii, B. garinii, and B. hermsii and the corresponding protein sequences are shown in Figs. 1. and 2. To further represent the degree of similarity between the sequences, a distance matrix was constructed using the amino acid and DNA sequence alignment (Table 1). Comparison of the lysK sequences demonstrated high homology between the three strains B. burgdorferi sensu stricto, B. afzelii, and B. garinii, whereas B. hermsii showed considerably lower homology. Design of species-specific primers and PCR test On the basis of the DNA alignment, we designed the following four primers: a 3¢ degenerate primer designed
82 Table 2 Classification of B. burgdorferi sensu lato strains [22] by lysK amplicon size Genospecies and strain
Size of amplicon (bp)
B. burgdorferi sensu strictu DK7 709 Lip 709 Dun 709 297 709 272 709 bur 709 rob 709 B. garinii DK29 856 DK32 856 Pbi 856 SL10 856 SL14 856 SL20 856 B. afzelii DK3 619 DK5 619 DK8 619 DK9 619 DK14 619 DK21 619 DK26 619 Pko 619
Predicted genospecies B. B. B. B. B. B. B.
burgdorferi burgdorferi burgdorferi burgdorferi burgdorferi burgdorferi burgdorferi
B. B. B. B. B. B.
garinii garinii garinii garinii garinii garinii
B. B. B. B. B. B. B. B.
afzelii afzelii afzelii afzelii afzelii afzelii afzelii afzelii
sensu sensu sensu sensu sensu sensu sensu
strictu strictu strictu strictu strictu strictu strictu
Specificity and sensitivity of the PCR test
Fig. 4 Gel electrophoresis of PCR products using genomic DNA from members of B. burgdorferi sensu latu complex as template (20 ll of each reaction mixture was electrophoresed on a 1.35% agarose gel and stained with ethidium bromide). From left to right: B. afzelii DK26 (lane 1), B. burgdorferi B31 (2), B. garinii DK6 (3), 100 bp DNA ladder (4), B. valaisiana POTIB1 (5), B. valaisiana POTIB2 (6), and B. lusitaniae VS116 (7)
Table 3 Sensitivity of PCR test for lysK amplicon (+ amplicon of expected size visible after gel electrophoresis, – amplicon not visible)
a
Number of chromosomal copies
Templatesa
to anneal to any of the three B. burgdorferi sensu lato genospecies, and three 5¢ primers designed to specifically anneal to each of the three genospecies separately (see Fig. 1). The B. burgdorferi sensu stricto, B. afzelii, and B. garinii 5¢ primers annealed at distances of 709, 619, and 859 bp respectively 5¢ of the broad specificity 3¢ degenerate primer. The four primers were mixed and the primer mix was tested in PCR, using genomic DNA from B. burgdorferi sensu stricto, B. afzelii, B. garinii, B. hermsii, and Treponema pallidum as template. As shown in Fig. 3, PCR with genomic DNA from B. afzelii gave rise to a band of 619 bp, B. burgdorferi sensu stricto 709 bp, and B. garinii 856 bp, whereas B. hermsii and T. pallidum did not react.
The specificity of the PCR test was first investigated using a variety of B. burgdorferi sensu strictu, B. afzelli, and B. garinii strains (Table 2). In all cases an amplicon of the expected size was obtained. These results confirm the effectiveness of the lysK gene for accurately genotyping strains from three species within the B. burgdorferi sensu latu complex, suggesting that lysK may be less heterogeneous than other common targets such as ospA and ospC (e.g., [4, 20, 23]). We also investigated the specificity of the PCR test with respect to B. valaisiana and B. lusitaniae, two species of the B. burgdorferi sensu latu complex whose human pathogenicity is unclear. Neither species produced a detectable amplicon in the PCR test (Fig. 4), indicating that the procedure is specific for B. burgdorferi sensu strictu, B. afzelli, and B. garinii. Nevertheless, as the pathogenicity of these species becomes clearer, sequencing of their lysK genes might provide a means to readily differentiate them from other human pathogenic strains by the incorporation of additional primers into the above PCR test. The sensitivity of the PCR test was investigated using serial dilutions of genomic DNA templates from two strains each of B. burgdorferi sensu strictu, B. afzelli, and B. garinii (Table 3). All three species could be readily differentiated at a level of 100 chromosomal copies (100 fg genomic DNA), while B. burgdorferi sensu
B. burgdorferi sensu lato strain B. afzelii
955873 95587 9559 956 96 10 1
B. burgdorferi sensu strictu
B. garinii
DK2
DK22
DK6
DK27
B31
272
+ + + + + – –
+ + + + + – –
+ + + + + – –
+ + + + – – –
+ + + + + + –
+ + + + + + –
83
strictu was identified from 10 copies. Taken together with the data above, these results suggest that the sensitivity and specificity of the described technique should allow for the direct and rapid molecular typing of B. burgdorferi-containing samples, thereby facilitating studies of the relationship between spirochete genotype and clinical disease. Furthermore, the reported lysK genes provide new targets for use in existing nucleotide sequence-based Lyme disease diagnostic techniques (e.g., [16]), although some optimization of the reaction conditions to increase sensitivity to 10 or less chromosomal copies for all species may be required. Acknowledgements Nina Christiansen and Louise Vilsbøll are thanked for excellent technical assistance. We are greatly indebted to P.A. Rosa and S.J. Norris for providing genomic DNA samples. M.I. was the recipient of an Investigator Fellowship from the Alfred Benzon Foundation. This work was supported by grant QLG-CT-99–00660 within the Fifth Framework Programme of the European Commission.
References 1. Belfaiza J, Postic D, Bellenger E, Baranton G, Girons IS (1993) Genomic fingerprinting of Borrelia burgdorferi sensu lato by pulsed-field gel electrophoresis. J Clin Microbiol 31:2873–2877 2. Benach JL, Bosler EM, Hanrahan JP, Coleman JL, Habicht GS, Bast TF, Cameron DJ, Ziegler JL, Barbour AG, Burgdorfer W, Edelman R, Kaslow RA (1983) Spirochetes isolated from the blood of two patients with Lyme disease. N Engl J Med 308:740–742 3. Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP (1982) Lyme disease-a tick-borne spirochetosis? Science 216:1317–1319 4. Escudero R, Barral M, Perez A, Vitutia MM, Garcia-Perez AL, Jimenez S, Sellek RE, Anda P (2000) Molecular and pathogenic characterization of Borrelia burgdorferi sensu lato isolates from Spain. J Clin Microbiol 38:4026–4033 5. Fraser CM, Casjens S, Huang WM, Sutton GG, Clayton R, Lathigra R, White O, Ketchum KA, Dodson R, Hickey EK, Gwinn M, Dougherty B, Tomb JF, Fleischmann D, Richardson D, Peterson J, Kerlavage AR, Quackenbush J, Salzberg S, Hanson M, Vugt R van, Palmer N, Adams MD, Gocayne J, Weidman J, Utterback T, Watthey L, McDonald L, Artiach P, Bowman C, Garland S, Fujii C, Cotton MD, Horst K, Roberts K, Hatch B, Smith HO, Venter JC (1997) Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580–586 6. Goodman JL, Jurkovich P, Kramber JM, Johnson RC (1991) Molecular detection of persistent Borrelia burgdorferi in the urine of patients with active Lyme disease. Infect Immun 59:269–278 7. Guy EC, Stanek G (1991) Detection of Borrelia burgdorferi in patients with Lyme diseases by polymerase chain reaction. J Clin Pathol 44:610–611 8. Hansen K, Bangsborg JM, Fjordvang H, Pedersen NS, Hindersson P (1988) Immunochemical characterization of and isolation of the gene for a Borrelia burgdorferi immunodominant
60-kilodalton antigen common to a wide range of bacteria. Infect Immun 56:2047–2053 9. Hofmann H (1996) Lyme borreliosis – problems of serological diagnosis. Infection 24:470–472 10. Ibba M, Losey HC, Kawarabayasi Y, Kikuchi H, Bunjun S, So¨ll D (1999) Substrate recognition by class I lysyl-tRNA synthetases: a molecular basis for gene displacement. Proc Natl Acad Sci U S A 96:418–423 11. Ibba M, Bono JL, Rosa PA, So¨ll D (1997) Archaeal-type lysyltRNA synthetase in the Lyme disease spirochete Borrelia burgdorferi. Proc Natl Acad Sci U S A 94:14383–14388 12. Ibba M, Morgan S, Curnow AW, Pridmore DR, Vothknecht UC, Gardner W, Lin W, Woese CR, So¨ll D (1997) A euryarchaeal lysyl-tRNA synthetase: resemblance to class I synthetases. Science 278:1119–1122 13. Keller TL, Halperin JJ, Whitman M (1992) PCR detection of Borrelia burgdorferi DNA in cerebrospinal fluid of Lyme neuroborreliosis patients. Neurology 42:32–42 14. Lebech A-M, Hansen K (1992) Detection of Borrelia burgdorferi DNA in urine samples and cerebrospinal fluid samples from patients with early and late Lyme neuroborreliosis by polymerase chain reaction. J Clin Microbiol 30:1646–1653 15. Lebech A-M, Hindersson P, Vuust J, Hansen K (1991) Comparison of in vitro culture and polymerase chain reaction for detection of Borrelia burgdorferi in tissue from experimentally infected animals. J Clin Microbiol 29:731–737 16. Lu¨nemann JD, Zarmas S, Priem S, Franz J, Zschenderlein R, Aberer E, Klein R, Schouls L, Burmester GR, Krause A (2001) Rapid typing of Borrelia burgdorferi sensu lato species in specimens from patients with different manifestations of Lyme borreliosis. J Clin Microbiol 39:1130–1133 17. Rijpkema S, Golubic D, Molkenboer M, Verbeek-De Kruif N, Schellekens J (1996) Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp Appl Acarol 20:23–30 18. Schwartz I, Wormser GP, Schwartz JJ, Cooper D, Weissensee P, Gazumyan A, Zimmermann E, Goldberg NS, Bittker S, Campbell GL, Pavia CS (1992) Diagnosis of early Lyme disease by polymerase chain reaction amplification and culture of skin biopsies from erythema migrans lesions. J Clin Microbiol 30:3082–3088 19. Steere AC (1989) Lyme disease. N Engl J Med 321:586–596 20. Theisen M, Borre M, Mathiesen MJ, Mikkelsen B, Lebech AM, Hansen K (1995) Evolution of the Borrelia burgdorferi outer surface protein OspC. J Bacteriol 177:3036–3044 21. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673– 4680 22. Dam AP van, Kuiper H, Vos K, Widjojokusumo A, Jongh BM de, Spanjaard L, Ramselaar AC, Kramer MD, Dankert J (1993) Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme borreliosis. Clin Infect Dis 17:708–717 23. Wang G, Dam AP van, Dankert J (2000) Two distinct ospA genes among Borrelia valaisiana strains. Res Microbiol 151:325–331 24. Wilske B, Barbour AG, Bergstrom S, Burman N, Restrepo BI, Rosa PA, Schwan T, Soutschek E, Wallich R (1992) Antigenic variation and strain heterogeneity in Borrelia spp. Res Microbiol 143:583–596
