Different temporal gene expression patterns for ovine pre-implantation embryos produced by parthenogenesis or in vitro fertilization

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/44582080

Different temporal gene expression patterns of ovine pre-implantation embryos produced by parthenogenesis or in vitro fertilization ARTICLE in THERIOGENOLOGY · MAY 2010 Impact Factor: 1.8 · DOI: 10.1016/j.theriogenology.2010.03.024 · Source: PubMed

CITATIONS

READS

10

101

8 AUTHORS, INCLUDING: Daniela Bebbere

Federica Ariu

Università degli Studi di Sassari

Università degli Studi di Sassari

50 PUBLICATIONS 612 CITATIONS

29 PUBLICATIONS 246 CITATIONS

SEE PROFILE

SEE PROFILE

Giovanni Giuseppe Leoni

Fiammetta Berlinguer

Università degli Studi di Sassari

Università degli Studi di Sassari

87 PUBLICATIONS 1,287 CITATIONS

59 PUBLICATIONS 728 CITATIONS

SEE PROFILE

All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and read them immediately.

SEE PROFILE

Available from: Sara Succu Retrieved on: 03 February 2016

Available online at www.sciencedirect.com

Theriogenology 74 (2010) 712–723 www.theriojournal.com

Different temporal gene expression patterns for ovine pre-implantation embryos produced by parthenogenesis or in vitro fertilization Daniela Bebberea,*, Luisa Boglioloa, Federica Ariua, Stefano Foisa, Giovanni Giuseppe Leonib, Sara Succuc, Fiammetta Berlinguerc, Sergio Leddaa a

b

Department of Veterinary Clinics and Pathology, University of Sassari, Sassari, Italy Department of Physiological, Biochemical and Cellular Science, University of Sassari, Sassari, Italy c Department of Animal Biology, University of Sassari, Sassari, Italy Received 12 October 2009; received in revised form 23 March 2010; accepted 25 March 2010

Abstract Parthenogenetic activation of the mammalian oocyte constitutes an essential step to a number of oocyte- or embryo-related technologies. Mammalian parthenotes are useful tools for studying the roles of paternal and maternal genomes in early mammalian development and are considered potential candidates for an ethical source of embryonic stem cells. We investigated the in vitro developmental competence of pre-implantation ovine embryos derived from in vitro fertilization (IVF) and parthenogenetic activation (PA) together with the expression of a panel of fourteen genes at different times of development. IVF and PA embryos showed similar developmental competence. No differences in gene expression were observed between PA and IVF two cell-stage embryos, while PA morulae showed a significantly higher expression of IGF2. At the blastocyst stage, parthenotes exhibited up-regulation of TP-1, CDC2, and IGF2 transcripts and significantly lower levels of AQP3, ATP1A1, H2A.Z, hsp90beta, and OCT4, while NANOG, BAX, CCNB1, CDH1, GAPDH, and IGF2R displayed similar expression patterns in the two groups. Our study indicates that oocyte parthenogenetic activation does not impair in vitro pre-implantation development to the blastocyst stage, but affects the gene expression status of the embryo after the activation of its own genome. © 2010 Elsevier Inc. All rights reserved. Keywords: Parthenogenesis; Gene expression; Ovine embryo

1. Introduction Parthenogenesis, the process of embryogenesis without fertilization, naturally occurs in several non-mammalian species and may be induced in mammals. Mammalian parthenotes are able to undergo several cycles of cell

* Corresponding author. Tel.: 0039 079 229428; fax: 0039 079 229429. E-mail address: [email protected] (D. Bebbere). 0093-691X/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2010.03.024

division after oocyte activation, but never proceed to term, arresting at different stages of development, depending on the species [1– 4]. Parthenogenesis of the oocyte is essential to a number of oocyte- or embryo-related technologies such as intracytoplasmic sperm injection and cloning by nuclear transfer. During their in vitro development to the blastocyst stage, parthenotes are comparable to embryos and therefore may be useful tools for any research aimed at investigating culture conditions, differ-

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

ent treatment options, exposure to chemicals, and many variables of the laboratory routine [5]. Moreover, the analysis of parthenotes is a classical way of identifying and characterizing novel imprinted genes that may contribute to mammalian phenotypes displaying parent of origin effects [6 – 8]. Recently, parthenogenesis has attracted wide attention because of the potential for deriving pluripotent lines. Embryonic stem cells (ESCs), typically derived from the inner cell mass (ICM) of the mammalian blastocyst, are in fact of fundamental value for developmental research and both cell and tissue replacement therapy. However, the development of human ESC based clinical therapies has hitherto been limited because of the ethical dilemma involving the destruction of a human embryo. Parthenogenesis is emerging as an ideal solution to overcome these ethical problems. Several studies have described the isolation of ESC from mammalian parthenotes [9 –12]. To what extent such cells are equivalent to embryonic cells is, however, yet to be investigated. In this context, it is desirable to gain a better understanding of the molecular events occurring during the first phases of parthenotes development. The present study focuses on the gene expression status and on the developmental competence of ovine pre-implantation embryos produced by parthenogenetic activation (PA) and in vitro fertilization (IVF). The expression of a panel of fourteen genes was analysed in 2 cell-stage embryos, morulae and blastocysts. Among the analysed genes, OCT4 was previously unreported in the ovine species. The use of an animal model for gene expression profiling offers a cue for the validation of systems that may be successively applied in humans. 2. Materials and methods All chemicals in this study were purchased from Sigma Chemical CO. (St. Louis, MO, USA) unless stated otherwise. 2.1. Source of oocytes and in vitro maturation Adult (4 – 6 yr old) ovine ovaries (Sarda sheep) were collected at local slaughterhouses and transported to the laboratory within 1–2 h in Dulbecco Phosphate Buffered Saline (PBS) with antibiotics. Collection of cumulus-oocyte complexes (COCs) was performed in sterile Petri dishes containing 20 mM Hepes-buffered TCM 199 supplemented with 0.1% (w/v) polyvinyl alcohol and antibiotics. Only COCs showing several intact cumulus cell layers and compacted cytoplasm were se-

713

lected and matured in vitro in TCM 199 supplemented with 10% heat-treated oestrus sheep serum (OSS), 10 ␮l/ml FSH/LH and 100 ␮M cysteamine. Thirty to thirty-five COCs were cultured for 24 h in 5% CO2 in air at 38.5 °C in four-well petri dishes (Nunclon, Nalge Nunc International, Denmark) with 600 ␮l of maturation medium, layered with 300 ␮l of mineral oil. 2.2. In vitro fertilization (IVF) and parthenogenetic activation (PA) In vitro matured oocytes were divided in two groups and fertilized (group A) or activated (group B). IVF (group A): a group of in vitro matured oocytes was fertilized in SOF medium ⫹2% OSS for 22 h at 38.5 °C and 5% CO2, 5% O2 and 90% N2 atmosphere in four-well petri dishes (Nunclon). Frozen-thawed spermatozoa selected by swim-up technique (1 · 106 spermatozoa/ml) under mineral oil were used for all experimental procedures. IVF was carried in 5% CO2 and 5% O2 in N2, at 39 °C. PA (group B): a group of in vitro matured oocytes was activated with ionomycin (5 ␮M, 5 min) followed by 3 h culture in 2 mM 6-DMAP. Presumptive IVF and PA zygotes were separated in two groups to evaluate in vitro embryo development and to produce embryos for gene expression analysis. 2.3. In vitro embryo development IVF and PA zygotes were transferred separately and cultured for 7 d in four well petri dishes containing SOF ⫹ essential and non-essential amino acids at oviductal concentration [13] ⫹ 0.4% BSA under mineral oil, in maximum humidified atmosphere with 5% CO2, 5% O2, 90% N2 at 39 °C. The first cleavage was registered between 24 –26 h after the start of fertilization or activation. The newly formed blastocysts were recorded on the 7th day of culture. 2.4. Gene expression analysis For gene expression analysis, two more groups of IVF and PA zygotes were transferred separately and cultured for 7 d as described in section 2.3. Embryos at 2 cell-, morula, and blastocyst stage were collected for gene expression analysis 24 –26 h post-fertilization or -activation, at the 5th day and at the 7th day of culture, respectively. Five groups of eight embryos each were analysed for every class and every developmental stage. Each group was added to 2 ␮l of diethylpyrocarbonate (DEPC) treated water, snap frozen in liquid nitrogen, and stored at ⫺80 °C until further analysis.

714

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

2.4.1. Messenger RNA isolation and reverse transcription The poly(A) RNA was isolated with oligo (dT)25 attached magnetic beads (Dynal A.S. Oslo, Norway) following manufacturer’s instructions: 20 ␮l of Lysis Buffer (100 mM Tris-HCl pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% LiDS, 5 mM DTT) were immediately added to each tube, containing a group of 8 embryos. Samples were vortexed, briefly centrifuged, incubated at room temperature for 10 min, and added to 20 ␮l of Dynabeads oligo (dT)25. Tubes were shaken gently, incubated for 5 min at 25 °C, and put into a Dynal magnetic separator for 2 min. After removal of the supernatant, poly(A)⫹ RNAs were washed once with 80 ␮l of Washing Buffer A (10 mM Tris HCl pH 7.5, 0.15 M LiCl, 1 mM EDTA, 0.1% LiDS) and three times with 80 ␮l of Washing Buffer B (10 mM Tris HCl pH 7.5, 0.15 M LiCl, 1 mM EDTA). Poly(A)⫹ RNAs were then eluted from the magnetic beads by incubation in 11 ␮l of DEPC-treated water at 65 °C for 2 min, and aliquots were immediately used for Reverse Transcription Polymerase Chain Reaction (RT-PCR). Reverse-transcription reactions were performed in a final volume of 20 ␮l consisting of 50 mM Tris HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 5 mM DTT, 1 mM dNTPs, 2.5 ␮M of Random Hexamer primers (Invitrogen Corporation, Carlsbad, CA 92008), 20 U of RNase OUT™ (Invitrogen Corporation, Carlsbad, CA 92008) and 100 U of SuperScript™ III RT (Invitrogen Corporation, Carlsbad, CA 92008). The reaction tubes were incubated at 25 °C for 10 min, then at 42 °C for 1 h and finally at 70 °C for 15 min to inactivate the reaction. A tube without RNA and one with RNA, but without reverse transcriptase, were analysed as negative controls. 2.4.2. Real-time polymerase chain reaction The quantification of the transcripts was carried out by Real-Time PCR in a BioRad iCycler™ (Bio-Rad, USA). PCRs were performed in 25 ␮l reaction volume containing 12.5 ␮l 2x SYBR® GreenER qPCR SuperMix (Invitrogen Corporation, Carlsbad, 92008 CA), 200 nM of each primer and cDNA equivalent to 0.25 embryo. The PCR protocol involved two incubation steps (50 °C for 5 min and 95 °C for 2 min) followed by 40 cycles of amplification program [95 °C for 15 sec, gene specific annealing temperature (see Table 1) for 30 sec, 72 °C for 30 sec], a melting curve program (65–95 °C, starting the fluorescence acquisition at 65 °C and taking measurements every 10-s interval until the temperature reached 95 °C) and finally a cooling step to 4 °C. Fluorescence data were acquired during the 72 °C exten-

sion steps. The PCR products were then analysed by generating a melting curve, to check the specificity and identity of the amplification product. To minimize handling variation, all samples were run on the same plate, using a PCR master mix containing all reaction components apart from the sample. The sizes of the RT-PCR products were further confirmed by gel electrophoresis on a standard ethidium bromide stained 2% agarose gel and visualized by exposure to ultraviolet light. The PCR products were sequenced (Applied Biosystems, Model 3130 ⫻l Genetic Analyzer, Foster City, CA 94404 U.S.A.) after purification and sequence identities were confirmed by Basic Local Alignment Search Tool (BLAST) (www.ncbi.nlm.nih.gov/ BLAST/). PCR primers specific for all genes are listed in Table 1 and were designed on ovine sequences, except for OCT4 primers that were designed on the basis of bovine sequence. When possible, primers were designed to be intron spanning as an additional precaution against genomic DNA contamination. For each primer pair the efficiency of the PCR reaction was determined by building a calibration curve with serial dilutions of a known amount of template, covering at least 3 orders of magnitude, so that the calibration curve’s linear interval included the interval above and below the abundance of the targets. The amplification efficiency was determined from the slope of the log-linear portion of the calibration curve. Specifically, PCR efficiency ⫽ 10⫺1/slope-1, when the logarithm of the initial template concentration was plotted on the x axis and Cq {quantification cycle, also known as the threshold cycle (Ct) or crossing point (Cp) [14]} was plotted on the y axis. The theoretical maximum of 100% indicates that the amount of product doubles with each cycle. Only primers achieving an efficiency of reaction between 90 and 100% (3.6 ⬎ slope ⬎ 3.1) were used for the analysis. The relative quantification of all genes expression was performed with the 2-ddCq method [15]. The analysis was performed normalizing the target gene expression with the transcript levels of the internal reference gene ␤-actin. 2.5. Statistical analysis Data were analysed using MINITAB Release 12.1 software package. In vitro fertilization, parthenogenetic activation and embryo development data were analysed with Analysis of Variance (ANOVA) after arcsin transformation. After testing for normality and equal variance using respectively the Kolmogorov-Smirnov and Levene

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

715

Table 1 Primers used for Real Time PCR experiments. Gene

GenBank accession number

Sequence

Annealing temperature

ACTB

NM_001009784

60 °C

162

AQP3

AF123316

60 °C

119

ATP1A1

X02813

58 °C

129

BAX

AF163774

58 °C

219

BMP15

AF236078S2

59 °C

273

CCNB1

L26548

56 °C

134

CDC2

NM_001142508

56 °C

96

CDH1

NM_001002763

58 °C

155

GAPDH

AF030943

60 °C

93

H2A.Z

NM_001009270

56 °C

152

hsp90beta

AB072369

56 °C

143

IGF2

NM_001009311

60 °C

169

IGF2R

AF353513

60 °C

137

MATER

AY721594

59 °C

212

NANOG

DQ069776

56 °C

203

OCT4

NM_174580

56 °C

204

TP-1

NM_001123399

58 °C

160

ZAR1

XM_591835

5= ttcctgggtatggatcctg 3= 5= ggtgatctccttctgcatcc 3= 5= gggtgcccattgtctctcc 3= 5= caacttcacattctcctcgtc 3= 5= gctgacttggtcatctgcaa 3= 5= cattccagggcagtaggaaa 3= 5= aacatggagctgcagaggat 3= 5= ggacattggacttccttcga 3= 5= gggttctacgactccgcttc 3= 5= ggttactttcaggcccatcat 3= 5= cagtgtatgacaggtaatgc 3= 5= cgtagtccagcatagttagt 3= 5= tcctggtcagttcatggattc 3= 5= ctgtggagaactcttctagag 3= 5= tgtgactgtgatgggatcgt 3= 5= acccttctcctccgaacaag 3= 5= gaagactgtggatggcccctcc 3= 5= gttgagggcaatgccagcccc 3= 5= ctcaccgcagaggtacttg 3= 5= ctggtggtggtgtcattcc 3= 5= tggagatcaaccctgacca 3= 5= cttctcgcttgaggatccc 3= 5= accctccagtttgtctgtgg 3= 5= caagtccgagagggatgtgt 3= 5= cattacttcgagtggaggac 3= 5= atcaagaccagcggtgctta 3= 5= cagcctccaggagttctttg 3= 5= gacagcctaggagggtttcc 3= 5= gatctgcttattcaggacag 3= 5= tgcatttgctggagactgag 3= 5= gaggagtcccaggacatcaa 3= 5= ccgcagcttacacatgttct 3= 5= ctctgcactggactccaaca 3= 5= cgctgtatcccttctcttgc 3= 5= cactgcaaggactgcaatatc 3= 5= caggtgatatcctccactc 3=

60 °C

137

tests, the gene expression data were analysed with Analysis of Variance (ANOVA). Differences were considered to be significant when P ⬍ 0.05. 3. Results

Size (bps)

BLAST; 05/02/2009) that confirmed the homology with the orthologous genes present in public databases (Fig. 1). The analyzed fragment within OCT4 gene shares 99% homology with the bovine sequence (NM_174580.1), 96% with the porcine (NM_001113060.1), 92% with the human (NM_002701.4), and 87% with mouse gene (NM_013633.2).

3.1. Embryo development In vitro embryo development of IVM oocytes after IVF or PA is described in Table 2. No significant differences were observed between the two classes of embryos. 3.2. Gene expression analysis The sequence obtained in sheep for OCT4 was analyzed with BLAST (http://www.ncbi.nlm.nih.gov/

Table 2 In vitro embryo development of IVM oocytes after IVF or PA. Blastocyst yield percentages are calculated on the basis of the cleaved embryos (a) and on the basis of the initial number of oocytes (b). MII oocytes IVF PA

256 182

2C (%)

Blastocysts (%)

228 (89%) 170 (93.4%)

138 (60.5%a–53.9%b) 105 (61.7%a–57.7%b)

No significant difference was observed between the two classes.

716

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

Fig. 1. Fragment of ovine OCT4 cDNA sequence and homology with orthologous genes. The analysed sequence shares 99% homology with the bovine (NM_174580.1), 96% with the porcine (NM_001113060.1), 92% with the human (NM_002701.4) and 87% with murine gene (NM_013633.2). Homologous sequences are highlighted in grey.

The panels of genes analyzed in the three points of pre-implantation development differ slightly because some transcripts are expressed in a stage-specific manner. Maternal effect bone morphogenetic protein 15 (BMP15), maternal antigen that embryo requires (MATER) and zygote arrest 1 (ZAR1) have been analysed only in 2-cell stage embryos as they are not expressed in morulae and blastocysts [16]. Interferon-␶ (TP-1) expression starts at the blastocyst stage [17], hence its analysis was performed only at this stage of development. Finally, the expression of Aquaporin 3 (AQP3) and homeobox transcription factor Nanog (NANOG) was detected only in morulae and blastocysts. The relative quantification of the transcripts showed no differences between the IVF and PA 2C stage embryos (Fig. 2).

At the morula stage, only insulin-like growth factor 2 (IGF2) displayed a different behavior in the two classes (Fig. 3), with the transcript being detected in 4 out of 5 pools of PA embryos and in 1 out of 5 pools of IVF morulae (Fig. 4). At the blastocyst stage, AQP3, alpha 1 polypeptide of the Na/K-ATPase (ATP1A1), histone H2A.Z (H2A.Z), 90-kDa heat shock protein beta (hsp90beta) and OCT4 are significantly more expressed in the IVF embryos, while TP-1, cell division cycle 2, G1 to S and G2 to M (CDC2) and IGF2 are more abundant in the PA blastocysts. NANOG, Bcl2-associated protein Bax (BAX), Cyclin B1 (CCNB1), E-cadherin (CDH1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and insulin-like growth factor 2 receptor (IGF2R) showed no difference in the two analyzed groups (Fig. 5).

Fig. 2. Relative gene expression in IVF (light dotted column) and PA (dark grey column) 2 cell-stage embryos. Relative abundance values are expressed as ddCq and show the mean value ⫾ SEM of the five replicates for each group.

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

717

Fig. 3. Relative gene expression in IVF (light dotted column) and PA (dark grey column) morulae. Relative abundance values are expressed as ddCq and show the mean value ⫾ SEM of the five replicates for each group. Asterisks indicate a significant difference of relative mRNA abundance between the two classes (* P ⬍ 0.01).

4. Discussion Our study provides novel information on the gene expression status of ovine IVF and PA embryos at different stages of in vitro pre-implantation development. We have analyzed the expression of a panel of genes previously associated with developmental competence [18 –20] that are involved in different mechanisms, such as regulation of transcription and cell pluripotency (NANOG and OCT4), pregnancy recognition (TP-1), stress defense (hsp90beta and BAX), histone composition (H2A.Z), regulation of growth (IGF2 and IGF2R) and cell cycle (CDC2 and CCNB1), compaction (CDH1), cavitation (AQP3) and metabolism (ATP1A1 and GAPDH). The existence of one of the selected genes, namely OCT4, was previously unreported in the ovine species. The analysis of specific transcripts as indicators of the overall gene expression status has been widely reported in oocytes and embryos [21–27].

The relative abundance of the genes was determined at distinct time points of ovine preimplantation development, consisting of 2 cell-, morula, and blastocyst stage. No differences were observed between the IVF and PA embryos at the 2 cell-stage. Except for the expression status of IGF2, morulae seem to be predominantly unaffected as well. Conversely, at the blastocyst stage 8 of the 14 analysed genes show significantly different abundance. This suggests that activation of sheep eggs with diverse signals does not affect evidently initial development, but exerts effects on the embryo after the activation of its own genome, as cellular differentiation begins. In mouse, differences in gene expression between PA and IVF embryos were observed as early as the late one-cell stage [28]. The reason for this discrepancy probably lies in the timing of embryo genome activation (EGA). In mouse, EGA occurs at the two cell stage (even if transcription is first

Fig. 4. RT-PCR of IGF2 (A) and ACTB (B) in IVF (lanes 1–5) and PA (lanes 6 –10) sheep morulae. Each lane represents a different pool of eight embryos. Additional lanes contain no template control (Lane 11), no RNA control (Lane 12), Molecular Weight Marker TrackIt™ ⌽X RF 174 DNA/Hae III Fragment (Invitrogen, Carlsbad, CA 92008; Lane M), genomic DNA control (Lane 13) and adult ovary cDNA-positive control (Lane 14).

718

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

Fig. 5. Relative gene expression in IVF (light dotted column) and PA (dark grey column) blastocysts. Relative abundance values are expressed as ddCq and show the mean value ⫾ SEM of the five replicates for each group. A: Differentially expressed genes. B: Not differentially expressed genes. Asterisks indicate a significant difference of relative mRNA abundance between the two classes (* P ⬍ 0.05 , ** P ⬍ 0.01).

detected in the male pronucleus prior to nuclear fusion), that is, early during the cleavage period and long before the first differentiation at the blastocyst stage [29]. In sheep, EGA spans over several cell cycles, with a weak transcriptional activity from the end of the 1-cell stage and a major transcriptional activation at 8 –16 cell stage [30]. This implies a longer reliance on maternally inherited information and a shortened delay between EGA and cell differentiation compared to mouse, possibly explaining the different reaction at the transcriptional level following PA. Considering the functions of the analysed genes, transcripts involved in the same mechanisms are differently affected in the parthenotes. PA blastocysts exhibit up-regulation of CDC2, the catalytic subunit of the enzymatic complex Maturation Promoting Factor (MPF; [31]) that controls the succession of the meiotic cycle, but not of its regulatory subunit CCNB1. In parallel, the IGF system is partially affected, with the up-regulation of IGF2 and the regular expression of its receptor IGF2R. Such different behaviour is encoun-

tered also in genes regulating pluripotency, as OCT4 shows significant down-regulation, but NANOG shows a correct abundance. The up-regulation of TP-1 in the PA blastocysts is the most striking difference we have observed. Produced by the conceptus, TP-1 is the primary signal necessary for the establishment of pregnancy in ruminant species [32]. Its production begins at the blastocyst stage [17] and reaches its peak before uterine attachment, when luteal regression must be blocked to maintain the pregnancy [33]. TP-1 secretion varies greatly between individual blastocysts, and although several parameters were shown to modulate its secretion [34 – 38,24 –26], it is yet unclear if its expression level at the blastocyst stage is an indicator of developmental competence. Bovine PA [39,40] and female blastocysts [36,40] secrete significantly more TP-1 than their male counterparts. Larson and coauthors [36] suggested a mechanism where female blastocysts produce higher levels of TP-1 to offset the advantage of male embryos [41] in nutritionally enriched uterine environments. The higher abundance of TP-1 we detected in parthenotes is consistent with this gender bias, suggesting that the up-regulation of TP-1 expression may not depend on the lack of paternal genetic contributions. In addition, as the regulation of TP-1 secretion was shown to depend on the control of IGF1 and IGF2 levels [42], the increase in TP-1 transcription may be associated with the up-regulation of IGF2 observed in PA blastocysts. It is likely that OCT4 is the gene mainly affecting embryonic cell developmental potential. Also known as Pou5f1, this gene is a nuclear transcription factor required for the maintenance of cell pluripotency and involved in the regulation of expression of several genes [43]. Its mRNA distribution in cleavage stage blastomeres and in the ICM of the blastocyst is conserved in mouse [44], human [45], bovine, and swine [46], confirming OCT4 conserved transcriptional downregulation on differentiation among mammals. OCT4 orthologs show high homology of both protein sequence and regulatory regions [47]. The sequence of OCT4 fragment we obtained in sheep confirms high homology with the bovine (99%), porcine (96%), human (92%), and mouse (87%) genes. We detected a lower abundance of the transcript in PA blastocysts compared to IVF blastocysts, in accordance with the observation made by Gomez et al [39] in bovine. This down-regulation may be crucial when considering PA cells for deriving ESCs, in view of the fact that mouse blastocysts with low or absent OCT4 do not give rise to ES cells [48]. Moreover, even if successfully estab-

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

lished, ESCs may inherit the blastocyst low levels of OCT4 that could constitute a detrimental legacy for further development. Any increase or decrease was seen to trigger differentiation to endoderm/mesoderm or trophectoderm, respectively, with the threshold for inducing differentiation set at 30% above or below the normal diploid expression level in undifferentiated stem cells [49]. If differentiation in sheep is regulated by similar mechanisms, the 35% decrease (0.433 Ct) in OCT4 transcript level we observed in PA blastocyst may significantly affect differentiation. The role of OCT4, however, is more sophisticated than that of a simple repressor of trophectodermal differentiation, since it regulates expression of multiple genes, directly or via interaction with other transcription factors [50 –55]. An abnormal OCT4 abundance may cause aberrant expression of other genes, leading to possible anomalies at various developmental stages. In light of this, the abnormal level of TP-1 and H2A.Z in PA embryos may be associated with OCT4 downregulation, in accordance with the influence exerted by OCT4 on trophectoderm-specific genes in the bovine [56] and on H2A.Z in mouse [57]. The amount of such transcription factor should therefore be tightly monitored when considering embryonic cells as a source for stem-cells. The formation of the fluid-filled blastocyst that concludes mammalian preimplantation development is dependent on the establishment of trophoblast (TE) ion and fluid transport mechanisms [58]. AQP3 is a transmembrane channel protein that allows water and small solutes to flow rapidly across the membrane in the direction of osmotic gradients [59]. Its expression increases at the morula– blastocyst transition [60,61] and, during blastocyst cavitation, it enhances a rapid nearisosmotic fluid transport across the TE [58]. AQP3 activity during blastocyst formation is linked to CDH1 and Na/K-ATPase functions. In fact, the differentiation of the TE at the morula stage depends on the cell– cell adhesion mediated by CDH1. This protein coordinates maturation of the tight junctions and cellular polarity, resulting in the formation of distinct apical and basolateral membrane domains within the TE cell layer [62,63]. Concurrently, Na/K-ATPase energizes the establishment of the trans-TE ionic gradients within the basolateral membrane of the TE [64,65]. As a matter of fact, the inhibition of Na/K-ATPase pump blocks blastocyst formation in vitro [65,66]. We observed a downregulation of AQP3 and ATP1A1, the alpha 1 subunit of Na/K-ATPase, in PA blastocyst, but a regular expression of CDH1. These results are in partial agreement

719

with a previous work showing a regular expression of ATP1A1 and CDH1 in bovine parthenotes [39], possibly because of species- or culture-specific differences. It has been postulated that epigenetic asymmetry is the main reason why artificial mammalian parthenotes are unable to develop to term [67]. Bi-parental reproduction is in fact normally needed to achieve the nonequivalent expression of imprinted genes from the maternal and paternal alleles. The correct parent-specific expression of imprinted genes is not always maintained in uniparental fetuses, possibly because both parental genomes are necessary for establishing the parental origin-dependent expression [68,69]. In our experiments, no difference in IGF2R expression were observed between IVF and PA embryos in any of the examined pre-implantation stages, in accordance with a previous study [70] and confirming IGF2R biallelic expression during pre-implantation in sheep. Conversely, the analysis of IGF2 describes a different picture. IVF and PA 2 cell-stage embryos display similar abundance. On the contrary, IGF2 was detected in most of the parthenogenetic morulae, but only in few IVF ones, suggesting an earlier activation of IGF2 transcription in parthenotes. The transcript was detected in both IVF and PA blastocysts, but a significantly higher abundance was observed in the parthenotes. Since IGF2, when imprinted, is expressed by the paternal allele [71], the presence of IGF2 transcript in PA embryos suggests a biallelic expression at this stage of development. The biallelic expression of both IGF2 and IGF2R is consistent with the hypothesis of an association between the monoallelic expression of imprinted genes and the process of implantation rather than blastocyst formation, as seen in mouse [72] and bovine [6,73]. In fact, although it has been widely believed that, following establishment of imprinting in the gametes, imprints are maintained throughout development [74 –77], recent research suggests that monoallelic expression may not be required for most imprinted genes during preimplantation development, especially in ruminants [70,78]. Our data on IGF2 are in contrast with a previous study [70] that failed to detect the expression of IGF2 in a pool of five IVP sheep blastocysts. Because we analysed an intron-spanning fragment from the 8th to the 9th exon of IGF2 gene, we can exclude the possibility of a false positive due to genomic DNA contamination in the RTPCR reactions. The discrepancy between previous results [70] and our results may be explained by the different analysed segment: while our primers are located on the 8th and 9th exon, Thurston et al [70] amplified a region span-

720

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

ning from the 8th to the 10th exon. Among the multiple IGF2 transcripts of different sizes documented in various species [79 – 81], a few miss exon 10 [82]. The primer pair used in the present work may detect a truncated transcript containing the 8th and 9th, but not the 10th exon, which the primers used by Thurston and collaborators [70], would fail to amplify. Further studies are required to investigate whether the abnormal level of IGF2 transcript in the parthenogenetic blastocysts is a hint of an overall disrupted epigenetic status of the embryo, potentially inherited by ESCs. Epigenetic instability was seen in mouse [83,84] and to some extent in monkey ESCs [12,85], while human ESCs appeared relatively stable [86]. In any case, a correct genomic imprinting could be unnecessary at this stage of development, when a functional placenta is still not formed and the expression of genes imprinted during further development is still biallelic. In this case, parthenogenetic blastocysts would serve as a source of stem cells, but not for implantation. The degree to which abnormal imprinting constitutes an obstacle for the therapeutic use of ESCs must await the outcome of transplantation studies. The results of this study indicate that the oocyte PA does not impair pre-implantation development to the blastocyst stage, but exerts effects on the gene expression status of the embryo after the activation of its own genome, as cellular differentiation begins. This condition may be due to the absence of the paternal genome and/or the presence of two female ones. The alterations in gene expression following activation call for further studies in order to evaluate whether and to what extent these modifications are unfavourable for ESC establishment and successive transplantation therapies.

Acknowledgements The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work. The animal experiments were approved by the Animal Care and Use Committee of the University of Sassari. Supported by RAS (Special Project Biodiversity), Fondazione Banco di Sardegna and MIUR PRIN 2006. D. Bebbere participated in the design of the study, performed the gene expression and the statistical analysis, and drafted the manuscript. L. Bogliolo contributed to the design of the study and to the drafting of the manuscript and supervised the experiments on oocytes developmental competence and on parthenogenetic ac-

tivation. F. Ariu and S. Fois carried out the experiments on oocytes developmental competence and on parthenogenetic activation. G.G. Leoni helped with the gene expression and statistical analysis and revised the manuscript. S. Succu and F. Berlinguer helped with the experiments on oocytes developmental competence and with the revision of the manuscript. S. Ledda conceived the study, participated in its design and coordination and helped in drafting the manuscript. All co-authors provided inputs during manuscript preparation and approved the final article. References [1] Surani MA, Barton SC, Norris ML. Nuclear transplantation in the mouse: heritable differences between parental genomes after activation of the embryonic genome. Cell 1986;45:127–36. [2] Kure-bayashi S, Miyake M, Okada K, Kato S. Successful implantation of in vitro-matured, electro-activated oocytes in the pig. Theriogenology 2000;53:1105–19. [3] Loi P, Ledda S, Fulka J Jr, Cappai P, Moor RM. Development of parthenogenetic and cloned ovine embryos: effect of activation protocols. Biol Reprod 1998;58:1177– 87. [4] Fukui Y, Sawai K, Furudate M, Sato N, Iwazumi Y, Ohsaki K. Parthenogenetic development of bovine oocytes treated with ethanol and cytochalasin B after in vitro maturation. Mol Reprod Dev 1992;33:357– 62. [5] Paffoni A, Brevini TA, Gandolfi F, Ragni G. Parthenogenetic activation: biology and applications in the ART laboratory. Placenta 2008;29:121–5. [6] Ruddock NT, Wilson KJ, Cooney MA, Korfiatis NA, Tecirlioglu RT, French AJ. Analysis of imprinted messenger RNA expression during bovine preimplantation development. Biol Reprod 2004;70:1131–5. [7] Mizuno Y, Sotomaru Y, Katsuzawa Y, Kono T, Meguro M, Oshimura M, Kawai J, Tomaru Y, Kiyosawa H, Nikaido I, Amanuma H, Hayashizaki Y, Okazaki Y. Asb4, Ata3, and Dcn are novel imprinted genes identified by high-throughput screening using RIKEN cDNA microarray. Biochem Biophys Res Commun 2002;290:1499 –505. [8] Kono T, Obata Y, Wu Q, Niwa K, Ono Y, Yamamoto Y, Park ES, Seo JS, Ogawa H. Birth of parthenogenetic mice that can develop to adulthood. Nature 2004;428:860 – 4. [9] Cibelli JB, Grant KA, Chapman KB, Cunniff K, Worst T, Green HL, Walker SJ, Gutin PH, Vilner L, Tabar V, Dominko T, Kane J, Wettstein PJ, Lanza RP, Studer L, Vrana KE, West MD. Parthenogenetic stem cells in nonhuman primates. Science 2002;295:819. [10] Mai Q, Yu Y, Li T, Wang L, Chen MJ, Huang SZ, Zhou C, Zhou Q. Derivation of human embryonic stem cell lines from parthenogenetic blastocysts. Cell Res 2007;17:1008 –19. [11] Cheng L. More new lines of human parthenogenetic embryonic stem cells. Cell Res 2008;18:215–7. [12] Dighe V, Clepper L, Pedersen D, Byrne J, Ferguson B, Gokhale S, Penedo MC, Wolf D, Mitalipov S. Heterozygous embryonic stem cell lines derived from nonhuman primate parthenotes. Stem Cells 2008;26:756 – 66. [13] Walker SK, Hill JL, Kleemann DO, Nancarrow CD. Development of ovine embryos in synthetic oviductal fluid containing

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

amino acids at oviductal fluid concentrations. Biol Reprod 1996;55:703– 8. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 2009;55:611–22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta Delta CT Method. Methods 2001;25:402– 8. Bebbere D, Bogliolo L, Ariu F, Fois S, Leoni GG, Tore S, Succu S, Berlinguer F, Naitana S, Ledda S. Expression pattern of zygote arrest 1 (ZAR1), maternal antigen that embryo requires (MATER), growth differentiation factor 9 (GDF9) and bone morphogenetic protein 15 (BMP15) genes in ovine oocytes and in vitro-produced preimplantation embryos. Reprod Fertil Dev 2008;20:908 –15. Farin CE, Imakawa K, Hansen TR, McDonnell JJ, Murphy CN, Farin PW, Roberts RM. Expression of trophoblastic interferon genes in sheep and cattle. Biol Reprod 1990;43:210 – 8. Leoni GG, Bebbere D, Succu S, Berlinguer F, Mossa F, Galioto M, Bogliolo L, Ledda S, Naitana S. Relations between relative mRNA abundance and developmental competence of ovine oocytes. Mol Reprod Dev 2007;74:249 –57. Succu S, Bebbere D, Bogliolo L, Ariu F, Fois S, Leoni GG, Berlinguer F, Naitana S, Ledda S. Vitrification of in vitro matured ovine oocytes affects in vitro pre-implantation development and mRNA abundance. Mol Reprod Dev 2008;75:538 – 46. Wrenzycki C, Herrmann D, Lucas-Hahn A, Korsawe K, Lemme E, Niemann H. Messenger RNA expression patterns in bovine embryos derived from in vitro procedures and their implications for development. Reprod Fertil Dev 2005;17:23–35. Knijn HM, Wrenzycki C, Hendriksen PJ, Vos PL, Herrmann D, van der Weijden GC, Niemann H, Dieleman SJ. Effects of oocyte maturation regimen on the relative abundance of gene transcripts in bovine blastocysts derived in vitro or in vivo. Reproduction 2002;124:365–75. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P. Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality. Mol Reprod Dev 2002;61: 234 – 48. Rizos D, Gutierrez-Adan A, Moreira P, O’Meara C, Fair T, Evans AC, Boland MP, Lonergan P. Species-related differences in blastocyst quality are associated with differences in relative mRNA transcription. Mol Reprod Dev 2004;69:381– 6. Wrenzycki C, Herrmann D, Carnwath JW, Niemann H. Alternations in the relative abundance of gene transcripts in preimplantation bovine embryos cultured in medium supplemented with either serum or PVA. Mol Reprod Dev 1999;53:8 –18. Wrenzycki C, Herrmann D, Keskintepe L, Martins A, Sirisathien S, Brackett B, Niemann H. Effects of culture system and protein supplementation on mRNA expression in pre-implantation bovine embryos. Hum Reprod 2001a;16:898 –901. Wrenzycki C, Wells D, Herrmann D, Miller A, Oliver J, Tervit R. Nuclear transfer protocol affects messenger RNA expression patterns in cloned bovine blastocysts. Biol Reprod 2001;65: 309 –17. Wrenzycki C, Herrmann D, Niemann H. Timing of blastocyst expansion affects spatial messenger RNA expression patterns of genes in bovine blastocysts produced in vitro. Biol Reprod 2003;68:2073– 80.

721

[28] Vassena R, Han Z, Gao S, Baldwin DA, Schultz RM, Latham KE. Tough beginnings: Alterations in the transcriptome of cloned embryos during the first two cell cycles. Dev Biol 2007; 304:75– 89. [29] Schultz RM. From egg to embryo: a peripatetic journey. Reproduction 2005;130:825– 8. [30] Telford NA, Watson AJ, Schultz GA. Transition from maternal to embryonic control in early mammalian development: a comparison of several species. Mol Reprod Dev 1990;26:90 –100. [31] Gautier J, Minshull J, Lohka M, Glotzer M, Hunt T, Maller JL. Cyclin is a component of maturation-promoting factor from Xenopus. Cell 1990;60:487–94. [32] Bazer FW, Spencer TE, Ott TL. Interferon-tau: A novel pregnancy recognition signal. Am J Reprod Immunol 1997;37:412–20. [33] Ashworth CJ, Bazer FW. Changes in ovine conceptus and endometrial function following asynchronous embryo transfer or administration of progesterone. Biol Reprod 1989;40:425–33. [34] Kubish HM, Larson MA, Ealy AD, Murphy CN, Roberts RM. Genetic and environmental determinants of interferon-␶ secretion by in vivo- and in vitro-derived bovine blastocysts. Animal Reprod Sci 2001;66:1–3. [35] Larson MA, Kubisch HM. The effects of group size on development and interferon-␶ secretion by in vitro fertilized and cultured bovine blastocysts. Hum Reprod 1999;14:2075–9. [36] Larson MA, Rimura K, Kubisch HM, Roberts RM. Sexual dimorphism among bovine embryos in their ability to make the transition to expanded blastocyst and in the expression of the signaling molecole IFN-tau. Proc Natl Acad Sci USA 2001;98: 9677– 82. [37] Neira JA, Tainturier D, L’Haridon RM, Martal J. Comparative IFN-tau secretion after hatching by bovine blastocysts derived ex vivo and completely produced in vitro. Reprod Domest Anim 2007;42:68 –75. [38] Stojkovic M, Buettner M, Zakhartchenko V, Riedl J, Reichenback H-D, Wenigerkind H, Brem G, Wolf E. Secretion of interferon-tau by bovine embryos in long-term culture: comparison of in vivo derived, in vitro produced, nuclear transfer and demi-embryos. Anim Reprod Sci 1999;55:151– 62. [39] Gómez E, Gutiérrez-Adán A, Díez C, Bermejo-Alvarez P, Muñoz M, Rodriguez A, Otero J, Alvarez-Viejo M, Martín D, Carrocera S, Caamaño JN. Biological differences between in vitro produced bovine embryos and parthenotes. Reproduction 2009;137:285–95. [40] Kubish MH, Rasmussen TA, Johnson KM. Interferon-␶ in bovine blastocysts following parthenogenetic activation of oocytes: pattern of secretion and polymorphism in expressed mRNA sequences. Mol Reprod Dev 2003;64:79 – 85. [41] Enrights WJ, Spicer LJ, Kelly M, Culleton N, Prendiville DJ. Energy level in winter diets of fallow deer: Effect on plasma levels of insulin-like growth factor-1 and sex ration of their offspring. Small Rumin Res 2001;39:253–9. [42] Ko Y, Lee CY, Ott TL, Davis MA, Simmen RC, Bazer FW, Simmen FA. Insulin-like growth factors in sheep uterine fluids: concentrations and relationship to ovine trophoblast protein-1 production during early pregnancy. Biol Reprod. 1991;45:135– 42. [43] Boiani M, Schöler HR. Regulatory networks in embryo-derived pluripotent stem cells. Nat Rev Mol Cell Biol 2005;6:872– 84. [44] Palmieri SL, Peter W, Hess H, Scholer HR. Oct-4 transcription factor is differentially expressed in the mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation. Dev Biol 1994;166:259 – 67.

722

D. Bebbere et al. / Theriogenology 74 (2010) 712–723

[45] Hansis C, Grifo JA, Krey LC. Oct-4 expression in inner cell mass and trophectoderm of human blastocysts. Mol Hum Reprod 2000;6:999 –1004. [46] Kurosaka S, Eckardt S, McLaughlin JK. Pluripotent Lineage Definition in Bovine Embryos by Oct4 Transcript Localization. Biol Reprod 2004;71:1578 – 82. [47] Nordhoff V, Hubner K, Bauer A, Orlova I, Malapesta A, Scholer HR. Comparative analysis of human, bovine, and murine Oct-4 upstream promoter sequences. Mamm Genome 2001;12: 309 –17. [48] Boiani M, Eckardt S, Scholer HR, McLaughlin KJ. Oct4 distribution and level in mouse clones: consequences for pluripotency. Genes Dev 2002;16:1209 –19. [49] Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation, or self-renewal of ES cells. Nat Genet 2000;24:372– 6. [50] Ben-Shushan E, Thompson JR, Gudas LJ, Bergman Y. Rex-1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox-1, binding to an adjacent site. Mol Cell Biol 1998;18:1866 –78. [51] Botquin V, Hess H, Fuhrmann G, Anastassiadis C, Gross MK, Vriend G, Schöler HR. New POU dimer configuration mediates antagonistic control of an osteopontin preimplantation enhancer by Oct-4 and Sox-2. Genes Dev 1998;12:2073–90. [52] Liu L, Roberts RM. Silencing of the gene for the beta subunit of human chorionic gonadotropin by the embryonic transcription factor Oct-3/4. J Biol Chem 1996;27:16683–9. [53] Saijoh Y, Fujii H, Meno C, Sato M, Hirota Y, Nagamatsu S, Ikeda M, Hamada H. Identification of putative downstream genes of Oct-3, a pluripotent cell-specific transcription factor. Genes Cells 1996;1:239 –52. [54] Scholer HR. Octamania: the POU factors in murine development. Trends Genet 1991;7:323–9. [55] Zuccotti M, Merico V, Sacchi L, Bellone M, Brink TC, Bellazzi R, Stefanelli M, Redi CA, Garagna S, Adjaye J. Maternal Oct-4 is a potential key regulator of the developmental competence of mouse oocytes. BMC Dev Biol 2008;8:97. [56] Ezashi T, Ghosh D, Roberts RM. Repression of Ets-2-induced transactivation of the tau interferon promoter by Oct-4. Mol Cell Biol 2001;21:7883–91. [57] Du Z, Cong H, Yao Z. Identification of Putative Downstream Genes of Oct-4 by Suppression-Subtractive Hybridization. Biochem Biophys Res Commun 2001;282:701– 6. [58] Barcroft LC, Offenberg H, Thomsen P, Watson AJ. Aquaporin proteins in murine trophectoderm mediate transepithelial water movements during cavitation. Dev Biol 2003;256:342–54. [59] Hara-Chikuma M, Verkman AS. Aquaporin-3 functions as a glycerol transporter in mammalian skin. Biology of the Cell 2005;97:479 – 86. [60] Edashige K, Sakamoto M, Kasai M. Expression of mRNAs of the aquaporin family in mouse oocytes and embryos. Cryobiology 2000;40:171–5. [61] Offenberg H, Barcroft LC, Caveney A, Viuff D, Thomsen PD, Watson AJ. mRNAs encoding aquaporins are present during murine preimplantation development. Mol Reprod Dev 2000; 57:323–30. [62] Collins JE, Fleming TP. Epithelial differentiation in the mouse preimplantation embryo: making adhesive cell contacts for the first time. Trends Biochem Sci 1995;20:307–12. [63] Fleming TP, Sheth B, Fesenko I. Cell adhesion in the preimplantation mammalian embryo and its role in trophectoderm

[64]

[65]

[66]

[67] [68]

[69]

[70]

[71]

[72] [73]

[74]

[75]

[76] [77] [78]

[79]

[80]

[81]

differentiation and blastocyst morphogenesis. Front Biosci 2001;6:D1000 –7. Watson AJ, Kidder GM. Immunofluorescence assessment of the timing of appearance and cellular distribution of Na/K-ATPase during mouse embryogenesis. Dev Biol 1988;126:80 –90. Wiley LM. Cavitation in the mouse preimplantation embryo: Na/K-ATPase and the origin of nascent blastocoele fluid. Dev Biol 1984;105:330 – 42. Watson AJ, Westhusin ME, De Sousa PA, Betts DH, Barcroft LC. Gene expression regulating blastocyst formation. Theriogenology 1999;51:117–33. Brevini TA, Gandolfi F. Parthenotes as a source of embryonic stem cells. Cell Prolif 2008;41 Suppl 1:20 –30. Sotomaru Y, Kawase Y, Ueda T, Obata Y, Suzuki H, Domeki I, Hatada I, Kono T. Disruption of imprinted expression of U2afbp-rs/U2af1-rs1 gene in mouse parthenogenetic fetuses. J Biol Chem 2001;276:26694 – 8. Sotomaru Y, Katsuzawa Y, Hatada I, Obata Y, Sasaki H, Kono T. Unregulated expression of the imprinted genes H19 and Igf2r in mouse uniparental fetuses. J Biol Chem 2002;277:12474 – 8. Thurston A, Taylor J, Gardner J, Sinclair KD, Young LE. Monoallelic expression of nine imprinted genes in the sheep embryo occurs after the blastocyst stage. Reproduction 2008; 135:29 – 40. McLaren RJ, Montgomery GW. Genomic imprinting of the insulin-like growth factor 2 gene in sheep. Mamm Genome 1999;10:588 –91. Wang H, Dey SK. Roadmap to embryo implantation: clues from mouse models. Nat Rev Genet 2006;7:185–99. Tveden-Nyborg PY, Alexopoulos NI, Cooney MA, French AJ, Tecirlioglu RT, Holland MK, Thomsen PD, D’Cruz NT. Analysis of the expression of putatively imprinted genes in bovine peri-implantation embryos. Theriogenology 2008;70:1119 –28. Young LE, Fairburn HR. Improving the safety of embryo technologies: possible role of genomic imprinting. Theriogenology 2000;53:627– 48. Ferguson-Smith A, Lin SP, Tsai CE, Youngson N, Tevendale M. Genomic imprinting – insights from studies in mice. Semin Cell Dev Biol 2003;14:43–9. Murphy SK, Jirtle RL. Imprinting evolution and the price of silence. Bioessays 2003;25:577– 88. Delaval K, Feil R. Epigenetic regulation of mammalian genomic imprinting. Curr Opin Genet Dev 2004;14:188 –95. D’Cruz NT, Wilson K J, Cooney MA, Tecirlioglu RT, Lagutina I, Galli C, Holland MK, French AJ. Putative imprinted gene expression in uniparental bovine embryo models. Reprod Fertil Dev 2008;20:589 –97. Boulle N, Schneid H, Listrat A, Holthuizen P, Binoux M, Groyer A. Developmental regulation of bovine insulin-like growth factor-II (IGF-II) gene expression: homology between bovine transcripts and human IGF-II exons. J Mol Endocrinol 1993;11:117–28. van Dijk MA, van Schaik FMA, Bootsma HJ, Holthuizen P, Sussenbach JS. Initial characterization of the four promoters of the human insulin-like growth factor II gene. Mol Cell Endocrinol 1991;81:81–94. Amarger V, Nguyen M, Van Laere AS, Braunschweig M, Nezer C, Georges M, Andersson L. Comparative sequence analysis of the INSIGF2-H19 gene cluster in pigs. Mamm Genome 2002; 13:388 –98.

D. Bebbere et al. / Theriogenology 74 (2010) 712–723 [82] Curchoe C, Zhang S, Bin Y, Zhang X, Yang L, Feng D, O’Neill M, Tian XC. Promoter-specific expression of the imprinted IGF2 gene in cattle (Bos taurus). Biol Reprod 2005;73:1275– 81. [83] Dean W, Bowden L, Aitchison A, Klose J, Moore T, Meneses JJ, Reik W, Feil R. Altered imprinted gene methylation and expression in completely ES cell-derived mouse fetuses: Association with aberrant phenotypes. Development 1998;125:2273– 82. [84] Humpherys D, Eggan K, Akutsu H, Hochedlinger K, Rideout WM 3rd, Biniszkiewicz D, Yanagimachi R, Jaenisch R. Epige-

723

netic instability in ES cells and cloned mice. Science 2001; 293:95–7. [85] Mitalipov S, Clepper L, Sritanaudomchai H, Fujimoto A, Wolf D. Methylation status of imprinting centers for H19/IGF2 and SNURF/SNRPN in primate embryonic stem cells. Stem Cells 2007;25:581– 8. [86] Rugg-Gunn PJ, Ferguson-Smith AC, Pedersen RA. Epigenetic status of human embryonic stem cells. Nat Genet 2005;37: 585–7.