Dietary cholesterol does not normalize low plasma cholesterol levels but induces hyperbilirubinemia and hypercholanemia in Mdr2 P-glycoprotein-deficient mice

PHYSIOLOGICAL FUNCTIONS OF

BILIARY LIPID SECRETION

Research This thesis and the research described herein fulfill the requirements necessary to obtain a Doctorate in Medical Sciences, University of Groningen. Studies were conducted within the Groningen University Institute for Drug Exploration (GUIDE), Center for Liver, Digestive and Metabolic Diseases, Department of Pediatrics in the University Hospital Groningen from 1996-2000

Copyrights Permission was granted from the editors for including the articles printed in Chapter 2, 5, 7 and 8.

Funding The studies presented in this thesis were made possible by a grant from the Netherlands Organization for Scientific Research (NWO), Grant no. 902-23-097. Printing of this thesis was financially supported by the following: Groningen University Institute for Drug Exploration (GUIDE), Groningen, The Netherlands De Nederlandse Vereninging voor Hepatologie, Haarlem, The Netherlands Hope Farms B.V., Woerden, The Netherlands TRAMEDICO B.V., Weesp, The Netherlands UCB Pharma Nederland B.V., Breda, The Netherlands Janssen-Gilag B.V., Tilburg, The Netherlands ARC Laboratories B.V., Amsterdam, The Netherlands J.E. Jurriaanse Stichting, Rotterdam, The Netherlands Solvay Pharmaceuticals, Hannover, Germany Campro Scientific BV/Simac Diagnostica BV, Veenendaal, The Netherlands Their contribution is gratefully acknowledged.

Printer Ponsen & Looijen B.V., Wageningen, The Netherlands

Cover design Diamant nr.19: Van Opstal Micro-art, Tilburg, E-mail: [email protected], www.micro-art.nl

RIJKSUNIVERSITEIT GRONINGEN

Physiological Functions of Biliary Lipid Secretion

Proefschrift

ter verkrijging van het doctoraat in de Medische Wetenschappen aan de Rijksuniversiteit Groningen op gezag van de Rector Magnificus, dr. D.F.J. Bosscher, in het openbaar te verdedigen op woensdag 7 juni 2000 om 14:15 uur

door

Pieter Jacobus Voshol geboren op 14 februari 1969 te Vlissingen

Promotores Prof. dr. Folkert Kuipers Prof. dr. Roel J. Vonk Co-promotor Dr. Albert K. Groen Referent Dr. Henkjan J. Verkade

ISBN

90-367-1192-4

Promotion Committee Members Prof. dr. Louis M. Havekes, TNO-prevention and Health, Gaubius Laboratory, Leiden Dr. Ronald P.J. Oude Elferink, Department Gastroenterology, Academic Medical Center, Amsterdam Prof. dr. Pieter J.J. Sauer, Department of Pediatrics, University Hospital Groningen, Groningen Paranimfen Rick Havinga Aloys Sesink

Aan mijn ouders

“Got my Liver, got my blood.... I got Life” “I got Life”, Musical Hair, 1967

Table of contents Chapter 1: Chapter 2:

Chapter 3:

Chapter 4:

Chapter 5:

Chapter 6:

Chapter 7:

Chapter 8:

Chapter 9:

Chapter 10:

General introduction and scope of this thesis. Voshol PJ, R Havinga, H Wolters, R Ottenhoff, HMG Princen, RPJ Oude Elferink, AK Groen and F Kuipers. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-Glycoprotein-deficient mice. Gastroenterology 1998; 114: 1024-1034. Voshol PJ, NR Koopen, JML de Vree, R Havinga, HMG Princen, RPJ Oude Elferink, AK Groen and F Kuipers. Dietary cholesterol does not normalize low plasma cholesterol levels but induces hyperbilirubinemia and hypercholanemia in Mdr2 P-glycoprotein-deficient mice. (submitted). Voshol PJ, R Havinga, AK Groen and F Kuipers Increased hepatic VLDL production in the absence of hepatobiliary lipid secretion in Mdr2 P-glycoprotein-deficient mice. (submitted). Koopen NR, H Wolters, PJ Voshol, B Stieger, RJ Vonk, PJ Meier, F Kuipers and B Hagenbuch. Decreased Na+-dependent taurocholate uptake and low expression of sinusoidal Na+taurocholate cotransporting protein (Ntcp) in livers of mdr2 P-glycoprotein-deficient mice. Journal of Hepatology, 1999; 30: 14-21. Voshol PJ, CV Hulzebos, R Boverhof, Th Boer, JRM Baller, W Kramer, S Stengelin, AK Groen, HJ Verkade, F Stellaard and F Kuipers. Increased expression of the apical sodiumdependent bile salt transporter in liver and intestine of Mdr2 P-glycoprotein-deficient mice. (submitted). Voshol PJ, DM Minich, R Havinga, RPJ Oude Elferink, HJ Verkade, AK Groen and F Kuipers. Postprandial chylomicron formation and fat absorption in multidrug resistance gene-2 P-glycoprotein-deficient mice. Gastroenterology, 2000; 118: 173-182. Minich DM, PJ Voshol, R Havinga, F Stellaard, F Kuipers, RJ Vonk and HJ Verkade. Biliary lipids are not required for intestinal absorptionand plasma status of linoleic acid in mice. Biochimica et Biophysica Acta, 1999; 1441: 14-22. Voshol PJ, M Krieger, AK Groen and F Kuipers. Downregulation of intestinal scavenger receptor class B, type I (SR-BI) expression in rodents under conditions of deficient bile delivery to the intestinal lumen. (submitted). General discussion.

1 23

39

55

67

79

95

111

123

137

Summary Samenvatting Zusammenfassung

143 149 155

Dankwoord

161

Curriculum Vitae + Publication list

167

CHAPTER 1 General introduction

Chapter 1: General introduction

1 General Introduction Cholesterol fulfills various important biological functions in the body, for instance in membrane biogenesis, steroid hormone and bile salt biosynthesis and embryonic development [1-4]. These widespread functions imply that its supply to several organs must be maintained at appropriate levels. On the other hand, an excess of circulating cholesterol is a major risk factor for development of atherosclerosis, representing the single largest cause of mortality in the Western society [5-7]. Furthermore, hypersecretion of cholesterol into bile is a prerequisite for development of cholesterol gallstones, a disorder that affects 10-15% of the general population [8,9]. Cholesterol can be derived from dietary sources as well as from de novo synthesis. Practically all organs are capable of synthesizing the sterol, but liver and intestine appear to be the major organs involved [10]. Since cholesterol i s practically insoluble in aqueous compartments between organs, it is transported via the circulation in so-called lipoproteins. The various lipoprotein classes [11,12], i.e., chylomicrons, very low density lipoproteins (VLDL), intermediate density lipoprotein (IDL), low density lipoprotein (LDL) and high density lipoprotein (HDL) differ in size, lipid composition, apolipoprotein content and in metabolic functions [13,14]. It is well-established that high levels of LDL are associated with a increased risk for development of atherosclerosis, whereas high HDL levels reduce this risk [7,15-17]. The liver plays a central role in cholesterol metabolism and, thereby, in the maintenance of whole body cholesterol homeostasis [10,18]. The liver has at least four distinct functions in cholesterol homeostasis: 1. the liver is an important site for de novo synthesis of cholesterol [10]; 2. the liver is actively involved in uptake and in secretion of cholesterol-containing lipoproteins [13,14,19]; 3. the liver is the only organ capable of removing excess cholesterol from the body, namely via secretion into bile [20,21]. Biliary cholesterol secretion is coupled to that of phospholipids under normal physiological circumstances; 4. bile salts are synthesized from cholesterol [22-24] exclusively in the liver and not only represent its major ‘catabolic product’, but are also of crucial importance for secretion of cholesterol itself into bile and for absorption of dietary cholesterol and fatty acids from the intestine [25-27]. Data available so far indicate that these 4 functions are strongly interrelated but neither the quantitative importance hereof nor the molecular background of underlying regulatory mechanisms have completely been established. Work presented in this thesis relates to physiological functions of biliary cholesterol/phospholipid secretion with respect to plasma lipoprotein levels, bile salt metabolism and intestinal fat absorption. The following sections will provide short overviews of hepatic cholesterol metabolism, bile formation and lipoprotein metabolism, with special emphasis on aspects that are of relevance for the studies described in this thesis.

2

Physiological functions of biliary lipid secretion

2 Hepatic cholesterol metabolism 2.1 The liver. The liver is highly vascularized and receives blood from the portal vein (about 75%) and the hepatic artery (about 25%) [28]. Hepatocytes, or liver parenchymal cells, represent about 70% of the total number of cells in the liver [29]. Hepatocytes are arranged in one-cell thick layers along the sinusoids in lobules [28]. Both the portal vein and hepatic artery end in the liver capillaries (sinusoids) which, in turn, drain into the central or hepatic vein. Endothelial cells are lining the sinusoids and form the only barrier between the hepatocytes and sinusoidal blood. Blood can reach the hepatocytes through pores (fenestrae) in the endothelial cells. Hepatocytes secrete bile into the bile canaliculi [30], minute channels formed by the plasma membrane of two adjacent hepatocytes. Bile canaliculi branch and interconnect to form a continuous network draining into the bile ductuli [30]. These bile ductuli drain into the bile ducts and, finally, bile is stored in the gallbladder, at least in humans and mice. Rats, on the other hand, do not have a gallbladder. Finally, bile is secreted into the intestinal lumen via the common bile duct upon contraction of the gallbladder, which is evoked by the entry of (fat-containing) food into the duodenum. Cholangiocytes, lining the biliary ducts, are involved in several processes influencing bile composition [31,32], e.g., by their ability to perform water and bicarbonate excretion. Several transporter proteins have recently been identified in these cells, including the apical sodium-dependent bile salt transporter protein (ABST) [33] and cystic fibrosis transmembrane regulator (CFTR) [32,34]. Another important cell type in the liver is the Kupffer cell, which performs macrophage-like functions. 2.2 Cholesterol synthesis. A condensed overview of major routes in hepatic cholesterol metabolism i s depicted in figure 1. Cholesterol is synthesized from acetyl-Co enzyme A (CoA) in series of enzymatic steps that are mainly confined to the endoplasmic reticulum (ER) [35]. In the liver cholesterol synthesis occurs primarily in the periportal region [10]. The major rate-controlling enzyme in this pathway is 3-hydroxy-3methylglutaryl CoA (HMG-CoA) reductase [35-37], which represents the target of the statins [38,39], the widely used plasma cholesterol-lowering drugs that exert their actions through inhibition of cholesterol synthesis [38,40]. The regulation of cholesterol synthesis at molecular level has recently been elucidated, at least in part, by the group of Goldstein and Brown [41-43]. Control of cholesterol synthesis is exerted by the regulated release of so-called sterol regulatory element-binding proteins (SREBP’s), a novel family of transcription factors that are associated with the ER and the nuclear envelope membrane in a hairpin fashion [44]. In steroldepleted cells, SREBP is cleaved by specific proteases [42], released from the ER membrane and the active form is translocated to the nucleus. In the nucleus, the nuclear form of SREBP binds to specific sites in the promotor region of certain genes, including those encoding HMG-CoA reductase, LDL receptor (LDLR) and several others [43]. In cholesterol-loaded cells, SREBP remains membrane-bound and sterol synthesis and uptake from the circulation remain depressed. For a 3

Chapter 1: General introduction

detailed overview on SREBP-mediated regulation of cholesterol synthesis, the reader is referred to recent review articles [41-43]. Humans of average weight (~70 kg) synthesize 600-1200 mg of cholesterol per day while chow-fed mice produce approximately 1.5 mg per day. When expressed per kg body weight these values are, on average, 10 and 50 mg/day in humans and mice, respectively [10]. The amount of cholesterol synthesized per day in either species is approximately 2-3 times larger than their daily dietary cholesterol intake.

Figure 1: Condensed overview of the major steps involved in cholesterol metabolism.

4

Physiological functions of biliary lipid secretion

2.3 Bile salt biosynthesis. Conversion of cholesterol to bile salts also involves a series of enzymatic steps [22,24] and occurs predominantly in the hepatocytes located in the pericentral area [45,46]. There are two separate pathways that quantitatively contribute to bile salt biosynthesis in mammals [22,24]. The primary or neutral route is initiated by conversion of cholesterol to 7α-hydroxycholesterol by the rate-limiting enzyme cholesterol 7α-hydroxylase [47], whereas the alternative or acidic pathway i s initiated by side chain hydroxylation via sterol 27-hydroxylase [48,49]. Increased cellular cholesterol supply increases bile salts synthesis: recently is was shown that a hepatic orphan receptor (LXR), an oxysterol receptor, stimulates transcription of cholesterol 7α-hydroxylase and thereby stimulates bile salt synthesis [50] (Figure 1). Biosynthesis of bile salts is also regulated via a negative feedback mechanism exerted by bile salts returning to the liver during their flux through the enterohepatic circulation [51-54]. This regulation seems to involve both the neutral and acidic pathway of bile salt biosynthesis [46,55]. Recently, the feedback regulation of bile salt biosynthesis was shown to be mediated via the farnesoid receptor (FXR), for which bile salts have been identified as natural ligands [50,5658]. FXR was shown to be involved in transcriptional regulation of cholesterol 7αhydroxylase. Furthermore, FXR did not only down-regulate cholesterol 7αhydroxylase but also stimulated expression of intestinal bile acid-binding protein (IBABP) [58-60] which is thought to facilitate the transport of bile salts across the enterocytes, thus facilitating their return to the liver where they can exert feedback repression on bile salt synthesis. Recently, the intestinal transporter for intestinal uptake of conjugated bile salt in human, hamster, rabbit, rat and mouse was cloned [61-66]. The apical sodium-dependent bile salt transporter protein (abst), expressed mainly in the distal ileum, is considered to be responsible for the sodium-dependent uptake of bile salts. In literature, contradictory data have been published on the (potential) regulation of abst by bile salts. Some investigators find no effect of bile salt load on the expression of abst in rats [54], while others find induction of abst expression after bile salt feeding in rats [67]. Yet, another group showed a negative regulation of ileal bile salt transport upon bile salt feeding in guinea pigs [68]. Fecal bile salt loss amounts up to ~1 g per day in humans, which is only ~4% of the daily biliary bile salt delivery to the intestine [10], indicating that the enterohepatic circulation of bile salts is a very efficient process. The fecal loss of bile salts is compensated for by de novo synthesis to maintain bile salt pool size. 3. Lipoprotein metabolism 3.1 Lipoproteins Lipoproteins are the lipid carriers in the circulation and are, in general, composed of a hydrophobic core, containing triglycerides and cholesterol esters, surrounded by a relative polar surface consisting of phospholipids, free cholesterol and apolipoproteins. Based on their density, lipoproteins are classified a s chylomicrons, very low density lipoproteins (VLDL), intermediate density 5

Chapter 1: General introduction

lipoproteins (IDL), low density lipoproteins (LDL) and high density lipoproteins (HDL). The lipoproteins differ in size, lipid composition and apolipoprotein spectrum (Table 1) and all have specific metabolic functions [11,12]. The metabolic fate of lipoproteins is, to a large extent, determined by their apolipoprotein content [13,14,69]. Table 1: Physical properties, lipid and apolipoprotein composition of human lipoproteins [11,12]. Source Diameter (nm) Density (g/mL) Mobility* Composition (% by weight) Triglycerides Phospholipids Cholesterol esters Free cholesterol Protein Apolipoproteins

Chylomicronen intestine 75-1200 < 0.96 origin

VLDL liver 30-80 0.96-1.006 pre-β

IDL VLDL 25-35 1.006-1.019 slow pre-β

LDL VLDL 18-25 1.019-1.063 β

HDL liver/intestine 5-12 1.063-1.210 α

88 8 3

56 20 15

29 26 34

13 28 48

15 45 30

1 1-2 A1, A4, B48, C1, C2, C3, E

8 9 6-10 11 B100, C1, C2, B100, E C3, E

10 21 B100

10 45-55 A1, A2, E

The physical properties, lipid and apolipoprotein composition of very low density lipoproteins (VLDL), intermediate density lipoproteins (IDL), low density lipoproteins (LDL) and high density lipoproteins (HDL) is depicted. *According to the electrophoretic mobility of plasma α- and β-globulins on agarose gel.

3.2 Lipoprotein metabolism Lipoprotein metabolism can be divided into three distinct pathways, based on origin, function and fate of the lipid content of the particles involved [2]: (1) Exogenous lipid transport, describing the metabolic route of dietary lipids after their absorption from the intestine. (2) Endogenous lipid transport, describing the distribution of lipids from the liver to peripheral tissues, in particular relevant during periods of fasting. (3) Reverse cholesterol transport, reflecting transport of cholesterol from peripheral tissues to the liver. A condensed overview of metabolic routes for exogenous, endogenous lipid transport and the reverse cholesterol transport is depicted in figure 2. Exogenous lipid transport: Dietary lipids absorbed from the intestinal lumen are packaged into chylomicrons by intestinal cells and subsequently secreted via the mesenteric lymph into the bloodstream. The main core constituents of chylomicrons are triglycerides with apolipoprotein B48 as the major apolipoprotein at its surface. In the circulation, chylomicron-triglycerides are hydrolyzed by endothelium-bound lipoprotein lipase (LPL) [70], which allows delivery of free fatty acids to muscle and adipose tissue. Due to hydrolysis of the core lipids, chylomicron particles shrink and the excess of surface material, i.e., phospholipids, free cholesterol and apolipoproteins, are in part transferred to HDL particles [14]. The chylomicron remnants thus formed are rapidly taken up by the liver via a receptor-mediated process [71]. Endogenous lipid transport: Triglyceride-rich VLDL particles containing a single molecule of apolipoprotein B are secreted by the liver and provide energy-rich material to the periphery during periods of fasting. Another important 6

Physiological functions of biliary lipid secretion

apolipoprotein on VLDL is apoE, which plays an role in the secretion [72,73] a s well as in the metabolic fate of these VLDL particles, the latter due to its interaction with specific receptors [74]. The VLDL-triglycerides are hydrolyzed by LPL, a s described for the chylomicrons, leading to formation of VLDL remnants or IDL. IDL is either taken up by the liver via a receptor-mediated process or is further hydrolyzed to LDL. LDL can be taken up via several receptors. The mammalian LDL-receptor (LDLR) family comprises a considerable number of receptors which are characterized by several distinct functional domains [75,76]. Besides the well known LDLR, other members of this family include the LDLR-related protein (LRP), megalin, the VLDL-receptor (VLDLR) and several others [77-81]. Expression of most of these receptors is relative high in the liver but they are also expressed in other tissues (e.g., intestine, lung, brain, muscle and skin) [77,79]. The hepatic LDLR-mediated uptake of LDL accounts for approximately 70% of the removal of LDL from the circulation [82]. Reverse cholesterol transport: HDL is a relatively small lipoprotein involved in the transport of cholesterol from peripheral tissue towards the liver [83,84]. Nascent HDL particles, small discoidal particles lacking cholesteryl esters and containing apoA-I as their major apolipoprotein, are formed by the liver and the intestine [85]. Surface lipids for HDL can be acquired from chylomicrons and from VLDL. In addition, HDL also acquires free cholesterol from cell membranes of several tissues [86], which is then estrified by the enzyme lechitin: cholesterol acyl transferase (LCAT), yielding a hydrophobic core of cholesteryl esters. Insight in the mechanism of formation of cholesterol-rich HDL particles was recently greatly increased as the result of studies in patients with an inherited disease called Tangier disease (TD) [87-89]. TD is a rare genetic disorder that is characterized by near or complete absence of circulating HDL and by the accumulation of cholesteryl esters in several tissues. It was found that patients with TD as well a s patients with familial HDL-deficiency have a defect in the gene encoding ATPbinding cassette transporter 1 (ABC-1) [90,91]. ABC-1 appears to be involved in lipid transfer from cells towards nascent HDL particles [87-89,92,93] for subsequent transport to the liver. Cholesteryl esters from the HDL particles can be redistributed to other lipoproteins via the action of cholesteryl transfer protein (CETP) [94]. CETP is not expressed in rodents which may, in part, explain the high HDL levels found in these animals. If cholesteryl esters are transferred to VLDL, there is a concomitant transfer of triglycerides from VLDL to HDL. There is also an exchange of surface phospholipid between the different lipoproteins mediated by phospholipid transfer protein (PLTP) [95,96]. The cellular uptake of cholesteryl esters from VLDL, IDL and LDL is a receptor-mediated process including whole particle uptake [97]. Cholesteryl ester uptake from HDL seems to be a selective process in which only cholesteryl esters are transferred from the particle to the tissues without uptake of the particle itself [98,99]. Recently, scavenger receptor class B type 1 (SR-BI), mainly present in steroidogenic tissues and liver, was identified to mediate the selective cholesteryl ester-uptake from HDL [100-103]. Delivery of HDL-cholesterol to the liver appears to provide an important source for the biliary secretion of cholesterol [104-106]: studies in SR-BI knockout animals [107] and animals overexpressing adenoviral transfected SR-BI [108,109] showed a ~50% decrease and ~100% increase, respectively, in biliary cholesterol secretion. Newly synthesized cholesterol has only a minor contribution to the total 7

Chapter 1: General introduction

amount of cholesterol present in bile under physiological conditions (only ~20%) [110].

Figure 2: Schematic illustration of lipoprotein metabolism.

4. Bile formation Bile formation is an important function of the liver, performed by the parenchymal cells of the liver (hepatocytes). Hepatocytes are polarized cells with their basolateral (sinusoidal) membrane facing the blood and their apical (canalicular) membrane facing the bile. Both domains are separated from each other by tightjunctions. Bile is an aqueous solution containing bile salts, phospholipids, cholesterol, a variety of proteins and bilirubin, the main organic components, a s well as electrolytes and a number of trace elements [111,112]. Bile formation represents an osmotic process, generated by active transport of various components across the bile canalicular membrane. It has been known for decades that bile salt secretion is the major driving force for bile formation (bile salt-dependent bile flow) [113-115]. In addition, other solutes generate the socalled bile salt-independent fraction of bile flow. Glutathione is a major contributor to this particular fraction in rodents [116,117], but other, as yet unidentified components also play a role. To be able to stimulate adequate bile flow, it i s essential that bile salts are efficiently conserved in an enterohepatic circulation [53,54,81], that comprises sequential biliary secretion, intestinal reabsorption and uptake by hepatocytes for resecretion into bile (section 2.3). Bile has an important physiological function in absorption of dietary lipids in the intestine [26,27]. Furthermore, biliary secretion of cholesterol is the only elimination route from the body [20,21,54]. Both functions will be highlighted later. A third function of the biliary pathway is the elimination from the body of a wide range of endo- and xenobiotic compounds. 8

Physiological functions of biliary lipid secretion

4.1 Hepatobiliary transport. In order to enable hepatobiliary transport of a vast amount of differently structured endo- and exogenous compounds, the basolateral and canalicular membranes of hepatocytes contain a wide variety of transporter proteins. For hepatic uptake at the basolateral membrane, several transport systems have been identified [118], + including the organic cation transporter, oct1; the Na -dependent taurocholate cotransporting protein, Ntcp; the organic anion transporting polypeptides, oatp-1 and oatp-2 and the recently identified rat liver-specific organic anion transporter (rlst-1) [119]. Since chapter 3 and 4 deal with Ntcp, this transporter will be discussed in some detail. Human, rat and mouse Ntcp has been cloned and represent a ~56 kDa protein, exclusively located at the sinusoidal membrane of hepatocytes [23,120-123]. The protein is homogeneously expressed in the liver and is thought to be responsible for the predominate fraction of hepatic (conjugated) bile salt uptake via a sodium-dependent process [124]: Km and Vmax values determined for Ntcp expressed in oocytes were found to be in the range found for hepatocytes from human and rat [125], Km values are in the order of 10-60 µmol/L. It has been calculated that Ntcp-mediated sodium-dependent uptake accounts for more than 80% of taurocholate uptake in the in vivo situation. Other conjugated bile salts, including glycocholate, are also mainly transported via Ntcp. In contrast, uptake of unconjugated cholate via this sodium-dependent pathway would account for less than 50% [125]. Canalicular secretion of bile salts and several other organic compounds i s thought to be rate-limiting in vectorial hepatobiliary transport. A large number of papers reporting on identification, cloning and functional characterization of several canalicular transporters has been published during recent years (see [111,126128] for review). Most of the canalicular membrane transporters which have been identified belong to the ATP Binding Cassette (ABC) transporter superfamily and share common structural and functional characteristics [111,126,127,129]. More than 100 ABC transporters have been identified so far in bacteria, yeast, plants and mammals [130,131]. These transporters localize to different cellular compartments of cells. ABC transporters, in general, have two sets of hydrophobic transmembrane domains and two nucleotide-binding regions located at the cytoplasmic face of the membrane [132]. The transmembrane regions consist in most cases of six hydrophobic membrane-spanning segments with the N- and Ctermini located to the cytoplasmic face of the membrane. These transmembranespanning regions are believed to determine the substrate specificity of the transporter [133,134]. The ATP-binding sites are highly conserved throughout evolution and share two highly conserved amino acid sequences of the Walker motifs (Walker A and Walker B) and a ‘signature sequence’ located upstream of the Walker B motif. Mutations in the Walker A and B motifs are generally not compatible with ATPase activity whereas mutations in the ‘signature sequence’ motif may impair transport function [135]. Transporters involved in bile secretion which do not belong to the ABC superfamily have also been identified in the canalicular membrane, e.g., the Cu-ATPase (Wilson disease protein) [136] that belongs to the superfamily of P-type ATPases. Within the superfamily of ABCtransporters two clusters of transporters involved in bile formation can be distinguished: the P-Glycoprotein family (Pgp) [137,138] and the Multidrug resistance-associated protein family (MRP) [139-142]. Until now, four members of 9

Chapter 1: General introduction

the Pgp family have been identified in rodents; mdr1a, mdr1b, mdr2 and spgp (or bsep). MRP’s are mainly involved in transport of conjugated organic anions of which mrp2/MRP2 (also called canalicular multi-specific organic anion transporter, cMOAT) is highly expressed in the liver and involved in transport of bilirubin [139,143]. MRP1 was the first transporter of the MRP sub-family to be cloned from a small lung cancer cell line [144] and was found to confer resistance to many structurally and functionally unrelated cytostatic drugs [140]. MRP’s will not be addressed further (see [144] for recent review) because this is beyond the scope of this thesis. A condensed overview of proteins involved in the hepatobiliary transport is depicted in Figure 3.

Figure 3: Hepatic transporter proteins HTTP://www.med.rug.nl/mdl/mm.htm).

involved

in

hepatobiliary

transport

(see

4.4 P-Glycoproteins (Pgp’s). The P-glycoproteins identified in humans are the multidrug resistance genes MDR1 and MDR3 and the Sister of P-gp (SPGP) or Bile Salt Export Pump (BSEP). The murine homologues are mdr1a, mdr1b, mdr2 and spgp (bsep). All these Pglycoproteins localize to the canalicular membrane of the liver. MDR1/mdr1a/b i s also present in the apical membrane of cells in colon, small intestine, adrenal, brain and placenta [145]. Multidrug resistance (MDR) refers to the phenomenon that cells (in particular tumor cells) become resistant to a broad range of unrelated cytostatic compounds. Overexpression of MDR1/mdr1 gene confers resistance to exogenous toxins (drugs) [146-148]. Its physiological role in bile formation is not yet clear: mice with a homologous disruption of mdr1a/1b have unaffected bile formation under standard laboratory conditions [149]. It is thought that the physiological role of mdr1 Pgp is in transport of endo- and exogenous metabolites, steroid hormones, hydrophobic peptides or even glycolipids [150]. Spgp is exclusively expressed in the liver and localizes to the canalicular membrane [151]. Functional transfection studies in X. laevis oocytes demonstrated that spgp-transfected cells display a 5-fold increase in ATP-dependent transport of bile salts. Furthermore, these studies showed a similar substrate preference for 10

Physiological functions of biliary lipid secretion

spgp-transfected cells and ATP-dependent transport in canalicular membrane vesicles [151]. The human orthologue, SPGP, has been mapped to chromosome 2 and mutations in the gene have been found in a subgroup of patients with progressive familial intrahepatic cholestasis (PFIC type 2) [152]. These patients show a phenotype consistent with defective hepatobiliary bile salt transport. Available data are consistent with the fact that the SPGP/spgp gene encodes the major bile salt export pump (BSEP/bsep) in humans and rodents [151-153]. The gene product of MDR3 (human) and mdr2 (rodent) was found not to confer multidrug resistance [154]. Its physiological function was elucidated by generation of mice homozygous for a disruption of the mdr2 gene [155]. Studies (-/-) with mdr2 knockout (Mdr2 ) mice, transfected cells and other model systems convincingly showed that mdr2 Pgp is involved in ATP-dependent translocation of phospholipids across the canalicular membrane [155-159]. The absence of mdr2 Pgp leads to complete absence of phospholipids, in particular of bile-specific phosphatidylcholines, in bile and to a strongly impaired biliary cholesterol (-/-) secretion. Biliary bile salt secretion on the other hand, is not impaired in Mdr2 mice [155]. In vitro studies have indicated that mdr2 Pgp acts as a flippase that ‘flips’ phosphatidylcholine, the major phospholipid species in bile, from the inner (-/-) mice leaflet to the outer leaflet of the canalicular membrane [156-159]. Mdr2 show an age- and sex-dependent progressive liver pathology, specified as a nonsuppurative inflammatory cholangitis with portal inflammation and ductular proliferation, consistent with toxic injury of cells lining the biliary tree exerted by (-/-) mouse lipid-free bile [160,161]. Recently, the human counterparts of the Mdr2 were identified that lack functional MDR3 in the liver. The pathology seen in these patients is similar to that in the mouse model and the disease is now referred to as progressive familial intrahepatic cholestasis subtype 3 (PFIC-3) [162]. It has been established more than 30 years ago that there is a clear-cut relation between the secretion rate of bile salts and biliary lipids (Figure 4). Because of the strong detergent action of bile salts it was assumed initially that bile salts act by solubilisation of lipids from the membrane to form mixed micelles [113,163]. This concept was refuted by the demonstration of phospholipid/cholesterol vesicles in rat and human bile [164-168]. Recent studies (-/-) mice revealed that mdr2 Pgp is crucially involved in bile saltin the Mdr2 stimulated secretion of phospholipids into bile. No secretion of phospholipids was (-/-) mice [169] (Figure 4). Biliary cholesterol induced in taurocholate-infused Mdr2 (-/-) secretion is coupled to that of phospholipid and is also decreased in the Mdr2 mice. In contrast to that of phospholipids, cholesterol secretion was stimulated (-/-) mice, indicative for a separate during maximal taurocholate secretion in Mdr2 mechanism of secretion. A reduced level of phospholipid secretion is sufficient to (+/-) reach full cholesterol output, since in heterozygous (Mdr2 ) mice a 50% reduction in phospholipid secretion has no significant effects on cholesterol secretion [169,170]. Proposed mechanisms of actual secretion in bile of phospholipid and cholesterol either as mixed micelles or as vesicles are still speculative [171,172]. It has been proposed that interactions between biliary bile salts and the canalicular membrane form the primary basis for the molecular coupling of bile salt secretion to biliary secretion of biliary lipids (cholesterol and phospholipids). This was based upon observations that endogenous and exogenous organic anions interact with bile salts following their secretion into bile and thereby dissociate bile salt secretion from cholesterol and phospholipid 11

Chapter 1: General introduction

secretion [173]. Ultrastructural studies by Crawford et al. [174] provided further insights into the specific molecular events. Ultrarapid fixation suggested that, parallel to bile salt secretion, vesicle formation was induced from the ectoplasmic surface of the canalicular membrane. Importantly, rates of vesicle formation correlated well with empirically determined phospholipid secretion rates. A further study by the same group highlights the critical role of mdr2/MDR3 in biliary phospholipid secretion, when they correlated expression levels of mdr2 Pgp in mice to rates of vesicle formation at the canalicular membrane [175]. Recent insights in biliary lipid secretion are given in up-to-date reviews [173,176-178].

Figure 4: Illustration of bile salt-dependent secretion of phospholipids into bile ( addapted from Oude Elferink et al. [170]).

5. Scope of the Thesis Work presented in this thesis relates to physiological functions of biliary cholesterol/phospholipid secretion with respect to plasma lipoprotein levels, bile salt metabolism and intestinal fat absorption. In humans, the biliary pathway delivers ~12 g of phospholipid and ~1.5 g of cholesterol to the intestinal lumen on a daily basis, exceeding dietary intake by at least a factor 4 and 2, respectively. In mice fed standard low-cholesterol chow, biliary lipid secretion rates amount up to ~14 mg of phospholipids and ~1 mg of cholesterol per day. Average daily intake of these lipids is approximately 2-4 mg and ~0.4 mg in mice, respectively. Both in humans and in mice, daily biliary phospholipid secretion almost equals the total hepatic phospholipid content, i.e., ~12 g and ~13 mg, respectively. In both species, the amount of cholesterol expelled into the bile per day represents approximately one third of the total hepatic free cholesterol content. These figures illustrate the quantitative importance of hepatobiliary lipid flux. Virtually all biliary phospholipids and up to 60% of biliary cholesterol is reabsorbed from the intestine, at least in rats. In view of the quantity of biliary cholesterol, this reabsorption process represents an important potential site for control of cholesterol homeostasis. Since essentially all reabsorbed cholesterol will be transported back to the liver via the chylomicron (remnant) route, biliary cholesterol secretion will have strong impact on regulation of hepatic cholesterol metabolism, e.g., by influencing expression of genes encoding LDLR and enzymes involved in de novo cholesterogenesis. The presence of phospholipids in bile is effective in solubilisation, and thus required for efficient secretion, of biliary cholesterol and for protection of the cells lining the biliary tree against the detergent action of bile salts. The latter function i s particularly evident from the liver pathology that develops in humans and mice lacking biliary lipid secretion due to defects in MDR3/mdr2 function (see section 12

Physiological functions of biliary lipid secretion

4.4). It has been recognized for many years that bile fulfills a major function in the absorption of dietary fat from the intestine, by providing mixed micelles and vesicular structures that function as transport vehicles for the products of dietary triglyceride lipolysis. Biliary phosphatidylcholine may have an additional role in fat absorption, namely in the assembly of chylomicrons by the intestinal cells. Collectively, available data indicate that biliary phospholipids and cholesterol exert specific functions. However, because biliary phospholipid/cholesterol secretion is tightly coupled to that of bile salts under physiological conditions (see section 4.5), it has until recently not been possible to evaluate the physiological importance of biliary lipids per se in the in vivo situation. Bile salts also display strong modulatory actions at several levels of cholesterol and lipid metabolism in the body. Bile salts represent the major products of cholesterol catabolism in quantitative terms and regulate their own synthesis via negative feedback control. Bile salts are also essential for intestinal fat and cholesterol absorption. In addition, bile salts seem to have an inhibitory effect on hepatic VLDL secretion. The generation of the mdr2 P-glycoprotein-deficient mouse made it possible to evaluate the metabolic actions of biliary phospholipid/cholesterol secretion as such, since these mice show an absence of biliary phospholipid secretion, a strongly impaired biliary cholesterol secretion, but (-/-) unaffected biliary bile salt secretion. These Mdr2 mice as well as heterozygous (+/-) mice, that display a 50% reduction in biliary phospholipid secretion only, Mdr2 were used as experimental models in most of the studies presented in this thesis. In addition, rat models were used with defective delivery of bile to the intestinal lumen by bile duct ligation or bile diversion. In bile duct-ligated animals, bile components accumulate in liver and plasma and elevated plasma cholesterol levels develop. Long-term bile diverted rats also experience a complete absence of bile in the intestinal lumen but without the potentially interfering consequences of cholestasis. The following topics were addressed: (1) Effects of impaired biliary lipid secretion on plasma lipoprotein metabolism. Because biliary cholesterol secretion is considered a major route for elimination of cholesterol from the body and because it has been suggested that (-/-) biliary cholesterol is preferentially recruited from HDL, the phenotype of Mdr2 (+/-) and Mdr2 mice with respect to plasma lipoprotein profiles, hepatic lipid content and overall body cholesterol homeostasis was characterized. With respect to the latter, hepatic cholesterol synthesis and esterification rates were assessed in the liver by measuring activities of HMG-CoA reductase and acyl CoenzymeA:cholesterol acyltransferase (ACAT). Overall cholesterol synthesis was estimated from balance studies. Finally, intestinal cholesterol absorption was determined using a dual-isotope approach (chapter 2). In a follow-up study, we determined the effects of dietary supplementation of phospholipids and/or cholesterol on plasma lipoprotein levels and cholesterol (-/-) mice. We followed plasma lipid levels during metabolism in the liver of Mdr2 dietary supplementation of excess phospholipids and cholesterol in amounts equaling ten- and thirty-times, respectively, the biliary load of these lipids per day. (-/-) mice under chow-fed conditions have strongly impaired biliary Since Mdr2 cholesterol secretion, we questioned whether these animals were actually able to handle excess of dietary cholesterol. Therefore several parameters of liver function were determined in cholesterol-fed animals and protein and steady state mRNA 13

Chapter 1: General introduction

levels of several transporter proteins involved in hepatobiliary secretion and cholesterol homeostasis were analyzed (chapter 3). Data from literature suggest that there may be a reciprocal relationship between biliary lipid secretion and hepatic lipid secretion into plasma in the form of (-/-) mice in vivo, VLDL. Therefore, we investigated hepatic VLDL secretion in Mdr2 using the Triton WR1339 method, and in vitro, in cultured hepatocytes. This dual approach was chosen to differentiate between potential intrinsic hepatocytic abnormalities related to the mdr2 Pgp-deficiency and the ‘physiological’ consequences of impaired hepatobiliary lipid flux (chapter 4) (2) Modulation of bile salt metabolism. Bile salts are key molecules in regulation of cholesterol metabolism, a s described above. In addition, however, due to their detergent properties, bile salts (-/-) mice gradually develop liver pathology can induce hepatotoxicity. The Mdr2 which is characterized by non-suppurative inflammatory cholangitis with portal inflammation and ductular proliferation. However, these mice are not ‘cholestatic’, according to the functional definition of this condition, i.e., an impairment of bile flow. In fact, bile flow is increased and bile salt secretion is unaffected or slightly (-/-) elevated in these knockout mice. Plasma bile salt levels are increased in Mdr2 mice as are bilirubin, AST and ALT levels. We questioned whether the hepatic uptake of bile salts via the major basolateral sodium-dependent bile salt transporter (ntcp) is affected and may contribute to high plasma bile salt levels in (-/-) mice. For this purpose we determined protein and steady state mRNA Mdr2 levels of ntcp in the livers of knockout and control mice and measured the uptake of taurocholate in membrane vesicles isolated from these livers (chapter 5). During the course of these studies, the intestinal sodium-dependent bile salt uptake system (ibat or apical sodium-dependent bile salt transporter, abst) was cloned. This transporter is mainly expressed in the terminal ileum of rats, hamsters, rabbits and humans and is considered responsible for conservation of bile salts in the enterohepatic cycle. More recently, it was shown that abst is also expressed in proliferated bile ducts of rat liver, as induced by bile duct ligation. However, its function in bile duct cells (cholangiocytes) has remained unclear. (-/-) Since Mdr2 mice develop bile duct proliferation and show some abnormalities in bile salt metabolism, we addressed the question whether or not expression of abst is altered in the intestine and bile ducts of these animals and, if so, whether this is associated with altered bile salt kinetics. For this purpose, we measured abst expression at protein and mRNA levels in liver and along the length of the intestine and studied bile salt kinetics (synthesis rate, turnover, pool size) by a novel stable isotope procedure (chapter 6). (3) Effects of impaired biliary lipid secretion on intestinal fat absorption. Since biliary phospholipids have been suggested to play an important role in the formation of chylomicrons by the intestinal epithelium, we questioned (whether chylomicron formation and intestinal lipid absorption are affected in Mdr2 /-) mice. To address this issue, we determined postprandial triglyceride appearance after an intragastric (radiolabeled) lipid load under experimental conditions that allowed us to differentiate between processes involved in uptake of fats by the enterocytes, entrance into the blood compartment as chylomicrons and chylomicron lipolysis. In addition, to evaluate the overall effects of lipid-free bile in efficiency of dietary fat absorption, balance studies were performed in mice fed either low- or high-fat diets (chapter 7). 14

Physiological functions of biliary lipid secretion

Essential fatty acids (EFAs) are fatty acids that can not be synthesized de novo by mammals. Therefore, their concentration in the body critically depends on adequate dietary supply and subsequent efficient absorption. It can be calculated that biliary phospholipid delivery to the intestinal lumen provides an important source of essential fatty acids, e.g. ~3 g per day in humans, and could be important for the maintenance of EFA status. We investigated whether biliary phospholipid secretion is important in the maintenance of plasma concentrations of linoleic acid and/or plays a role in the absorption of linoleic acid from the diet. (-/-) The plasma and liver EFA status in the Mdr2 and wildtype mice was analyzed by 13 C-linoleic acid, plasma gaschromatography (GC) and the absorption of 13 13 appearance of C-linoleic acid and its metabolism to C-arachidonic acid was (-/-) 13 determined in Mdr2 and control mice after an intragastric C-linoleic acid load (chapter 8). Recently, the HDL receptor (scavenger receptor class B, type 1 (SRBI)), was identified in the intestine of rabbits and was suggested to be involved in intestinal cholesterol absorption. Because bile plays an important role in the absorption of cholesterol and biliary cholesterol secretion was suggested to (co-?) regulate absorption of dietary cholesterol, we investigated whether absence of bile delivery to the intestine would alter intestinal SRBI expression in rats and mice. Two rat models, i.e., bile duct-ligated and bile-diverted rats and bile duct-ligated mice were used to evaluate whether the absence of bile in the intestine affects SRBI expression. To elucidate whether biliary phospholipids and/or cholesterol may (-/-) mice were also studied. We have specific functions in this respect, Mdr2 determined intestinal protein and mRNA levels of SRBI in these animal models and checked its localization by immunohistochemistry and confocal microscopy. Furthermore, we measured the cholesterol absorption in these animals by the dual-isotope method (chapter 9). The final chapter (chapter 10) provides an integrated summary of the data obtained in the above mentioned chapters and a general discussion. References 1. Russell DW. Cholesterol biosynthesis and metabolism. Cardiovasc Drugs Ther 1992;6:103110. 2. Havel RJ. Biology of cholesterol, lipoproteins and atherosclerosis. Clin Exp Hypertens 1989;11:887-900. 3. Farese RV, Jr., Herz J. Cholesterol metabolism and embryogenesis. Trends Genet 1998;14:115-120. 4. Herz J, Willnow TE, Farese RV, Jr. Cholesterol, hedgehog and embryogenesis. Nat Genet 1997;15:123-124. 5. Neaton JD, Blackburn H, Jacobs D, Kuller L, Lee DJ, Sherwin R, Shih J, Stamler J, Wentworth D. Serum cholesterol level and mortality findings for men screened in the Multiple Risk Factor Intervention Trial. Multiple Risk Factor Intervention Trial Research Group. Arch Intern Med 1992;152:1490-1500. 6. Scott J. Heart disease. Good cholesterol news. Nature 1999;400:816-7, 819. 7. Kannel BW, Castelli WP, Gordon T, McNamara PM. Serum cholesterol, lipoproteins, and the risk of coronary heart disease. The Framingham study. Ann Intern Med 1971;74:1-12. 8. Kratzer W, Mason RA, Kachele V. Prevalence of gallstones in sonographic surveys worldwide. J Clin Ultrasound 1999;27:1-7. 9. Carey MC. Pathogenesis of gallstones. Recenti Prog Med 1992;83:379-391. 10. Dietschy JM, Turley SD, Spady DK. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res 1993;34:1637-1659.

15

Chapter 1: General introduction 11. Assmann G. Biochemistry of lipoproteins. In: AnonymousLipid metabolism and atherosclerosis. Stuttgart: F.K. Schattauer Verlag GmbH, 1982:14-53. 12. Gotto AM, Jr., Pownall HJ, Havel RJ. Introduction to the plasma lipoproteins. Methods Enzymol 1986;128:3-41:3-41. 13. Mahley RW, Innerarity TL, Rall SC, Jr., Weisgraber KH. Plasma lipoproteins: apolipoprotein structure and function. J Lipid Res 1984;25:1277-1294. 14. Havel RJ, Kane JP. Introduction: Structure and metabolism of plasma lipoproteins. In: Sriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. 6th Ed. New York: McGraw-Hill, 1989:1129-1138. 15. Genest J, Jr., Cohn JS. Clustering of cardiovascular risk factors: targeting high-risk individuals. Am J Cardiol 1995;76:8A-20A. 16. Castelli WP. Lipids, risk factors and ischaemic heart disease. Atherosclerosis 1996;124 Suppl:S1-9:S1-9. 17. Stein O, Stein Y. Atheroprotective mechanisms of HDL. Atherosclerosis 1999;144:285-301. 18. Packard CJ, Shepherd J. The hepatobiliary axis and lipoprotein metabolism: effects of bile acid sequestrants and ileal bypass surgery. J Lipid Res 1982;23:1081-1098. 19. Breslow JL. Apolipoprotein genetic variation and human disease. Physiol Rev 1988;68:85132. 20. Robins SJ, Brunengraber H. Origin of biliary cholesterol and lecithin in the rat: contribution of new synthesis and preformed hepatic stores. J Lipid Res 1982;23:604-608. 21. Nervi F, Bronfman M, Allalon W, Depiereux E, Del Pozo R. Regulation of biliary cholesterol secretion in the rat. Role of hepatic cholesterol esterification. J Clin Invest 1984;74:2226-2237. 22. Björkhem I. Mechnism of bile acid synthesis in mammalian liver. In: Danielsson H, Sjövall J, eds. Sterols and Bile Acids. Amsterdam: Elsevier Scientific Publishers, 1985:231-278. 23. Bjorkhem I. Mechanism of degradation of the steroid side chain in the formation of bile acids. J Lipid Res 1992;33:455-471. 24. Vlahcevic ZR, Pandak WM, Heuman DM, Hylemon PB. Function and regulation of hydroxylases involved in the bile acid biosynthesis pathways. Semin Liver Dis 1992;12:403-419. 25. Hofmann AF, Borgstrom B. Physio-chemical state of lipids in intestinal content during their digestion and absorption. Fed Proc 1962;21:43-50. 26. Carey MC, Hernell O. Digestion and absorption of fat. Semin Gastroint Dis 1992;3:189-208. 27. Tso P. Intestinal lipid absorption. In: Johnson LR, ed. Physiology of the Gastrointestinal Tract. 3rd Ed. New York: Raven Press, 1987:1867-1907. 28. Rappaport AM, Borowy ZM, Lougheed WM, Lotto WM. Subdivision of hexagonal liver lobules into a structural and functional unit; role in hepatic physiology and pathology. Anatomical Resort 1954;119:11-34.(Abstract) 29. Munthe-Kaas AC, Berg T, Seljelid R. Distribution of lysosomal enzymes in different types of rat liver cells. Exp Cell Res 1976;99:146-154. 30. Jones AL, Schmucker DL. Current concepts of liver structure as related to function. Gastroenterology 1977;73:833-851. 31. Alpini G, Glaser SS, Ueno Y, Rodgers R, Phinizy JL, Francis H, Baiocchi L, Holcomb LA, Caligiuri A, Lesage GD. Bile acid feeding induces cholangiocyte proliferation and secretion: evidence for bile acid-regulated ductal secretion. Gastroenterology 1999;116:179-186. 32. Strazzabosco M. Transport systems in cholangiocytes: their role in bile formation and cholestasis. Yale J Biol Med 1997;70:427-434. 33. Lazaridis KN, Pham L, Tietz P, Marinelli RA, deGroen PC, Levine S, Dawson PA, Larusso NF. Rat cholangiocytes absorb bile acids at their apical domain via the ileal sodium-dependent bile acid transporter. J Clin Invest 1997;100:2714-2721. 34. Tietz PS, Holman RT, Miller LJ, Larusso NF. Isolation and characterization of rat cholangiocyte vesicles enriched in apical or basolateral plasma membrane domains. Biochemistry 1995;34:15436-15443. 35. Bloch K. The biological synthesis of cholesterol. Science 1965;150:19-28. 36. Brown MS, Goldstein JL, Dietschy JM. Active and inactive forms of 3-hydroxy-3methylglutaryl coenzyme A reductase in the liver of the rat. Comparison with the rate of cholesterol synthesis in different physiological states. J Biol Chem 1979;254:5144-5149. 37. Rodwell VW, Nordstrom JL, Mitschelen JJ. Regulation of HMG-CoA reductase. Adv Lipid Res 1976;14:1-74:1-74. 38. Endo A. The discovery and development of HMG-CoA reductase inhibitors. J Lipid Res 1992;33:1569-1582. 39. Lennernas H, Fager G. Pharmacodynamics and pharmacokinetics of the HMG-CoA reductase inhibitors. Similarities and differences. Clin Pharmacokinet 1997;32:403-425. 40. Herbert PR, Gaziano JM, Chan KS, Hennekens CH. Cholesterol lowering with statin drugs, risk of stroke, and total mortality. An overview of randomized trails. JAMA 1997;278:313-321.

16

Physiological functions of biliary lipid secretion 41. Brown MS, Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 1997;89:331-340. 42. Brown MS, Goldstein JL. A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci U S A 1999;96:11041-11048. 43. Brown MS, Goldstein JL. Sterol regulatory element binding proteins (SREBPs): controllers of lipid synthesis and cellular uptake. Nutr Rev 1998;56:S1-3; discussion S54-75. 44. Wang X, Sato R, Brown MS, Hua X, Goldstein JL. SREBP-1, a membrane-bound transcription factor released by sterol-regulated proteolysis. Cell 1994;77:53-62. 45. Ugele B, Kempen HJ, Kempen JM, Gebhardt R, Meijer P, Burger HJ, Princen HM. Heterogeneity of rat liver parenchyma in cholesterol 7 alpha-hydroxylase and bile acid synthesis. Biochem J 1991;276:73-77. 46. Twisk J, Hoekman MF, Mager WH, Moorman AF, de Boer PA, Scheja L, Princen HM, Gebhardt R. Heterogeneous expression of cholesterol 7 alpha-hydroxylase and sterol 27hydroxylase genes in the rat liver lobulus. J Clin Invest 1995;95:1235-1243. 47. Myant NB, Mitropoulos KA. Cholesterol 7 alpha-hydroxylase. J Lipid Res 1977;18:135-153. 48. Cooper AD. Bile salt biosynthesis: an alternate synthetic pathway joins the mainstream. Gastroenterology 1997;113:2005-2008. 49. Twisk J, de Wit EC, Princen HM. Suppression of sterol 27-hydroxylase mRNA and transcriptional activity by bile acids in cultured rat hepatocytes. Biochem J 1995;305:505-511. 50. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Willson TM, Zavacki AM, Moore DD, Lehmann JM. Bile acids: natural ligands for an orphan nuclear receptor. Science 1999;284:1365-1368. 51. Shefer S, Hauser S, Bekersky I, Mosbach EH. Biochemical site of regulation of bile acid biosynthesis in the rat. J Lipid Res 1970;11:404-411. 52. Kuipers F, Havinga R, Bosschieter H, Toorop GP, Hindriks FR, Vonk RJ. Enterohepatic circulation in the rat. Gastroenterology 1985;88:403-411. 53. Carey MC, Duane WC. Enterohepatic circulation. In: Arias I, Boyer JL, Jakoby WB, Schachter D, Shafritz DA, eds. The Liver: Biology and Pathology. 3rd Ed. New York: Raven Press, 1994:719-768. 54. Arrese M, Trauner M, Sacchiero RJ, Crossman MW, Shneider BL. Neither intestinal sequestration of bile acids nor common bile duct ligation modulate the expression and function of the rat ileal bile acid transporter. Hepatology 1998;28:1081-1087. 55. Twisk J, Hoekman MF, Muller LM, Iida T, Tamaru T, Ijzerman A, Mager WH, Princen HM. Structural aspects of bile acids involved in the regulation of cholesterol 7 alpha-hydroxylase and sterol 27-hydroxylase. Eur J Biochem 1995;228:596-604. 56. Gustafsson JA. Seeking ligands for lonely orphan receptors. Science 1999;284:1285-1286. 57. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B. Identification of a nuclear receptor for bile acids. Science 1999;284:1362-1365. 58. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999;3:543-553. 59. Gong YZ, Everett ET, Schwartz DA, Norris JS, Wilson FA. Molecular cloning, tissue distribution, and expression of a 14-kDa bile acid-binding protein from rat ileal cytosol. Proc Natl Acad Sci U S A 1994;91:4741-4745. 60. Kanda T, Niot I, Foucaud L, Fujii H, Bernard A, Ono T, Besnard P. Effect of bile on the intestinal bile-acid binding protein (I-BABP) expression. In vitro and in vivo studies. FEBS Lett 1996;384:131-134. 61. Mullins JG, Beechey RB, Gould GW, Campbell FC, Shirazi-Beechey SP. Characterization of the ileal Na+/bile salt co-transporter in brush border membrane vesicles and functional expression in Xenopus laevis oocytes. Biochem J 1992;285:785-790. 62. Kramer W, Nicol SB, Girbig F, Gutjahr U, Kowalewski S, Fasold H. Characterization and chemical modification of the Na(+)-dependent bile-acid transport system in brush-border membrane vesicles from rabbit ileum. Biochim Biophys Acta 1992;1111:93-102. 63. Wong MH, Oelkers P, Craddock AL, Dawson PA. Expression cloning and characterization of the hamster ileal sodium-dependent bile acid transporter. J Biol Chem 1994;269:1340-1347. 64. Shneider BL, Dawson PA, Christie DM, Hardikar W, Wong MH, Suchy FJ. Cloning and molecular characterization of the ontogeny of a rat ileal sodium-dependent bile acid transporter. J Clin Invest 1995;95:745-754. 65. Craddock AL, Love MW, Daniel RW, Kirby LC, Walters HC, Wong MH, Dawson PA. Expression and transport properties of the human ileal and renal sodium-dependent bile acid transporter. Am J Physiol 1998;274:G157-69.

17

Chapter 1: General introduction 66. Saeki T, Matoba K, Furukawa H, Kirifuji K, Kanamoto R, Iwami K. Characterization, cDNA cloning, and functional expression of mouse ileal sodium-dependent bile acid transporter. J Biochem (Tokyo) 1999;125:846-851. 67. Stravitz RT, Sanyal AJ, Pandak WM, Vlahcevic ZR, Beets JW, Dawson PA. Induction of sodium-dependent bile acid transporter messenger RNA, protein, and activity in rat ileum by cholic acid. Gastroenterology 1997;113:1599-1608. 68. Lillienau J, Crombie DL, Munoz J, Longmire-Cook SJ, Hagey LR, Hofmann AF. Negative feedback regulation of the ileal bile acid transport system in rodents. Gastroenterology 1993;104:38-46. 69. Alaupovic P. Significance of apolipoproteins for structure, function, and classification of plasma lipoproteins. Methods Enzymol 1996;263:32-60:32-60. 70. Olivecrona G, Olivecrona T. Triglyceride lipases and atherosclerosis. Curr Opin Lipidol 1995;6:291-305. 71. Havel RJ. Postprandial lipid metabolism: an overview. Proc Nutr Soc 1997;56:659-666. 72. Kuipers F, Jong MC, Lin Y, Van Eck M, Havinga R, Bloks V, Verkade HJ, Hofker MH, Moshage H, Van Berkel TJC, Vonk RJ, Havekes LM. Impaired secretion of very low density lipoprotein-triglycerides by apolipoprotein E-deficient mouse hepatocytes. J Clin Invest 1997;100:2915-2922. 73. Mensenkamp AR, Jong MC, van Goor H, van Luyn MJ, Bloks V, Havinga R, Voshol PJ, Hofker MH, van Dijk KW, Havekes LM, Kuipers F. Apolipoprotein E Participates in the Regulation of Very Low Density Lipoprotein-Triglyceride Secretion by the Liver. J Biol Chem 1999;274:35711-35718. 74. Mahley RW. Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science 1988;240:622-630. 75. Willnow TE, Nykjaer A, Herz J. Lipoprotein receptors: new roles for ancient proteins. Nat Cell Biolog 1999;1:E157-E162. 76. Hussain MM, Strickland DK, Bakillah A. The mammalian low-density lipoprotein receptor family. Annu Rev Nutr 1999;19:141-72:141-172. 77. Herz J, Hamann U, Rogne S, Myklebost O, Gausepohl H, Stanley KK. Surface location and high affinity for calcium of a 500-kd liver membrane protein closely related to the LDL-receptor suggest a physiological role as lipoprotein receptor. EMBO J 1988;7:4119-4127. 78. Saito A, Pietromonaco S, Loo AK, Farquhar MG. Complete cloning and sequencing of rat gp330/"megalin," a distinctive member of the low density lipoprotein receptor gene family. Proc Natl Acad Sci U S A 1994;91:9725-9729. 79. Takahashi S, Kawarabayasi Y, Nakai T, Sakai J, Yamamoto T. Rabbit very low density lipoprotein receptor: a low density lipoprotein receptor-like protein with distinct ligand specificity. Proc Natl Acad Sci U S A 1992;89:9252-9256. 80. Novak S, Hiesberger T, Schneider WJ, Nimpf J. A new low density lipoprotein receptor homologue with 8 ligand binding repeats in brain of chicken and mouse. J Biol Chem 1996;271:11732-11736. 81. Kim DH, Iijima H, Goto K, Sakai J, Ishii H, Kim HJ, Suzuki H, Kondo H, Saeki S, Yamamoto T. Human apolipoprotein E receptor 2. A novel lipoprotein receptor of the low density lipoprotein receptor family predominantly expressed in brain. J Biol Chem 1996;271:83738380. 82. Attie AD, Pittman RC, Steinberg D. Hepatic catabolism of low density lipoprotein: mechanisms and metabolic consequences. Hepatology 1982;2:269-281. 83. Johnson WJ, Mahlberg FH, Rothblat GH, Phillips MC. Cholesterol transport between cells and high-density lipoproteins. Biochim Biophys Acta 1991;1085:273-298. 84. Small DM. Mechanisms of reversed cholesterol transport. Agents Actions Suppl 1988;26:135-146. 85. Gotto AM, Jr. High-density lipoproteins: biochemical and metabolic factors. Am J Cardiol 1983;52:2B-4B. 86. Johnson WJ, Phillips MC, Rothblat GH. Lipoproteins and cellular cholesterol homeostasis. Subcell Biochem 1997;28:235-76:235-276. 87. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated i n Tangier disease. Nat Genet 1999;22:347-351. 88. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet 1999;22:336-345.

18

Physiological functions of biliary lipid secretion 89. Rust S, Rosier M, Funke H, Real J, Amoura Z, Piette JC, Deleuze JF, Brewer HB, Duverger N, Denefle P, Assmann G. Tangier disease is caused by mutations in the gene encoding ATPbinding cassette transporter 1. Nat Genet 1999;22:352-355. 90. Luciani MF, Denizot F, Savary S, Mattei MG, Chimini G. Cloning of two novel ABC transporters mapping on human chromosome 9. Genomics 1994;21:150-159. 91. Luciani MF, Chimini G. The ATP binding cassette transporter ABC1, is required for the engulfment of corpses generated by apoptotic cell death. EMBO J 1996;15:226-235. 92. Hobbs HH, Rader DJ. ABC1: connecting yellow tonsils, neuropathy, and very low HDL. J Clin Invest 1999;104:1015-1017. 93. Lawn RM, Wade DP, Garvin MR, Wang X, Schwartz K, Porter JG, Seilhamer JJ, Vaughan AM, Oram JF. The Tangier disease gene product ABC1 controls the cellular apolipoproteinmediated lipid removal pathway. J Clin Invest 1999;104:R25-31. 94. Tall AR. Plasma high density lipoproteins. Metabolism and relationship to atherogenesis. J Clin Invest 1990;86:379-384. 95. Bruce C, Chouinard RA, Jr., Tall AR. Plasma lipid transfer proteins, high-density lipoproteins, and reverse cholesterol transport. Annu Rev Nutr 1998;18:297-330:297-330. 96. Tall AR, Krumholz S, Olivecrona T, Deckelbaum RJ. Plasma phospholipid transfer protein enhances transfer and exchange of phospholipids between very low density lipoproteins and high density lipoproteins during lipolysis. J Lipid Res 1985;26:842-851. 97. Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986;232:34-47. 98. Glass C, Pittman RC, Weinstein DB, Steinberg D. Dissociation of tissue uptake of cholesterol ester from that of apoprotein A-I of rat plasma high density lipoprotein: selective delivery of cholesterol ester to liver, adrenal, and gonad. Proc Natl Acad Sci U S A 1983;80:5435-5439. 99. Glass C, Pittman RC, Civen M, Steinberg D. Uptake of high-density lipoprotein-associated apoprotein A-I and cholesterol esters by 16 tissues of the rat in vivo and by adrenal cells and hepatocytes in vitro. J Biol Chem 1985;260:744-750. 100. Acton SL, Scherer PE, Lodish HF, Krieger M. Expression cloning of SR-BI, a CD36-related class B scavenger receptor. J Biol Chem 1994;269:21003-21009. 101. Acton SL, Kozarsky KF, Rigotti A. The HDL receptor SR-BI: a new therapeutic target for atherosclerosis? Mol Med Today 1999;5:518-524. 102. Rigotti A, Trigatti B, Babitt J, Penman M, Xu S, Krieger M. Scavenger receptor BI--a cell surface receptor for high density lipoprotein. Curr Opin Lipidol 1997;8:181-188. 103. Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M, Williams DL. Scavenger receptor class B, type I (SR-BI) is the major route for the delivery of high density lipoprotein cholesterol to the steroidogenic pathway in cultured mouse adrenocortical cells. Proc Natl Acad Sci U S A 1997;94:13600-13605. 104. Robins SJ, Fasulo JM. Delineation of a novel hepatic route for the selective transfer of unesterified sterols from high-density lipoproteins to bile: studies using the perfused rat liver. Hepatology 1999;29:1541-1548. 105. Robins SJ, Fasulo JM. High density lipoproteins, but not other lipoproteins, provide a vehicle for sterol transport to bile. J Clin Invest 1997;99:380-384. 106. Robins SJ, Fasulo JM, Leduc R, Patton GM. The transport of lipoprotein cholesterol into bile: a reassessment of kinetic studies in the experimental animal. Biochim Biophys Acta 1989;1004:327-331. 107. Rigotti A, Trigatti BL, Penman M, Rayburn H, Herz J, Krieger M. A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl Acad Sci U S A 1997;94:12610-12615. 108. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 1997;387:414417. 109. Ji Y, Wang N, Ramakrishnan R, Sehayek E, Huszar D, Breslow JL, Tall AR. Hepatic scavenger receptor BI promotes rapid clearance of high density lipoprotein free cholesterol and its transport into bile. J Biol Chem 1999;274:33398-33402. 110. Bandsma RH, Stellaard F, Vonk RJ, Nagel GT, Neese RA, Hellerstein MK, Kuipers F. Contribution of newly synthesized cholesterol to rat plasma and bile determined by mass isotopomer distribution analysis: bile-salt flux promotes secretion of newly synthesized cholesterol into bile. Biochem J 1998;329:699-703. 111. Oude Elferink RP, Meijer DK, Kuipers F, Jansen PL, Groen AK, Groothuis GM. Hepatobiliary secretion of organic compounds; molecular mechanisms of membrane transport. Biochim Biophys Acta 1995;1241:215-268. 112. Hay DW, Carey MC. Chemical species of lipids in bile. Hepatology 1990;12:6S-14S;

19

Chapter 1: General introduction 113. Wheeler HO. Secretion of bile acids by the liver and their role in the formation of hepatic bile. Arch Intern Med 1972;130:533-541. 114. Erlinger S. Physiology of bile secretion and enterohepatic circulation. In: Johnson LR, ed. Physiology of the Gastrointestinal tract. 2nd Ed. New York: Raven Press, 1987:1557-1580. 115. Blitzer BL, Boyer JL. Cellular mechanisms of bile formation. Gastroenterology 1982;82:346-357. 116. Nathanson MH, Boyer JL. Mechanisms and regulation of bile secretion. Hepatology 1991;14:551-566. 117. Ballatori N, Truong AT. Glutathione as a primary osmotic driving force in hepatic bile formation. Am J Physiol 1992;263:G617-24. 118. Kullak-Ublick GA. Regulation of organic anion and drug transporters of the sinusoidal membrane. J Hepatol 1999;31:563-573. 119. Kakyo M, Unno M, Tokui T, Nakagomi R, Nishio T, Iwasashi H, Nakai D, Seki M, Suzuki M, Naitoh T, Matsuno S, Yawo H, Abe T. Molecular characterization and functional regulation of a novel rat liver-specific organic anion transporter rlst-1. Gastroenterology 1999;117:770-775. 120. Hagenbuch B, Lubbert H, Stieger B, Meier PJ. Expression of the hepatocyte Na+/bile acid cotransporter in Xenopus laevis oocytes. J Biol Chem 1990;265:5357-5360. 121. Hagenbuch B. Molecular properties of hepatic uptake systems for bile acids and organic anions. J Membr Biol 1997;160:1-8. 122. Hagenbuch B, Meier PJ. Sinusoidal (basolateral) bile salt uptake systems of hepatocytes. Semin Liver Dis 1996;16:129-136. 123. Hagenbuch B, Meier PJ. Molecular cloning, chromosomal localization, and functional characterization of a human liver Na+/bile acid cotransporter. J Clin Invest 1994;93:1326-1331. 124. Meier PJ. Molecular mechanisms of hepatic bile salt transport from sinusoidal blood into bile. Am J Physiol 1995;269:G801-12. 125. Meier PJ, Eckhardt U, Schroeder A, Hagenbuch B, Stieger B. Substrate specificity of sinusoidal bile acid and organic anion uptake systems in rat and human liver. Hepatology 1997;26:1667-1677. 126. Muller M, Jansen PL. The secretory function of the liver: new aspects of hepatobiliary transport. J Hepatol 1998;28:344-354. 127. Muller M, Jansen PL. Molecular aspects of hepatobiliary transport. Am J Physiol 1997;272:G1285-303. 128. Oude Elferink RP, Frijters CM, Paulusma C, Groen AK. Regulation of canalicular transport activities. J Hepatol 1996;24 Suppl 1:94-9:94-99. 129. Keppler D, Arias IM. Hepatic canalicular membrane. Introduction: transport across the hepatocyte canalicular membrane. FASEB J 1997;11:15-18. 130. Allikmets R, Gerrard B, Hutchinson A, Dean M. Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database. Hum Mol Genet 1996;5:1649-1655. 131. Decottignies A, Goffeau A. Complete inventory of the yeast ABC proteins. Nat Genet 1997;15:137-145. 132. Schneider E, Hunke S. ATP-binding-cassette (ABC) transport systems: functional and structural aspects of the ATP-hydrolyzing subunits/domains. FEMS Microbiol Rev 1998;22:1-20. 133. Loo TW, Clarke DM. Covalent modification of human P-glycoprotein mutants containing a single cysteine in either nucleotide-binding fold abolishes drug-stimulated ATPase activity. J Biol Chem 1995;270:22957-22961. 134. Zhang X, Collins KI, Greenberger LM. Functional evidence that transmembrane 12 and the loop between transmembrane 11 and 12 form part of the drug-binding domain in Pglycoprotein encoded by MDR1. J Biol Chem 1995;270:5441-5448. 135. Walker JE, Saraste M, Runswick MJ, Gay NJ. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1982;1:945-951. 136. Dijkstra M, In 't Veld G, van den Berg GJ, Muller M, Kuipers F, Vonk RJ. Adenosine triphosphate-dependent copper transport in isolated rat liver plasma membranes. J Clin Invest 1995;95:412-416. 137. Silverman JA, Schrenk D. Hepatic canalicular membrane 4: expression of the multidrug resistance genes in the liver. FASEB J 1997;11:308-313. 138. Meijer DKF, Smit JW, Müller M. Hepatobiliary elimination of cationic drugs: the role of Pglycoprotein and other ATP-dependent transporters. Adv Drug Deliv Rev 1997;25:159-200. 139. Paulusma CC, Bosma PJ, Zaman GJ, Bakker CT, Otter M, Scheffer GL, Scheper RJ, Borst P, Oude Elferink RP. Congenital jaundice in rats with a mutation in a multidrug resistanceassociated protein gene. Science 1996;271:1126-1128.

20

Physiological functions of biliary lipid secretion 140. Cole SP, Deeley RG. Multidrug resistance mediated by the ATP-binding cassette transporter protein MRP. Bioessays 1998;20:931-940. 141. Kool M, Dehaas M, Scheffer GL, Scheper RJ, Vaneijk MJT, Juijn JA, Baas F, Borst P. Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines. Cancer Res 1997;57:3537-3547. 142. Madon J, Hagenbuch B, Gerloff T, landmann L, Meier PJ, Stieger B. Identification of a novel multidrug resistanceassociated protein (mrp6) at the lateral plasma membrane of rat hepatocytes. Hepatology 1998;28:400A. 143. Paulusma CC, Oude Elferink RP. The canalicular multispecific organic anion transporter and conjugated hyperbilirubinemia in rat and man. J Mol Med 1997;75:420-428. 144. Loe DW, Deeley RG, Cole SP. Biology of the multidrug resistance-associated protein, MRP. Eur J Cancer 1996;32A:945-957. 145. Cordon-Cardo C, O'Brien JP, Boccia J, Casals D, Bertino JR, Melamed MR. Expression of the multidrug resistance gene product (P-glycoprotein) in human normal and tumor tissues. J Histochem Cytochem 1990;38:1277-1287. 146. Juliano RL, Ling V. A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim Biophys Acta 1976;455:152-162. 147. Gottesman MM, Pastan I. Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu Rev Biochem 1993;62:385-427:385-427. 148. Borst P, Schinkel AH. Genetic dissection of the function of mammalian P- glycoproteins. Trends Genet 1997;13:217-222. 149. Schinkel AH, Mayer U, Wagenaar E, Mol CA, van Deemter L, Smit JJ, van der Valk MA, Voordouw AC, Spits H, van Tellingen O, Zijlmans JM, Fibbe WE, Borst P. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins. Proc Natl Acad Sci U S A 1997;94:4028-4033. 150. van Helvoort A, Smith AJ, Sprong H, Fritzsche I, Schinkel AH, Borst P, van Meer G. MDR1 P-glycoprotein is a lipid translocase of broad specificity, while MDR3 P-glycoprotein specifically translocates phosphatidylcholine. Cell 1996;87:507-517. 151. Gerloff T, Stieger B, Hagenbuch B, Madon J, landmann L, Roth J, Hofmann AF, Meier PJ. The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 1998;273:10046-10050. 152. Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, Sokal E, Dahan K, Childs S, Ling V, Tanner MS, Kagalwalla AF, Nemeth A, Pawlowska J, Baker A, Mieli-Vergani G, Freimer NB, Gardiner RM, Thompson RJ. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet 1998;20:233-238. 153. Jansen PL, Strautnieks SS, Jacquemin E, Hadchouel M, Sokal EM, Hooiveld GJ, Koning JH, De Jager-Krikken A, Kuipers F, Stellaard F, Bijleveld CM, Gouw A, van Goor H, Thompson RJ, M#ller M. Hepatocanalicular Bile Salt Export Pump Deficiency in Patients With Progressive Familial Intrahepatic Cholestasis. Gastroenterology 1999;117:1370-1379. 154. Buschman E, Gros P. The inability of the mouse mdr2 gene to confer multidrug resistance is linked to reduced drug binding to the protein. Cancer Res 1994;54:4892-4898. 155. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA, van der Valk MA, Offerhaus GJA, Berns AJM, Borst P. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462. 156. Smith AJ, Timmermans-Hereijgers JL, Roelofsen B, Wirtz KW, Van Blitterswijk WJ, Smit JJ, Schinkel AH, Borst P. The human MDR3 P-glycoprotein promotes translocation of phosphatidylcholine through the plasma membrane of fibroblasts from transgenic mice. FEBS Lett 1994;354:263-266. 157. Ruetz S, Gros P. Phosphatidylcholine translocase: a physiological role for the mdr2 gene. Cell 1994;77:1071-1081. 158. Ruetz S, Gros P. Enhancement of Mdr2-mediated Phosphatidylcholine Translocation by the Bile Salt Taurocholate, implications for hepatic bile formation.. The Journal of Biological chemistry 1995;270:25388-25395. 159. Ruetz S, Raymond M, Gros P. Functional expression of P-glycoprotein encoded by the mouse mdr3 gene in yeast cells. Proc Natl Acad Sci U S A 1993;90:11588-11592. 160. Van Nieuwkerk CMJ, Oude Elferink RPJ, Groen AK, Ottenhoff R, Tytgat GNJ, Dingemans KP, Weerman MAVB, Offerhaus GJA. Effects of ursodeoxycholate and cholate feeding on liver disease in FVB mice with a disrupted mdr2 P-glycoprotein gene. Gastroenterology 1996;111:165-171.

21

Chapter 1: General introduction 161. Van Nieuwkerk CMJ, Groen AK, Ottenhoff R, van Wijland M, Weerman MAV, Tytgat GNJ, Offerhaus JJA, Oude Elferink RPJ. The role of bile salt composition in liver pathology of mdr2 (/-) mice: Differences between males and females. J Hepatol 1997;26:138-145. 162. de Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J, Deleuze JF, Desrochers M, Burdelski M, Bernard O, Oude Elferink RP, Hadchouel M. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci U S A 1998;95:282-287. 163. Wheeler HO, King KK. Biliary excretion of lecithin and cholesterol in the dog. J Clin Invest 1972;51:1337-1350. 164. Gilat T, Somjen GJ. Phospholipid vesicles and other cholesterol carriers in bile. Biochim Biophys Acta 1996;1286:95-115. 165. Somjen GJ, Marikovsky Y, Wachtel E, Harvey PR, Rosenberg R, Strasberg SM, Gilat T . Phospholipid lamellae are cholesterol carriers in human bile. Biochim Biophys Acta 1990;1042:28-35. 166. Somjen GJ, Gilat T. A non-micellar mode of cholesterol transport in human bile. FEBS Lett 1983;156:265-268. 167. Cohen DE, Kaler EW, Carey MC. Cholesterol carriers in human bile: are "lamellae" involved? Hepatology 1993;18:1522-1531. 168. Cohen DE, Carey MC. Rapid (1 hour) high performance gel filtration chromatography resolves coexisting simple micelles, mixed micelles, and vesicles in bile. J Lipid Res 1990;31:2103-2112. 169. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38. 170. Oude Elferink RPJ, Ottenhoff R, van Wijland M, Frijters CMG, van Nieuwkerk CM, Groen AK. Uncoupling of biliary phospholipid and cholesterol secretion in mice with reduced expression of mdr2 P- glycoprotein. J Lipid Res 1996;37:1065-1075. 171. Kuipers F, Oude Elferink RP, Verkade HJ, Groen AK. Mechanisms and (patho)physiological significance of biliary cholesterol secretion. Subcell Biochem 1997;28:295-318:295-318. 172. Elferink RP, Tytgat GN, Groen AK. Hepatic canalicular membrane 1: The role of mdr2 Pglycoprotein in hepatobiliary lipid transport. FASEB J 1997;11:19-28. 173. Verkade HJ, Vonk RJ, Kuipers F. New insights into the mechanism of bile acid-induced biliary lipid secretion. Hepatology 1995;21:1174-1189. 174. Crawford J, Mockel G, Crawford A, Hagen S, Hatch V, Barnes S, Godleski J, Carey M, Miura H, Tazuma S, Kajiyama G. Imaging biliary lipid secretion in the rat: Ultrastructural evidence for vesiculation of the hepatocyte canalicular membrane Partial characterization of regulation of biliary lecithin hydrophobicity: association with organic anion-induced solute cholestasis in rats. Journal of Lipid Research 36(10): 2147 2163 1995;312:795-797. 175. Crawford AR, Smith AJ, Hatch VC, Oude Elferink RPJ, Borst P, Crawford JM. Hepatic secretion of phospholipid vesicles in the mouse critically depends on mdr2 or MDR3 Pglycoprotein expression. Visualization by electron microscopy. J Clin Invest 1997;100:25622567. 176. Oude Elferink RPJ, Groen AK. The mechanism of biliary lipid secretion and its defects. Gastroenterol Clin North Am 1999;28:59-74. 177. Cohen DE. Hepatocellular transport and secretion of biliary lipids. Curr Opin Lipidol 1999;10:295-302. 178. Oude Elferink RP, Groen AK. The role of mdr2 P-glycoprotein in biliary lipid secretion. Cross-talk between cancer research and biliary physiology. J Hepatol 1995;23:617-625.

22

CHAPTER 2 REDUCED PLASMA CHOLESTEROL AND INCREASED FECAL STEROL LOSS IN MDR2 PGLYCOPROTEIN-DEFICIENT MICE LACKING BILIARY LIPIDS Peter J Voshol, Rick Havinga, Henk Wolters, Roel Ottenhoff, Hans MG Princen, Ronald PJ Oude Elferink, Albert K Groen and Folkert Kuipers. Groningen University Institute for Drug Exploration, Center for Liver, Digestive and Metabolic Diseases, Department of Pediatrics, University Hospital Groningen, ‡ Groningen and Department of Gastrointestinal and Liver Diseases, Academic Medical Center, Amsterdam, The Netherlands

Published in Gastroenterology (1998) 114: 1024-1034

Chapter 2: Plasma lipids in mdr2 knockout mice

ABSTRACT Background: Mdr2 P-glycoprotein (Pgp) deficiency in mice leads to absence of biliary phospholipids and cholesterol in the presence of normal bile salt secretion. Aim: To evaluate the importance of the biliary pathway in cholesterol homeostasis by determining the effects of mdr2 Pgp-deficiency on hepatic and plasma lipid levels and cholesterol kinetics in chow-fed mice. Methods: Hepatic lipid content, enzyme activities, plasma lipoprotein levels and fecal sterol excretion were (+/+) and mdr2 Pgp-deficient (Mdr2(-/-)) mice. Cholesterol measured in wildtype Mdr2 kinetics were determined using radiotracer techniques. Results: No differences in (-/-) and Mdr2(+/+) mice. Plasma hepatic lipid content were observed between Mdr2 (-/-) mice when HDL cholesterol and apoA-I levels were strongly reduced in Mdr2 compared to controls, while the apoB contents of VLDL and LDL were increased. (-/-) Hepatic activity of HMG-CoA reductase was three-fold higher in Mdr2 mice than in controls, yet, compartmental analysis of plasma cholesterol decay revealed no (-/-) and Mdr2(+/+) mice. A dual differences in cholesterol synthesis between Mdr2 isotope approach for estimating cholesterol absorption yielded ~50% lower values (-/-) mice than in controls. Surprisingly, Mdr2(-/-) mice showed a four-fold in Mdr2 increase in fecal neutral sterol secretion. Conclusion: This study unequivocally establishes the important direct role of biliary lipids in the regulation of plasma lipid levels in mice.

24

Physiological functions of biliary lipid secretion

INTRODUCTION The hepatobiliary axis appears to play a key role in the maintenance of cholesterol homeostasis [1,2]. Concerning the regulatory aspects of this axis, interest has mainly been focused on the bile salts. Bile salts represent the major catabolic products of cholesterol with a fecal disposal equivalent to 400-600 mg cholesterol per day in humans [1,2]. In addition, bile salts fulfill important physiological functions in the intestinal absorption of lipids [3,4] and, after their reabsorption from the intestine, in the regulation of hepatic cholesterol and bile salt synthesis [1,5], low density lipoprotein (LDL)-receptor activity [6], and very low density lipoprotein (VLDL) production [7,8]. Finally, bile salts control secretion of cholesterol and phospholipids into the bile [9]. Secretion of cholesterol into bile amounts up to 1200 mg/day in humans [1]. A considerable fraction hereof, in the order of 60%, is reabsorbed from the intestine [10]. In view of the fact that the amount of biliary cholesterol entering the intestine exceeds that of dietary cholesterol by a factor of at least two, intestinal reabsorption of biliary cholesterol may represent an important site of control in cholesterol homeostasis. Biliary cholesterol secretion i s coupled to a four-fold higher secretion of bile-specific phospholipids, consisting mainly (95%) of phosphatidylcholine with 16:0-18:1, 16:0-18:2 or 16:0-20:4 acyl chain configuration [11]. Phospholipids are essential for efficient solubilization of biliary cholesterol [12,13] and for protection of cells lining the biliary tree against the detergent action of bile salts [14-16]. Virtually all biliary phospholipids are reabsorbed by the intestine [17]. It has been claimed that these phospholipids are needed for adequate formation and secretion of the apolipoprotein (apo) B48containing chylomicrons in the enterocytes [4,18] and, therefore, for lipid absorption. Thus, both biliary cholesterol and phospholipids are conserved in the enterohepatic circulation. The impact of the circulation of biliary lipids per se on cholesterol homeostasis, however, has not been defined, mainly because it has not been possible to vary output rates of the individual biliary lipids independently from that of bile salts under in vivo conditions. Recently generated mice in which (-/-) the mdr2 gene has been disrupted by homologous recombination (Mdr2 ) (-/-) mice display a provide a new, powerful tool to address this issue. The Mdr2 virtual absence of phospholipids in their bile and a strongly impaired cholesterol secretion [12-14], whereas bile salt output is not affected. Based on these data, it was proposed that mdr2 P-glycoprotein (Pgp) functions as a flippase, responsible for translocation of phospholipids from the inner to the outer leaflet of the bile canalicular membrane prior to their secretion into bile [12,14]. This view i s supported by results from a number of recently published studies [19-22]. In the present study, we have evaluated the effects of mdr2 Pgp-deficiency on plasma lipid levels and on cholesterol kinetics in mice fed a standard, lowcholesterol laboratory chow. The results of this study unequivocally establish a key role of biliary lipid secretion in the regulation of plasma lipoprotein levels. In addition, absence of biliary lipids surprisingly leads to enhanced fecal sterol loss that is not reflected in plasma cholesterol kinetics, indicating disequilibrium between body pools of cholesterol in mdr2 Pgp-deficient mice.

25

Chapter 2: Plasma lipids in mdr2 knockout mice

MATERIALS AND METHODS Materials: Tween-80, Triton WR-1339, glucose-6-phosphate, fatty acid-free bovine serum albumin, oleoyl CoA, 3-hydroxy-3-methylglutaryl (HMG) CoA, and mevalonic acid lactone were purchased from Sigma Chemical Co., St. Louis, MO, USA. Glucose-6-phosphate dehydrogenase, DTT, NADP, ATP, triglyceride and cholesterol (ester) kits were obtained from Boehringer Mannheim GmbH, 14 3 Mannheim, Germany. [ C]HMG-CoA (55 mCi/mmol), [1, 2[n]- H]cholesteryl oleate 3 (45.1 Ci/mmol) and [7(n)- H]cholesterol (3.5 Ci/mmol) were obtained from the 3 Radiochemical Center, Ltd, Amersham, Buckinghamshire, UK. [5- H]Mevalonic 14 14 acid lactone, [4- C]cholesterol (5.8 Ci/mmol) and [1- C]oleoyl CoA (59.35 mCi/mmol) were obtained from New England Nuclear, Boston, MA, USA. All reagents used were of analytical grade. (-/-) and Mdr2(+/+) Animals: We used two to four months old male and female Mdr2 mice with a FVB background [23]. Animals were obtained from the colony at the Central Animal Facility, Academic Medical Center, Amsterdam, The Netherlands. Experimental protocols were approved by the Ethics Committee for Animal Experiments, Faculty of Medical Sciences, University of Groningen, The Netherlands. The animals were housed in a light- (lights on 6 AM-6 PM) and o temperature- (21 C) controlled environment. After weaning they were fed a commercial lab chow (RMH-B, Hope Farms BV, Woerden, The Netherlands), which contained 6.2% (wt/wt) fat and approximately 0.01% cholesterol (wt/wt). Food and tap water was available ad libitum.

Experimental procedures: Male and female mice of both genotypes, four-five per group, were anaesthetized with halothane. A large blood sample (0.6-1.0 mL) was obtained by heart puncture, transferred to EDTA-containing tubes and centrifuged o to obtain plasma. A portion of the plasma samples was kept at 4 C and used for FPLC size fractionation of lipoproteins as detailed below within 48 h. The o remainder of the samples was stored at -20 C until analysis. Immediately after blood collection, the liver was excised, weighed and frozen in liquid nitrogen for subsequent determination of hepatic lipid content and of mRNA levels (see below). Additional small blood samples (0.1 mL) for plasma lipid analysis only were obtained from 7-9 animals per group by tail bleeding under light halothane (-/-) (+/+) mice kept on the same anesthesia. Separate groups of male Mdr2 and Mdr2 diet were used for determination of the hepatic activities of HMG CoA reductase and acyl-CoA:cholesterol acyltransferase (ACAT). 3 Cholesterol kinetics were determined after an intravenous injection of Hlabeled cholesterol (0.33 mg, 3 µCi) dissolved in a 20% Lipofundin S (Braun Medical BV, Oss, The Netherlands) solution in phosphate-buffered saline via a tail vein. Blood samples were drawn at 30 minutes, 4 hours, 1, 2, 3, 4, 7, 10, 14 and 17 days after injection by tail bleeding. Blood samples (0.06 mL) were extracted 3 according to (24) and H-activity in the extracts was measured in a scintillation counter. Total cholesterol in the extracts was determined enzymatically (see below). Analysis of the data was by two-compartment analysis as proposed by Quarfordt et al. [24] with MultiFit, a computer program developed by dr. J.H. Proost, University Centre for Pharmacy, Groningen, The Netherlands. Feces was collected from individual mice in timed intervals. Freeze dryed samples were extracted and 26

Physiological functions of biliary lipid secretion

radioactivity in the chloroform phase and the water phase, the latter after concentration on SepPak C18 columns (Waters Corp., Milford, MA), was determined. Cholesterol absorption was assessed by the dual-isotope method described by Zilversmit and Hughes [25] as recently modified for use in rodents by 3 Turley et al. [26]. In short, animals recieved an i.v. dose of H-labeled cholesterol (0.27 mg, 2.5 µCi) dissolved in Lipofundin S and, at the same time, an oral dose 14 C-labeled cholesterol (0.07 mg, 1.0 µCi) dissolved in MCT oil. After 48 hours animals were sacrificed and the ratio between 14C-labeled and 3H-labeled cholesterol was determined in plasma by scintilation counting. The formula used to calculate the cholesterol absorption was: 14 % cholesterol absorption = (% intragastric C dose per mL plasma / % 3 intravenous H dose per mL plasma) x 100. 14 3 The C to H ratio of hepatic and intestinal cholesterol was also measured to check equilibration of cholesterol administered via the different routes. All experiments were performed between noon and 4 PM to exclude potential effects of circadian variations; animals were not fasted prior to experiments unless stated otherwise. Lipid analyses: Plasma concentrations of cholesterol, cholesterol ester and triglycerides (without measuring free glycerol) were measured using commercially available kits (Boehringer Mannheim Germany) according to the instructions provided. Contents of cholesterol, cholesterol ester, triglycerides and phospholipids in liver tissue were determined after lipid extraction [27] a s described previously [28]. Lipoprotein size fractionation: For FPLC size fractionation of plasma lipoproteins, 0.2 mL of pooled plasma from at least three animals per group was injected onto a 25 mL Superose 6 prep grade column (Pharmacia, Upsalla, Sweden) and eluted at a constant flow of 0.5 mL/min with phosphate buffered saline (pH 7.4). The effluent was collected in 0.5 mL fractions and cholesterol and triglyceride concentrations were measured as described. The lipoproteins were identified on the basis of the elution profile of human plasma lipoproteins. Western blot analysis: For Western blot analysis, proteins of FPLC samples containing VLDL/LDL and HDL fractions were size-separated by SDS-PAGE using 4-15% gradient gels (Tris-Glycerine, Ready Gels, BioRad, Hercules CA, USA). Proteins were transferred to nitrocellulose membranes (Amersham, ECLhyperbound, Buckinghamshire, UK) by tankblotting (BioRad) followed by incubation with polyclonal rabbit anti-rat apoB (kindly provided by Dr. R.A. Davis, San Diego, CA, USA) and with rabbit anti-human apoA-I (IgG fraction, Calbiochem, San Diego, CA, USA). As second antibody a goat anti-rabbit IgG HRP (Amersham, Buckinghamshire, UK), was used. Detection was done by ECL-Western Blotting detection reagents (Amersham) according to the instructions provided. HMG-CoA reductase and ACAT assays: Microsomes were isolated [29] from livers (-/-) (+/+) male mice for determination of HMG CoA reductase and of Mdr2 and Mdr2 ACAT activities, as described by Phillip and Shapiro [30] and Billheimer et al. [31], respectively. 27

Chapter 2: Plasma lipids in mdr2 knockout mice

Determination of mRNA levels: mRNA was isolated from livers of Mdr2(-/-) and (+/+) male mice and analyzed for mRNA levels of HMG-CoA reductase, Mdr2 cholesterol 7α-hydroxylase, cholesterol 27-hydroxylase, LDL receptor, apo B, apo A-I, albumin and fibrinogen as previous described [32]. Fecal sterol analysis: Seven to nine male Mdr2(-/-) and Mdr2(+/+) mice were housed individually and total fecal production during a one week-period was separated from the wood shavings. Fecal samples were lyophilized and weighed. Aliquots hereof were used for determination of neutral and acidic sterol content by gas liquid chromatographic procedures described [33,34]. Miscellaneous methods: Protein was determined according to Lowry et al. [35], with BSA as standard. Statistics: All values represent mean ± standard deviation for the indicated number of animals per group. Differences between the two groups of mice were analyzed by means of a Mann-Whitney U test [36]. A p value < 0.05 was considered significant.

RESULTS Hepatic lipid content: Figure 1 shows the hepatic content of free cholesterol, cholesterol esters, triglycerides and phospholipids, expressed as nmol/mg (+/+) and Mdr2(-/-) protein, in male (panel A) and female (panel B) mice of the Mdr2 genotype. Free cholesterol in the livers of both male and female Mdr2(-/-) mice (+/+) mice but these differences did tended to be increased compared to the Mdr2 not reach statistical significance. No significant differences were observed in (+/+) and Mdr2(-/-) male cholesterol ester and phospholipid content between Mdr2 and female mice but triglyceride levels were significantly lower in livers of female (-/-) mice compared to those of female Mdr2(+/+) mice. Mdr2 Pgp-deficiency Mdr2 resulted in increased liver weight, particularly in females as previously described [12]. Figure 1: Hepatic lipid content in male and female Mdr2(+/+) and Mdr2(-/-) mice on a regular chow diet; FC, free cholesterol; CE, cholesterol ester; TG, triglycerides; PL, phospholipids (value divided by 10). All values represent nmol per mg protein. n = 4, mean ± SD. *p = 0.02 difference as assessed by Mann-Whitney U test. ˇ Mdr2(+/+) mice, ˛ Mdr2(-/) mice

28

Physiological functions of biliary lipid secretion

Plasma lipid levels and lipoprotein profiles: Figure 2 shows plasma cholesterol (panel A) and triglyceride (panel B) concentrations in non-fasted male and female (+/+) and Mdr2(-/-) mice. Plasma cholesterol levels of both male and female Mdr2 (-/-) mice were reduced by about 65% when compared to Mdr2(+/+) controls. Mdr2 Cholesterol esters amounted up to about 70% of total plasma cholesterol and was similar in all groups. Heterozygous (+/-) mice showed a 25% reduction in plasma cholesterol (data not shown). Plasma triglyceride levels were decreased by about (-/-) mice compared to male controls, whereas female Mdr2(-/-) 55% in male Mdr2 mice showed no significant differences in comparison to Mdr2(+/+) mice in this respect. Fasted values for plasma cholesterol and triglycerides were similar to the non-fasted ones (data not shown). Figure 2: Plasma cholesterol (panel A) and triglyceride (panel B) levels in chowfed male and female Mdr2(+/+) and Mdr2(-/-) mice. Values represent mmol/L, n = 10 male Mdr2(+/+), n = 8 male Mdr2(/-) , n = 8 female Mdr2(+/+) and n = 8 female Mdr2(-/-), * p < 0.05, assessed by Mann-Whitney U test. ˇ Mdr2(+/+) mice, ˛ Mdr2(-/-) mice

Figure 3 shows the cholesterol and triglyceride contents in the different plasma lipoprotein fractions of male mice after FPLC size-chromatography. The reduction (-/-) mice was due to a strong reduction of the in plasma cholesterol in the Mdr2 HDL size fractions (panel A). The decrease of plasma triglyceride levels in the (-/-) male Mdr2 mice was due to a strong reduction in the VLDL size fractions (panel B), while the triglyceride content of the IDL/LDL size fractions appeared to be slightly, but consistently, increased. Figure 3: Cholesterol (panel A) and triglyceride (panel B) profiles after FPLC size chromatography of plasma from male Mdr2(+/+) and Mdr2(-/-) mice. Values represent mmol/L in each fraction, mean of 3 samples is shown. ------- Mdr2(+/+) mice, _______ Mdr2(-/-) mice.

29

Chapter 2: Plasma lipids in mdr2 knockout mice

Western blot analysis of apo B and A-I contents in the different FPLC fractions revealed a markedly higher content of apoB48 and apoB100 (Figure 4, upper lanes) in both the VLDL and LDL fractions of knockout mice. As expected, the apo A-I content was decreased (Figure 4, lower lanes) in the HDL fractions of the (-/-) mice as compared to their controls. Similar patterns were observed for Mdr2 female mice. Hepatic enzyme activity and mRNA levels: Table 1 shows the activities of HMG(+/+) and Mdr2(-/-) mice. Enzyme CoA reductase and ACAT in livers of male Mdr2 (-/-) mice activities were increased three- and two-fold, respectively, in Mdr2 (+/+) mice. Figure 5 shows the relative mRNA levels of HMG-CoA compared to Mdr2 reductase, cholesterol 7α-hydroxylase, cholesterol 27-hydroxylase, LDL receptor, apo B, apo A-I, albumin and fibrinogen in male Mdr2(-/-) and Mdr2(+/+) mouse livers. No significant differences were observed for these specific mRNA levels between (+/+) and Mdr2(-/-) mice. Mdr2 Figure 4: Western blot analysis of apolipoprotein B (apo B) and apolipoprotein A-I (apo A-I) in FPLC fractions of plasma from male Mdr2(+/+) and Mdr2(-/-) mice as shown in figure 3. Protein present in the various fractions were separated by SDS-PAGE gel electrophoresis, blotted onto nitrocellulose membranes and visualized as described in detail in the Methods section.

Table 1: Hepatic activities of 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMG-CoA reductase) and Acyl-Coenzym A cholesterol acyltransferase (ACAT) in chow-fed male Mdr2(+/+) and Mdr2(-/-) mice. Mdr2(-/-) Mdr2(+/+) HMG-CoA reductase 0.06 ± 0.01 0.21 ± 0.04 * ACAT 0.53 ± 0.01 0.95 ± 0.08 * Values represent nmol/min/mg protein, mean ± SD, n = 2, *p < 0.05 Figure 5: Hepatic mRNA levels in livers of chow-fed male Mdr2(+/+) and Mdr2(-/-) mice. Values represent the ratio of specific mRNA to RIBO mRNA as detailed in the Methods section; values for Mdr2(+/+) mice were taken as 100%. Abbreviations: 7a, cholesterol 7α hydroxylase; 27OH, cholesterol 27hydroxylase; LDLr, LDL receptor; HMG, HMG-CoA reductase; Apo A-I, apolipoprotein A-I; Apo B, apolipoprotein B; alb, albumin; FNA, αfibrinogen; FNB, β-fibrinogen. n = 3, mean ± SD, no significant differences were observed between groups, as assessed by Mann-Whitney U test. ˇ Mdr2(+/+) mice, ˛ Mdr2(-/-) mice

30

Physiological functions of biliary lipid secretion

Cholesterol kinetics: The plasma decay of radiolabeled cholesterol showed a rapid initial phase followed by a distinctly slower terminal phase (Figure 6, upper panel). Kinetic analysis of the curves revealed increased distribution volumes, i.e., 12.2 ± 3.3 mL vs. 6.3± 0.2 mL (p < 0.05) for the first (“rapid”) compartment and 12.7 (-/-) ± 3.7 mL vs. 6.1 ± 0.5 mL (p < 0.05) for the second compartment, in Mdr2 mice when compared to controls. No difference in cholesterol transport (equivalent to synthesis) was noted, i.e., 7.13 ± 1.36 and 7.09 ± 0.98 µmol/day, in Mdr2(-/-) and Mdr2(+/+) mice, respectively. There were no significant differences in other kinetic parameters (see legends figure 6). Analysis of fecal radioactivity (Figure 6, lower panel) revealed that the 3 fraction of H-cholesterol recovered in the neutral sterol fraction was considerably (-/-) smaller in Mdr2 mice than in controls, but still appreciable, i.e., ~4% dose in 17 3 days. Conversion of i.v. administered H-cholesterol to bile salts disposed into (-/-) feces during the course of the experiment was somewhat slower in Mdr2 than in (+/+) mice. Mdr2 Table 2 shows the results of cholesterol absorption measurements by the dualisotope method [25,26]. Apparent cholesterol absorption was 70% and 42%, (+/+) and Mdr2(-/-) mice. As expected, the normalized ratios respectively, for Mdr2 14 3 between C-labeled and H-labeled cholesterol in plasma, liver and intestine were (+/+) mice at 48 h after injection, indicative for equilibration similar in the Mdr2 between orally and intravenously administered cholesterol across these organs. In (-/-) mice, in contrast, liver and intestine were clearly not (yet) in equilibrium Mdr2 with plasma, thus prohibiting any conclusion about actual cholesterol absorption efficiency by dual-isotope methodology in these animals. Table 2: Apparent cholesterol absorption and normalized 14C/3H ratios in plasma, liver and intestine in Mdr2(+/+) and Mdr2(-/-) mice at 48 h after an oral dose of 14C-labeled cholesterol and an i.v. dose of 3H-labeled cholesterol. 14 14 14 C/3H plasma C/3H liver C/3H intestine apparent absorption Mdr2(+/+) 70 ± 13 0.7 ± 0.1 0.9 ± 0.2 0.9 ± 0.3 Mdr2(-/-) 42 ± 8a 0.4 ± 0.1a 0.7 ± 0.1ab 1.3 ± 0.3b The results are presented as mean ± SD. a significant difference between -/- and +/+, p < 0.05 b significant difference ratio liver and intestine from ratio plasma, p < 0.05

Fecal neutral and acidic sterol content and secretion: Figure 7 shows the fecal (+/+) and Mdr2(-/-) mice, expressed a s neutral and acidic sterol output in male Mdr2 µmol/day. Fecal total neutral sterol (panel A) and cholesterol (data not shown) (-/-) mice compared to the control excretion was four-fold increased in the Mdr2 (+/+) mice. Total fecal acidic sterol excretion was slightly reduced in male Mdr2 (-/-) Mdr2 mice (panel B). Analysis of fecal bile salt composition revealed a decrease (-/-) mice whereas the in the relative amounts of cholate and deoxycholate in Mdr2 relative contribution of muricholate showed an two-fold increase. Food intake and feces mass production did not differ between the groups (data not shown). 31

Chapter 2: Plasma lipids in mdr2 knockout mice

Figure 6: Plasma cholesterol decay (panel A) and recovered radioactivity in neutral and acidic fractions of feces (panel B) after intravenous injection of 3H-cholesterol in chow-fed control Mdr2(+/+) and Mdr2(-/-) mice. Data for Mdr2(+/+) mice are indicated by open symbols, those for Mdr2(-/) mice by closed symbols. Panel A: Isotopic data are expressed as the fraction of injected radioactivity per µmol of cholesterol. The plasma decay data were analyzed by a twocompartment model, revealing the following kinetic parameters: V1 (mL) Pool size1 V2 (mL) k10 k12 k21 (µmol) Mdr2(+/+) 6.3± 0.2 34.4± 4.7 6.1± 0.5 0.24± 0.02 0.39± 0.18 0.39± 0.15 Mdr2(-/-) 12.2± 3.3* 40.7± 11.4 12.7± 3.7* 0.24± 0.03 0.32± 0.11 0.32± 0.14 V1, V2: distribution volume of first and second compartment, respectively; k10, k12, k21: elimination rate constants describing removal and transfer between pools. Panel B: Cummulative excretion of radioactivity in neutral sterol fraction (diamonds) and acidic sterol fraction (squares) after intravenous injection of 3H-cholesterol in Mdr2(+/+) and Mdr2(-/-) mice. Values represent percentage of injected dose, mean ± SD, n = 5 per group, *indicates significant difference between Mdr2(+/+) and Mdr2(-/-), shown for 17 day point only for reasons of clearity. Figure 7: Fecal neutral sterol (panel A) and bile salt (panel B) output in male Mdr2(+/+) and Mdr2(-/-) mice. Values represent total output in µmol/day. n = 10 Mdr2(+/+) mice and 8 Mdr2(-/-) mice, mean ± SD, * indicates significant difference between groups, as assessed by Mann-Whitney U test. ˇ Mdr2(+/+) mice, ˛ Mdr2(-/-) mice

DISCUSSION In this study we have used the mdr2 Pgp-deficient mouse model to evaluate the role of biliary lipids in the maintenance of cholesterol homeostasis and in the regulation of plasma lipid levels. Originally, mdr2 Pgp-deficiency was induced in mice of the 129/Ola strain [14] but, because of poor breeding of this strain, the deficiency has been bred into the FVB background [12]. In the FVB strain, mdr2 Pgp-deficiency leads to similar changes in bile composition as observed in the 129/Ola strain, i.e., no phospholipid secretion and a strongly reduced cholesterol secretion (-97%) in the presence of a normal bile salt secretion, as described in 32

Physiological functions of biliary lipid secretion

detail by Oude Elferink et al. [12]. In the present study, we have analyzed hepatic and plasma lipid levels, cholesterol kinetics, cholesterol absorption and fecal (+/+) and mdr2 gene knock out (Mdr2(-/-)) FVB mice that sterol output in control Mdr2 were kept on a standard, low-cholesterol / low-fat chow diet. No significant differences were observed in hepatic cholesterol and (-/-) (+/+) mice when cholesterol ester content of the Mdr2 mice compared to the Mdr2 expressed as nmol per mg of protein, the latter in spite of increased ACAT activity. The phospholipid content of the liver showed no significant differences across all groups, presumably indicating that hepatic PC synthesis has adapted to the absence of biliary secretion. Plasma lipid analysis revealed an unexpected reduction in cholesterol (-/-) (+/+) mice in both sexes, while concentration in Mdr2 mice as compared to Mdr2 triglycerides were reduced in males only. Surprisingly, the apoB contents of VLDL (-/-) animals. These effects are unlikely and LDL fractions were increased in Mdr2 due to liver pathology associated with this deficiency, as 1) the effects are larger in the FVB strain than previously found in the 129/Ola strain (plasma cholesterol reduction of approximately 50%), which showed more severe liver pathology than (-/-) the FVB Mdr2 mice [12], 2) effects of mdr2 Pgp-deficiency on plasma cholesterol were similar in male and female mice, while the latter show markedly more liver (-/-) mice no signs of hepatocytic damage are found pathology [15,16], 3) in Mdr2 and mRNA levels of acute phase markers, albumin and fibrinogen, were similar in (-/-) and Mdr2(+/+) mice, 4) liver disease associated with impaired lipid Mdr2 secretion into bile, such as cholestasis, is generally associated with increased plasma lipid levels rather than reduced levels [37-40], and finally, 5) heterozygous (+/-) mice show no signs of liver pathology [14] but do show a 25% reduction in plasma cholesterol. At the moment, we can only speculate about the mechanisms underlying these changes in (apo)lipoprotein levels. First, a reduced absorption of dietary lipids and the absence of biliary lipids for reabsorption from the intestine may contribute. Biliary phospholipids, cholesterol and bile salts appear to be required for efficient absorption of lipids from the intestine [3,4]. Absence of biliary lipid components impairs apo B48 synthesis and secretion of apoB48-containing chylomicrons by the enterocytes [41]. Recently, it was shown that specifically PC, the major phospholipid species in bile, stimulates secretion of triglyceride-rich lipoproteins by CaCo-2 cells [42]. Therefore, one may expect lipid malabsorption (-/-) mice. As HDL and impaired chylomicron formation in the intestine of the Mdr2 particles are, in part, derived from chylomicron surface material, reduced (-/-) chylomicron formation may contribute to low HDL levels in Mdr2 mice. Impaired intestinal HDL formation may also play a role: interruption of the enterohepatic circulation by cholestyramine feeding [43] and bile diversion [44] has been shown to reduce intestinal apo A-I mRNA levels. Alternatively, HDL cholesterol [45] and phospholipids [46] are preferentialy used for bile secretion: the reduction in HDL could be a physiological reaction of the liver to compensate for the absence of biliary lipid secretion. Yet, hepatic apolipoprotein A-I mRNA levels were equal in (-/-) mice could be a both groups. Elevated apoB levels in plasma of Mdr2 consequence of the reciprocal relationship that has been described between biliary cholesterol secretion and VLDL secretion [47-49]. Thus, manouvers leading to increased disposition of cholesterol into bile result in decreased VLDL secretion and vice versa. This scenario would, in part, explain elevated levels of liver-derived 33

Chapter 2: Plasma lipids in mdr2 knockout mice (-/-) apo B100 and apo B48 in VLDL and LDL fractions in plasma of Mdr2 mice. The resulting plasma lipid profiles obviously represents the consequence of complex interactions between secretory processes and removal of lipids from plasma, interactions that cannot be fully appreciated on the basis of our results so far. To gain more insight herein, we investigated cholesterol synthesis and kinetics in detail in these animals by “standard” techniques. (-/-) Activity of HMG-CoA reductase was increased in livers of male Mdr2 mice, indicative for increased hepatic cholesterol synthesis. The mRNA levels of HMG(-/-) (+/+) mice, CoA reductase were similar in the livers of male Mdr2 mice and Mdr2 suggesting post-transcriptional modulation of enzyme activity. Cooper et al. [37,38] and others [39,50] have reported increased cholesterol synthesis and HMG-CoA reductase activity/mRNA levels in the liver of rats with biliary obstruction, another experimental model in which the flow of biliary cholesterol, phospholipids as well as of bile salts to the intestine is absent. Reduced delivery of chylomicron-remnant cholesterol for feedback inhibition due to impaired cholesterol absorption [51,52] and defective control of hepatic cholesterogenesis due to reduced formation of regulatory sterols [37,39] have been proposed to underlie this apparent paradoxical response to bile duct ligation. It should be noted that bile duct ligation results in an increased hepatic cholesterol content when expressed per m g protein and in elevated plasma cholesterol concentrations in rats [39]. As these (-/-) mice, the mechanism(s) involved in phenomena do not occur in Mdr2 upregulation of HMG-CoA reductase may be different in both situations. It is clear, however, that increased bile salt synthesis, in most experimental models associated with increased hepatic cholesterol synthesis, is not the cause. We found no effects of mdr2 Pgp-deficiency on hepatic mRNA levels of cholesterol 7αhydroxylase and cholesterol 27-hydroxylase, enzymes catalyzing the first steps of the ‘neutral’ and ‘acidic’ pathways in bile salt synthesis, respectively [53]. Furthermore, fecal bile salt output, under steady-state conditions identical to hepatic production rate, was even slightly decreased in the male knockout mice. (+/+) and Mdr2(-/-) mice The differences in fecal bile salt composition between Mdr2 are in accordance with the differences in biliary bile salts noted earlier [13]. In contrast to measurement of hepatic HMG-CoA reductase activity, kinetic analysis of plasma cholesterol decay did not reveal differences in cholesterol (-/-) and synthesis in the central compartment, including the liver, between Mdr2 Mdr2(+/+) mice, i.e., about 7-8 µmol/day in both strains. Values obtained by this approach were in excellent agreement with those of Quarfordt et al. [24] using similar methodology in mice. In fact, estimates of total body cholesterol synthesis based on the difference between intake (about 0.9 µmol/day) and output (sum of fecal neutral and acidic sterols) yielded values in the same order of magnitude for control mice, i.e., about 11 µmol/day. In marked contrast, total body cholesterol synthesis based on fecal analysis in Mdr2(-/-) mice, i.e., about 30 µmol/day, was much higher than the value derived from plasma cholesterol kinetics. This discrepancy can, to our opinion, only be explained by assuming increased (-/-) mice that does not contribute to cholesterol synthesis in the intestine of Mdr2 plasma cholesterol. The several-fold increase in “endogenous cholesterol (-/-) secretion” in Mdr2 mice may therefore be due to an accellerated desquamation of enterocytes, possibly caused by cytotoxic effects of lipid-free bile, in conjunction with a derepressed intestinal cholesterol synthesis as a result of the absence of

34

Physiological functions of biliary lipid secretion

biliary cholesterol and disturbed cholesterol absorption. The relevance of bile in the regulation of fecal sterol secretion was also evident in a recent study performed in our laboratory [54], showing a two-fold increase in neutral sterol secretion in long-term bile diverted rats. In this condition, we noted a marked proliferation of intestinal mucosa (Minich et al., unpublished results). Attempts to quantify the efficiency of intestinal cholesterol absorption in (-/-) mice using the dual-isotope approach optimized for use in rodents by Mdr2 Turley et al. [26], were hampered by incomplete equilibration of intravously and (-/-) mice. In particular, the high intragastrically administered cholesterol in Mdr2 14 3 C/ H ratio in the intestine indicates that orally administered cholesterol i s sequestered in the intestinal wall. Therefore, the estimates of cholesterol absorption obtained by this method, i.e., about 70% in controls and 40% in the (-/-) mice. It is very likely, however, that knock-outs, are not reliable for Mdr2 (-/-) mice. For instance, recent work by cholesterol absorption is impaired in Mdr2 Mackay et al. [55] demonstrates that pancreatic phospholipase A2-mediated phosphatidylcholine hydrolysis is required for efficient uptake of cholesterol by CaCo2 cells. In any case, the data summarized in table 2 support our suggestion that, in the absence of biliary cholesterol, cholesterol of intestinal origin does not, or only slowly, reach the plasma compartment, possibly due to impaired chylomicron formation. Another point worthwhile noting relates to the contribution of biliary (+/+) mice, total neutral cholesterol to fecal neutral sterol secretion in mice. In Mdr2 sterol excretion was about 3 times larger than the sum of the calculated daily input of biliary cholesterol into the intestine (0.96 µmol/day [13]) and dietary cholesterol intake (0.9 µmol/day). Assuming that at least 70% of biliary and dietary cholesterol will be (re)absorbed, this means that the majority of fecal sterols under the dietary conditions employed in this study must originate from endogenous secretion, i.e., most likely from turnover of intestinal cells. Data shown in Figure 6B demonstrate that, in the absence of biliary cholesterol secretion, a relatively small part (4% dose/17 days) of circulating plasma cholesterol is secreted into feces in the form of neutral sterol, a fraction that is doubled in animals with normal bile composition. Thus, endogenous secretion mainly involves cholesterol locally synthesized in the intestine. This simple calculation also supports our hypothesis that increased (-/-) mice originates from accellerated turnover of fecal sterol secretion in Mdr2 intestinal cells in these animals and, most importantly, underlines the role of biliary lipids in the regulation of this quantitatively very important pathway in cholesterol homeostasis. In conclusion, this study delineates the important role of biliary phospholipid and cholesterol secretion in the regulation of plasma lipid levels and maintenance of a normal sterol balance in mice. Our results suggest that, in the absence of biliary lipid secretion, intestinal cholesterol absorption is impaired and intestinal cell turnover is increased leading to a strongly increased fecal excretion of the sterol. This combination of effects more than compensates for the lack in biliary cholesterol secretion. Interestingly, the increase in fecal sterol excretion i s accompanied by a decrease in serum HDL. The molecular mechanism underlying this interaction is presently under investigation.

35

Chapter 2: Plasma lipids in mdr2 knockout mice

ACKNOWLEDGMENTS The authors thank Elly de Wit, Renze Boverhof and Hans Bartels for skillful technical assistance. MultiFit computer software used for kinetic studies was kindly provided by dr. J.H. Proost, University Centre for Pharmacy, Department of Pharmacokinetics and Drug Delivery, University of Groningen, The Netherlands. Parts of this work have been presented at the 68th Scientific Sessions of the American Heart Association, November 1995 at Anaheim, CA (Kuipers et al., 1995 Circulation 98(8), I-105, abstract) and at the meeting of the European Association for Study of the Liver, London UK, April 1997 (Voshol et al., 1997 J Hepatol 26, 123, abstract). These studies were supported by grant 902-23-097 from the Netherlands Organization for Scientific Research (NWO) and a by grant from Nutricia B.V., Zoetermeer, The Netherlands.

REFERENCES 1. Dietschy JM, Turley SD, Spady DK. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res 1993;34:1637-1659. 2. Packard CJ, Shepherd J. The hepatobiliary axis and lipoprotein metabolism: effects of bile acid sequestrants and ileal bypass surgery. J Lipid Res 1982;23:1081-1098. 3. Carey MC, Hernell O. Digestion and absorption of fat. Sem Gastroint Dis 1992;3:189-208. 4. Tso P. Intestinal lipid absorption, In: Johnson LR, ed. Physiology of the Gastrointestinal Tract. New York: Raven Press, 1994:1867-1907. 5. Duckworth PF, Vlahcevic ZR, Studer EJ, et al. Effect of hydrophobic bile acids on 3-hydroxy3-methylglutaryl-coenzyme A reductase activity and mRNA levels in the rat. J Biol Chem 1991;266:9413-9418. 6. Spady DK, Stange EF, Bilhartz LE, Dietschy JM. Bile acids regulate hepatic low density lipoprotein receptor activity in the hamster by altering cholesterol flux across the liver. Proc Natl Acad Sci U S A 1986;83:1916-1920. 7. Lin Y, Havinga R, Schippers IJ, Verkade HJ, Vonk RJ, Kuipers F. Characterization of the inhibitory effects of bile acids on very-low-density lipoprotein secretion by rat hepatocytes i n primary culture. Biochem J 1996;316:531-538. 8. Lin Y, Havinga R, Verkade HJ, et al. Bile acids suppress the secretion of very-low-density lipoprotein by human hepatocytes in primary culture. Hepatology 1996;23:218-228. 9. Verkade HJ, Vonk RJ, Kuipers F. New insights into the mechanism of bile acid-induced biliary lipid secretion. Hepatology 1995;21:1174-1189. 10. Wilson MD, Rudel LL. Review of cholesterol absorption with emphasis on dietary and biliary cholesterol. J Lipid Res 1994;35:943-955. 11. Hay DW, Cahalane MJ, Timofeyeva N, Carey MC. Molecular species of lecithins in human gallbladder bile. J Lipid Res 1993;34:759-768. 12. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38. 13. Oude Elferink RP, Ottenhoff R, van Wijland M, Frijters CM, van Nieuwkerk C, Groen AK. Uncoupling of biliary phospholipid and cholesterol secretion in mice with reduced expression of mdr2 P-glycoprotein. J Lipid Res 1996;37:1065-1075. 14. Smit JJ, Schinkel AH, Oude Elferink RP, et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462. 15. Nieuwkerk van CMJ, Oude Elferink RPJ, Groen AK, et al. Effects of ursodeoxycholate and cholate feeding on liver disease in FVB-mice with a disrupted mdr2 P-glycoprotein gene. Gastroenterology 1996;111:165-171. 16. Nieuwkerk van CMJ, Groen AK, Ottenhoff R, et al. The role of bile salt composition in liver (-/-) mice: differences between males and females. J Hepatol 1997;26:138pathology of mdr2 145. 17. Robins SJ. Recirculation and reutilization of micellar bile lecithin. Am J Physiol 1975;229:598-602.

36

Physiological functions of biliary lipid secretion 18. Davidson NO, Kollmer ME, Glickman RM. Apolipoprotein B synthesis in rat small intestine: regulation by dietary triglyceride and biliary lipid. J Lipid Res 1986;27:30-39. 19. Nies AT, Gatmaitan Z, Arias IM. ATP-dependent phosphatidylcholine translocation in rat liver canalicular plasma membrane vesicles. J Lipid Res 1996;37:1125-1136. 20. Ruetz S, Gros P. Enhancement of mdr2-mediated phosphatidylcholine translocation by the bile salt taurocholate. Implications for hepatic bile formation. J Biol Chem 1995;270:2538825395. 21. Ruetz S, Gros P. Phosphatidylcholine translocase: a physiological role for the mdr2 gene. Cell 1994;77:1071-1081. 22. Ruetz S, Raymond M, Gros P. Functional expression of P-glycoprotein encoded by the mouse mdr3 gene in yeast cells. Proc Natl Acad Sci U S A 1993;90:11588-11592. 23. Groen AK, Van Wijland MJ, Frederiks WM, Smit JJ, Schinkel AH, Oude Elferink RP. Regulation of protein secretion into bile: studies in mice with a disrupted mdr2 p-glycoprotein gene. Gastroenterology 1995;109:1997-2006. 24. Quarfordt SH, Oswald B, Landis B, Xu HS, Zhang SH, Maeda N. In vivo cholesterol kinetics in apolipoprotein E-deficient and control mice. J Lipid Res 1995;36:1227-1235. 25. Zilversmit DB, Hughes LB. Validation of a dual-isotope plasma ratio method for measurment of cholesterol absorption in rats. J Lipid Res 1974;15:465-473. 26. Turley SD, Herndon MW, Dietschy JM. Reevaluation and application of the dual-plasma isotope plasma ratio method for the measurement of intestinal cholesterol absoption in the hamster. J Lipid Res 1994;35:328-339. 27. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Biophys 1959;37:911-917. 28. Kuipers F, Van Ree JM, Hofker HM, et al. Altered lipid metabolism in apolipoprotein Edeficient mice does not affect cholesterol balance across the liver. Hepatology 1996;24:241247. 29. Smit HJ, Temmerman AM, Wolthers H, Kuipers F, Beyen AC, Vonk RJ. Dietary fish-oil induced changes in intrahepatic cholesterol transport and bile acid synthesis in rats. J Clin Invest 1991;88:943-951. 30. Philipp BW, Shapiro DJ. Improved methods for the assay and activation of 3-hydroxy-3methylglutaryl coenzyme A reductase. J Lipid Res 1979;20:588-593. 31. Billheimer JT, Tarani D, Nes WR. Effect of a dispersion of cholesterol in Triton WR 1339 on acylCoA:cholesterol acyltransferase in rat liver microsomes. Anal Biochem 1981;111:331-335. 32. Twisk J, Lehmann EM, Princen HM. Differential feedback regulation of cholesterol 7 alphahydroxylase mRNA and transcriptional activity by rat bile acids in primary monolayer cultures of rat hepatocytes. Biochem J 1993;290:685-691. 33. Arca M, Montali A, Ciocca S, Angelico F, Cantafora A. An improved gas-liquid chromatographic method for the determination of fecal neutral sterols. J Lipid Res 1983;24:332-335. 34. Setchell KD, Lawson AM, Tanida N, Sjovall J. General methods for the analysis of metabolic profiles of bile acids and related compounds in feces. J Lipid Res 1983;24:10851100. 35. Lowry OH, Rosebrough NJ, Farr AL, Randall RL. Protein measurment with the folin reagens. J Biol Chem 1951;193:265-275. 36. Dawson-Saunders B, Trapp RG. Basic and clinical Biostatistics. USA: Lange Medicals Books, 1990. 37. Cooper AD, Ockner RK. Studies of hepatic cholesterol synthesis in experimental acute biliary obstruction. Gastroenterology 1974;66:586-595. 38. Cooper AD, Jones AL, Koldinger RE, Ockner RK. Selective biliary obstruction: a model for the study of lipid metabolism in cholestasis. Gastroenterology 1974;66:574-585. 39. Dueland S, Reichen J, Everson GT, Davis RA. Regulation of cholesterol and bile acid homoeostasis in bile-obstructed rats. Biochem J 1991;280:373-377. 40. Long TT, Jakoi L, Stevens R, Quarfordt S. The sources of rat biliary cholesterol and bile acid. J Lipid Res 1978;19:872-878. 41. Davidson NO, Drewek MJ, Gordon JI, Elovson J. Rat intestinal apolipoprotein B gene expression. Evidence for integrated regulation by bile salt, fatty acid, and phospholipid flux. J Clin Invest 1988;82:300-308. 42. Field FJ, Born E, Chen H, Murthy S, Mathur SN. Regulation of apolipoprotein B secretion by biliary lipids in CaCo-2 cells. J Lipid Res 1994;35:749-762. 43. Felgines C, Mazur A, Rayssiguier Y. Effect of the interruption of enterohepatic circulation of bile acids by cholestyramine on apolipoprotein gene expression in the rat. Life S c i 1994;55:1053-1060.

37

Chapter 2: Plasma lipids in mdr2 knockout mice 44. Sonoyama K, Nishikawa H, Kiriyama S, Niki R. Bile diversion lowers apolipoprotein A-I and A-IV mRNA levels in rat ileum. J Nutr Sci Vitaminol Tokyo 1994;40:343-352. 45. Robins SJ, Fasulo JM. High density lipoprotein, but not other lipoproteins, provide a vehicle for sterol transport in bile. J Clin Invest 1997;99:380-384. 46. Portal I, Clerc T, Sbarra V, et al. Importance of high-density lipoproteinphosphatidylcholine in secretion of phospholipid and cholesterol in bile. Am J Physiol 1993;264:G1052-6. 47. Stone BG, Erickson SK, Craig WY, Cooper AD. Regulation of rat biliary cholesterol secretion by agents that alter intrahepatic cholesterol metabolism. Evidence for a distinct biliary precursor pool. J Clin Invest 1985;76:1773-1781. 48. Nervi F, Marinovic I, Rigotti A, Ulloa N. Regulation of biliary cholesterol secretion. Functional relationship between the canalicular and sinusoidal cholesterol secretory pathways in the rat. J Clin Invest 1988;82:1818-1825. 49. Nervi F, Bronfman M, Allalon W, Depiereux E, Del Pozo R. Regulation of biliary cholesterol secretion in the rat. Role of hepatic cholesterol esterification. J Clin Invest 1984;74:2226-2237. 50. Weis HJ, Dietschy JM. Failure of bile acids to control hepatic cholesterogenesis: evidence for endogenous cholesterol feedback. J Clin Invest 1969;48:2398-2408. 51. Nervi FO, Dietschy JM. The mechanisms of and the interrelationship between bile acid and chylomicron-mediated regulation of hepatic cholesterol synthesis in the liver of the rat. J Clin Invest 1978;61:895-909. 52. Weis HJ, Dietschy JM. Presence of an intact cholesterol feedback mechanism in the liver i n biliary stasis. Gastroenterology 1971;61:77-84. 53. Russell DW, Setchell KD. Bile acid biosynthesis. Biochemistry 1992;31:4737-4749. 54. Bandsma RHJ, Stellaard F, Vonk RJ, et al. The contribution of newly synthesised cholesterol to rat plasma and bile determined by mass isotopomer distribution analysis: bile salt flux promotes secretion of newly synthesised cholesterol into bile. Biochem J 1998; 329: 699-703. 55. Mackay K, Starr JR, Lawn RM, Ellsworth RL. Phosphatidylcholine hydrolysis is required for pancreatic cholesterol esterase- and phospholipase A(2)-facilitated cholesterol uptake into intestinal Caco-2 cells. J Biol Chem 1997;272:13380-13389.

38

CHAPTER 3 DIETARY CHOLESTEROL DOES NOT NORMALIZE LOW PLASMA CHOLESTEROL LEVELS BUT INDUCES HYPERBILIRUBINEMIA AND HYPERCHOLANEMIA IN MDR2 PGLYCOPROTEIN-DEFICIENT MICE Peter J Voshol, Nynke R Koopen, J Marleen L de Vree †, Rick Havinga, Hans MG ‡ † † Princen , Ronald PJ Oude Elferink , Albert K Groen and Folkert Kuipers. Groningen University Institute for Drug Exploration (GUIDE), Center for Liver, Digestive and Metabolic Diseases, Department of Pediatrics, University Hospital † Groningen, Groningen, Department of Gastrointestinal and Liver Diseases, ‡ Academic Medical Center, Amsterdam, Gaubius Laboratory, TNO-PG, Leiden, The Netherlands

Submitted

Chapter 3: Hypercholanemia in Mdr2 knockout mice

ABSTRACT Background & Aims: Mdr2 P-glycoprotein (Pgp) deficiency in mice leads to formation of phospholipid- and cholesterol-depleted bile. Plasma HDL cholesterol (-/-) is strongly reduced in Mdr2 Pgp-deficient (Mdr2 ) mice. This study addresses the (-/-) mice increase upon following questions 1: does plasma HDL in Mdr2 (-/-) phospholipid and/or cholesterol feeding, and 2: is the liver of Mdr2 mice capable (-/-) and of handling excess dietary cholesterol. Methods: Male and female Mdr2 (+/+) mice were fed semi-synthetic diets with or without additional wildtype Mdr2 phosphatidylcholine for two weeks, with or without additional cholesterol for another week. Plasma, hepatic and biliary lipids were measured, as well a s parameters of liver function and expression of transport proteins involved in bile formation. Results: Feeding excess phospholipids and/or cholesterol did not affect (+/+) or Mdr2(-/-) mice. Dietary cholesterol led plasma lipoprotein levels in either Mdr2 (-/-) to a marked hyperbilirubinemia in male (+100%) and female (+500%) Mdr2 mice, both in the presence and absence of phospholipids. Plasma bile salt levels increased by 200% in males and by 1250% in females. These effects were not (+/+) mice. Bile flow, biliary bile salt secretion nor biliary bilirubin observed in Mdr2 (-/-) secretion were affected in Mdr2 mice by cholesterol feeding. Increased plasma bile salt levels may be related to cholesterol-induced reduction of Na+(-/-) mice. taurocholate cotransporting protein (Ntcp) expression in livers of Mdr2 Conclusion: Excess dietary phospholipids and cholesterol do not normalize low HDL levels associated with Mdr2 Pgp-deficiency. Induction of hypercholanemia (-/-) mice delineates the and hyperbilirubinemia by dietary cholesterol in Mdr2 important role of biliary lipid secretion in normal hepatic functioning. 40

Physiological functions of biliary lipid secretion

INTRODUCTION The biliary pathway is considered the major route for removal of excess cholesterol from the body [1,2]. Cholesterol, either as such or after its conversion to bile salts, is expelled through bile into the intestinal lumen followed by fecal elimination. However, the majority of bile salts and a considerable fraction of biliary cholesterol, approximately 65% [3], is reabsorbed from the intestine. Bile salts are transported back to the liver via the portal system for resecretion into bile. The physiological importance of this so-called enterohepatic circulation of bile salts in the regulation of hepatic bile salt and cholesterol synthesis [1,4], LDL receptor activity [5] and VLDL formation [6,7] is well-established. Less is known about the physiological significance of biliary cholesterol reabsorption. In this respect, it is of importance to note that the amount of cholesterol entering the intestine via bile, up to 1200 mg/day in humans [1], is typically two to three times larger than the amount of dietary cholesterol. Biliary cholesterol is accompanied by a six- to eight-fold excess of bile specific phospholipids, mainly phosphatidylcholine with 16:0-18:1, 16:-18:2 or 16:0-20:4 configuration. These phospholipids are essential for secretion of biliary cholesterol [8,9] and for protection of the biliary tree against the cytotoxic actions of bile salts [10-12]. In addition, it has been described that biliary phospholipids have a stimulatory action on formation of chylomicrons by enterocytes [13-15] and, therefore, may be essential for efficient absorption of cholesterol. Little is known about the role of biliary cholesterol and phospholipids per se in the maintenance of cholesterol homeostasis and in the regulation of plasma cholesterol levels. This is mainly due to the fact that secretion of these lipids is coupled to that of bile salts. As a consequence, it has not been possible to study the actions of biliary lipids independent from those of bile salts in the in vivo (-/-) situation. Recently generated Mdr2 P-glycoprotein (Pgp)-deficient mice (Mdr2 mice) [8-10] provide us with the tool to address this issue. Mdr2 Pgp acts as an ATP-dependent “flippase”, translocating phosphatidylcholine from the inner to the outer leaflet of the bile canalicular membrane [8,10]. Mdr2 Pgp-deficient mice are unable to secrete phospholipids into bile and, as a consequence, do not secrete cholesterol under physiological conditions [8,10]. Bile salt secretion, on the other hand, is not affected in these animals [8,10]. In a previous study [16], we observed that mice homozygous for Mdr2 gene disruption have strongly reduced plasma HDL-cholesterol levels (- 65%) when fed (+/-) mice show a 25% reduction in normal laboratory chow. Heterozygous Mdr2 plasma HDL-cholesterol compared with wild type controls [16]. We hypothesized (-/-) mice are due to the absence of that reduced HDL cholesterol levels in Mdr2 biliary lipids in the intestine leading to impaired chylomicron formation [15]. Our aim for the present study was: 1. to evaluate whether or not the phenotype of Mdr2 Pgp-deficient mice with respect to plasma lipoprotein levels can be restored by addition of phosphatidylcholine and/or cholesterol to the diet and 2. to investigate whether the liver of these mice is able to handle excess dietary cholesterol despite impaired hepatobiliary cholesterol secretion. For this purpose we supplied mice with dietary egg-phosphatidylcholine (PC), the composition of which resembles that of biliary PC, with or without additional cholesterol. PC and cholesterol were added to the diets in amounts equivalent to respectively ten-times and thirty-times the daily biliary load of these lipids in control mice. Data show no effects of dietary 41

Chapter 3: Hypercholanemia in Mdr2 knockout mice

PC and cholesterol on plasma lipid levels in Mdr2(-/-) mice, indicating a specific role of biliary lipid secretion in regulation of plasma HDL levels. However, cholesterol feeding resulted in a marked hyperbilirubinemia and hypercholanemia (-/-) in Mdr2 mice, with elevated plasma alkaline phosphatase activities. To the best of our knowledge, this is the first description of hypercholanemia and hyperbilirubinemia induced by dietary cholesterol in an in vivo model.

MATERIALS AND METHODS Animals: Control Mdr2(+/+) and Mdr2 knockout Mdr2(-/-) mice, 25-30 g, were obtained from the breeding colony at the Academic Medical Center, Amsterdam. Animals were kept on a semi-purified diet, the composition of which is shown in Table 1 (Hope Farms BV, Woerden, The Netherlands), for two weeks before starting the experiment. After these two weeks, the mice were randomly divided into two groups, one group (males and females) continuing on the same semipurified diet and the other group receiving the same diet supplemented with 11.3 mmol/kg PC. Animals received these diets for a period of two weeks and were than subdivided again, with half of the animals remaining on their diet and the other half receiving the same diet supplemented with 0.25% cholesterol (6.5 mmol/kg), resulting in n = 8 per dietary group for both sexes (see Figure 1). Food and water were available ad libitum. The experimental procedure was approved by the Ethical Committee for Animal Experiments of the University of Groningen. Table 1: Composition of the semi-purified diet (reference diet) as purchased from Hope Farms BV, Woerden, The Netherlands. Compound % (w/w) Cerelose 54.3 Casein 20.0 Corn starch 10.0 Cellulose 5.0 Soya-oil 5.0 Choline 0.4 Vitamin/minerals etc. 5.3

Figure 1: Design of the experiment, showing the different dietary groups and the time points of blood sampling during the experiment.

Experimental procedures: Blood samples were collected at baseline (day 0), after one (day 7) and two (day 14) weeks on semi-purified diets with or without PC and 42

Physiological functions of biliary lipid secretion

after 3 (day 17) and 7 (day 21) days of cholesterol feeding, as indicated in Figure 1. Small blood samples at days 0, 7, 14 and 17 were collected by tail bleeding under light halothane anesthesia. At day 21, the gallbladder of mice was canulated under Hypnorm (fentanyl/fluanisone, 1 mL/kg) and Diazepam (10 mg/kg) anesthesia and bile was collected during a 30 minute period. Bile production was assessed by weight. Subsequently, a large blood sample was collected by cardiac puncture. Three mice of each group were used for investigating liver pathology and for RNA isolation. Mice were killed by cardiac puncture and the liver was perfused with ice-cold saline, excised, weighed and used for examining liver morphology after paraformaldehyde fixation and HE staining, or, after snap freezing in liquid isopentane, for membrane isolation and RNA isolation. Western blot analysis and RT-PCR analysis: Part of the collected livers was used to isolate total and plasma membrane fractions as previously described [17], for assessment of Ntcp, Oatp-1, bile salt export pump (bsep) and SR-BI protein levels. + + Protein levels of Na /K -ATPase was used as a reference signal. Protein (75 µg) was separated using SDS gel electrophoresis (13% Ready gels, BioRad Laboratories, Hercules, CA, USA) and subsequently blotted onto nitrocellulose (Hybond-ECL, Amersham, UK) and probed with anti-Ntcp-immunoglobulin IgG K4, anti-oatp1-immunoglobulin IgG K10 (both kindly provided by B. Stieger, Zürich, Switzerland [18]), anti-spgp (bsep) (rat) IgG K12 (kindly provided by Dr. M Müller, Groningen anti SR-BI IgG (Kindly provided by Dr. M. Krieger, Boston, USA) or goat + + anti-rabbit-Na /K -ATPase antibody against its α-subunit (kindly provided by Dr. WHM Peters, Nijmegen, The Netherlands). Immune complexes were detected using horseradish peroxidase-conjugated donkey anti-rabbit-IgG by ECL Western blotting Kit (Amersham, UK). Total RNA of liver and intestine was isolated using a combination of the Trizol method (GIBCO BRL, Grand Island, NY) with the Promega SV-RNA kit (Promega, Madison WI, USA) to obtain qualitative amounts of RNA for further analysis. Steady state mRNA levels of Ntcp, sPgp, mrp2 in liver were determined by semi-quantitative RT-PCR, β-actin mRNA levels were used as a housekeeping signal. The following primers sets were used; Ntcp, sense primer: CTGCCGCCTGGCTTTGGCCA, anti sense primer: CTGGAGCAGGTGGTCATCTG; sPgp, sense primer: TCTGGACAAAGCCAGAGAGG, anti sense primer: AGAGCTATGACAACCCGCAG; mrp2, sense primer: AATCATCCCTCACCAACTGC, anti sense primer: CTTCATGGAGCAACCCAAGT and β-actin, sense primer: AACACCCCAGCCATGTAGG, anti sense primer: ATGTCACGCACGATTTCCC. The relative intensity of the different bands were determined using a CCD video camera of the ImageMaster VDS system (Pharmacia, Upsulla, Sweden). (-/-) (+/+) mice were housed Fecal bile salt analysis: Male and female Mdr2 and Mdr2 individually and total fecal production during a one week-period was separated from the wood shavings. Fecal samples were lyophilized and weighed. Aliquots hereof were used for determination of acidic sterol content by gas liquid chromatographic procedures described [19,20].

Analyses: Plasma total cholesterol, free cholesterol and triglycerides (glycerol blanking) were measured using commercially available kits, according to the manufacturer’s instructions (Boehringer Mannheim, Mannheim, Germany). 43

Chapter 3: Hypercholanemia in Mdr2 knockout mice

Plasma free fatty acids and phospholipids were determined using commercial kits from WAKO (WAKO Chemicals GmbH, Neuss, Germany). Contents of cholesterol in bile and cholesterol (ester) and triglycerides in liver tissue was determined after lipid extraction [21] as described previously [22]. Protein content of the liver homogenates was determined according to Lowry et al. [23], with BSA a s standard. Total bile salt concentration in bile and plasma were determined by an enzymatic fluorimetric assay [24]. Plasma and biliary bilirubin (total and conjugated), alanine-aminotransferase (ALT), aspartate-aminotransferase (AST) and alkaline phosphatase (AP), were determined by standard procedures at the Central Clinical Laboratory at the University Hospital Groningen. Statistical analysis: All results are presented as means ± standard deviations for the number of animals indicated. Differences between dietary groups was determined by one-way ANOVA analysis [25], with posthoc comparison by (-/-) and Mdr2(+/+) mice. Differences Newmann Keuls t-test [25], for both Mdr2 (-/-) (+/+) and Mdr2 mice were determined by Mann Whitney U-test between Mdr2 analysis [25] for the different dietary groups. Level of significance for all statistical analysis was set at p < 0.05. Analysis was performed using SPSS for Windows software (SPSS, Chicago, IL, USA)

RESULTS Plasma lipid levels: The first question was whether reduced plasma cholesterol (-/-) levels in Mdr2 mice could be (partially) restored by feeding phosphatidylcholine (PC) and/or cholesterol. Feeding PC and/or cholesterol did not have any relevant (+/+) or Mdr2(-/-) effect on plasma total cholesterol or cholesteryl ester levels in Mdr2 mice, with the exception of a small increase in PC + cholesterol-fed male mice (-/-) mice (Figure 2). Cholesterol levels remained significantly lower in Mdr2 compared with controls under all dietary conditions, in males as well as in females, during the experiments. There were no marked effects on plasma (+/+) and Mdr2(-/-) mice on triglycerides or phospholipids in male or female Mdr2 either diet (data not shown). Figure 2: Plasma cholesterol levels determined at day 21 in male (A) and female (B) Mdr2(+/+) and Mdr2(-/-) mice on reference (ref) and phospholipid-containing (PC) diets with or without additional cholesterol (C). Samples were taken by tail bleeding as described in the method section. Data represent mean plasma cholesterol concentrations (in mM) ± SD, n = 8 per group. Differences for the diet groups were analyzed by one-way ANOVA analysis with Newmann-Keuls t-test posthoc analysis, (#) p < 0.05. Differences between Mdr2(-/-) and control mice were analyzed using Mann Whitney exact U-test. Concentrations in Mdr2(-/-) mice were significantly lower in Mdr2(+/+) mice in all groups (*). White bars: Mdr2(+/+) mice; black bars: Mdr2(/-) mice.

Hepatic cholesterol content: The absence of any effect of cholesterol feeding on (-/-) mice could theoretically be due to plasma cholesterol concentrations in Mdr2 44

Physiological functions of biliary lipid secretion

impaired uptake of dietary cholesterol from the intestine [16]. We therefore measured hepatic cholesterol content as a reflection of intestinal uptake. Figure 3 shows the hepatic total cholesterol content, expressed in µmol/liver, in male and (+/+) and Mdr2(-/-) mice on the reference and reference + cholesterol female Mdr2 (+/+) and Mdr2(-/-) mice showed a similar increase in total hepatic diets. Mdr2 cholesterol content after one week of cholesterol supplementation. Similar results were found with additional PC (data not shown). This increase was due to an increase in hepatic cholesterol ester content: hepatic free cholesterol remained unchanged in all groups. Hepatic triglyceride levels increased 1.5-2 times on (+/+) mice (data not shown): no changes were cholesterol-containing diets in Mdr2 (-/-) observed in the Mdr2 mice. Figure 3: Hepatic cholesterol content in livers of Mdr2(+/+) and Mdr2(-/-) male and female mice on reference (ref) or reference + 0.25% cholesterol (ref + C) diets. Values represent total cholesterol in µmol per liver, n = 5 per group. Differences between the dietary groups were determined by one-way ANOVA analysis and Newmann-Keuls t-test posthoc analysis, (#) p < 0.05. White bars: Mdr2(+/+) mice; Black bars: Mdr2(-/-) mice.

Hepatic SR-BI expression: Protein levels of SR-BI, identified as the HDL-receptor ([26,27], appeared to be slightly higher in plasma liver membrane fractions of Mdr2 /-) mice than of Mdr2(+/+) mice fed the reference diet (Figure 4). In both strains, however, dietary cholesterol was associated with a marked reduction in hepatic SR-BI levels. Figure 4: Western blot analysis of hepatic plasma membrane fractions for Scavenger receptor class B, type 1 (SRBI) and Na +, K+-ATPase in female Mdr2(+/+) and Mdr2(-/-) mice on reference (R) or reference + cholesterol (C) diets. The amounts of protein loaded onto the gel were standardized to activities of Na/K-ATPase, as described [17]. Data shown are representative for 2 separate membrane preparations (each of 2 pooled mouse livers) per group. Similar data were obtained for male mice. Supplementation of PC to the diet had no additional effects on SR-BI protein levels.

The second question was whether the strongly reduced capacity to remove (-/-) cholesterol via bile in Mdr2 mice would affect hepatic handling of the relatively mild dietary cholesterol load. During blood sampling, it was obvious that plasma (-/-) mice became jaundiced within three days of cholesterol feeding. of Mdr2 Because phospholipid feeding had no additional effect on plasma lipid or bilirubin levels subsequent studies were focused on the effects of cholesterol supplementation to the reference diet. 45

Chapter 3: Hypercholanemia in Mdr2 knockout mice Figure 5: Plasma bilirubin (panel A) and bile salt (panel B) levels in mice on reference diet before and during cholesterol feeding, i.e., at days 14, 17 and 21. Values represent mean ± SD in µmol/L, n = 8 per group. Differences between dietary groups were determined by means of a one-way ANOVA with Newmann-Keuls t-test posthoc analysis, (#) p < 0.05. Differences between Mdr2(-/-) and Mdr2(+/+) mice were analyzed for each dietary group and males and females separately by Mann-Whitney exact U-test, (*) p < 0.05. Filled symbols: Mdr2(+/+) mice; open figures: Mdr2(+/+) mice; squares: male mice; circles: female mice.

Plasma bile salt, bilirubin, transaminases and alkaline phosphatase levels: Plasma bile salts, bilirubin, transaminases and alkaline phosphatase were determined at three and seven days after initiation of cholesterol feeding in male (-/-) and control mice. Bile salt levels in Mdr2(-/-) mice before and female Mdr2 initiation of cholesterol feeding were significantly higher than those of sex-matched controls, as previously reported [8], whereas bilirubin levels did not differ. As shown in Figure 5, plasma bilirubin (panel A) and bile salts (panel B) levels (-/-) increased during cholesterol feeding in Mdr2 mice, in particular in the females. As shown in Table 2, both the conjugated and the unconjugated fraction of plasma (-/-) bilirubin was significantly increased in Mdr2 mice upon cholesterol feeding. Table 2: Conjugated and unconjugated bilirubin in plasma of male and female Mdr2(+/+) and Mdr2(-/-) mice fed reference (Ref) or reference + cholesterol (Ref + C) diets. Blood samples were taken at the end of the experiment by cardiac puncture as described in the material and method section. (*) significant difference Mdr2(-/-) versus Mdr2(+/+), Mann-Whitney U test, p < 0.05, n = 8 per group. (#) significant difference of one dietary group versus other dietary groups, one-way ANOVA, Newmann-Keuls t-test p < 0.05, n = 8 per group. Unconjugated bilirubin Mouse group Diet Conjugated bilirubin µmol/L µmol/L Male +/+ Ref bd 2.7 ± 1.2 Ref + C 0.7 ± 1.2 4.0 ± 2.0 Female +/+ Ref bd 4.0 ± 2.0 3.3 ± 1.2 Ref + C 0.7 ± 1.2 4.0 ± 2.0 Male -/Ref 2.0 ± 0.1 * 6.7 ± 1.2 # Ref + C 6.0 ± 0.1 *# 3.3 ± 1.2 Female -/Ref 0.7 ± 1.2 Ref + C 22.7 18.9 *# 32.7 ± 22.7 *# bd = below detection limit

Plasma transaminase (AST and ALT) and alkaline phosphatase (AP) activities in (-/-) male and female Mdr2 mice kept on reference diet were significantly higher than in control mice, as shown before [8,28]. Feeding cholesterol had no further effect (+/+) and Mdr2(-/-) mice of either sex, whereas cholesterol on AST and ALT in Mdr2 (-/-) feeding induced an increase in AP activity in male and female Mdr2 mice (Table 3). 46

Physiological functions of biliary lipid secretion

Table 3: Alanine-aminotransferase (ALT), aspartate-aminotransferase (AST) and alkaline phosphatase (AP) activities in plasma of male and female Mdr2(+/+) and Mdr2(-/-) mice fed reference (Ref) or reference + cholesterol (Ref + C) diets. Blood samples were taken at the end of the experiment by cardiac puncture as described in the material and method section. (*) significant difference Mdr2(-/-) versus Mdr2(+/+), Mann-Whitney U test, p < 0.05, n = 8 per group. (#) significant difference of one dietary group versus other dietary groups, one-way ANOVA, Newmann-Keuls t-test p < 0.05, n = 8 per group. Mouse group Diet AST (U/L) ALT (U/L) AP (U/L) Male +/+ Ref 56 ± 13.1 20.7 ± 6.4 bd Ref + C 53.3 ± 9.5 28.0 ± 7.2 bd 25.3 ± 1.2 bd Female +/+ Ref 78.1 ± 12.2 21.3 ± 1.2 bd Ref + C 96.0 ± 28.4 290.0 ± 303.7 * bd Male -/Ref 364.7 ± 292.4 * 375.0 ± 76.8 * 4.0 ± 0.01 * # Ref + C 456.6 ± 128.2 * 206.7 ± 14.5 * 2.0 ± 0.01 * Female -/Ref 397.3 ± 43.2 * 334.7 ± 120.4 * 10.0 ± 8.7 * # Ref + C 362.0 ± 150.6 * bd = below detection limit

Bile flow and bile composition: The increases in plasma bilirubin and bile salt (-/-) levels in the Mdr2 mice on the cholesterol-containing diet could be indicative for induction of cholestasis. Therefore, we analyzed bile flow and biliary output of bile salts, bilirubin and cholesterol in the different groups, as summarized in Figure 6. Figure 6: Bile flow, biliary salt output and biliary cholesterol output in male and female mice on reference (ref) and reference + cholesterol (ref + C) diets. Bile flow is given in µL per minute per 100g body weight, bile salt output and cholesterol output in nmol per minute per 100g body weight, n = 5 per group. Differences between the dietary groups were analyzed by one-way ANOVA analysis and Newmann-Keuls t-test posthoc analysis, (#) p < 0.05. Differences between Mdr2(-/-) and (+/+) Mdr2 mice were analyzed for each dietary group and males and females separate by Mann-Whitney exact U-test, (*) p < 0.05. White bars: Mdr2(+/+) mice; black bars: Mdr2(-/-) mice.

(-/-) mice is clearly increased when As previously shown [8], bile flow in Mdr2 (+/+) mice, both in males and females. Although expected on compared with Mdr2 basis of the elevated plasma bile salts, there was no decrease in bile flow or (-/-) mice compared to control-fed biliary bile salt secretion in cholesterol-fed Mdr2 (-/-) mice. Similarly, no changes where observed in biliary bilirubin output Mdr2 across the groups. Feeding cholesterol led to an increased biliary cholesterol (+/+) mice. Cholesterol output in Mdr2(-/-) mice was strongly impaired output in Mdr2

47

Chapter 3: Hypercholanemia in Mdr2 knockout mice

compared with the Mdr2(+/+) mice [8,10] and did not change when cholesterol was (+/+) mice of added to the diet. Biliary phospholipid output was not changed in Mdr2 (either sex in any of the dietary groups and remained below detection level in Mdr2 /-) mice (data not shown). Analysis of fecal acidic sterol content, performed in male animals only, revealed that feeding of cholesterol led to an approximately two-fold (+/+) mice, i.e., from 6.5 ± 1 µmol/day on the increased fecal bile salt output in Mdr2 reference to 12.2 ± 2 µmol/day on the reference + cholesterol diet, respectively. In contrast, no increase in fecal bile salt output was noted in cholesterol-fed male (-/-) Mdr2 mice (7.4 ± 2 versus 5.9 ± 1 µmol/day). Protein and steady state mRNA levels of hepatic transporters: We have + previously reported reduced hepatic levels of Na -taurocholate cotransporting protein (Ntcp) and impaired taurocholate transport in liver plasma membrane (-/-) fractions in Mdr2 mice on a regular chow diet [28]. Therefore, we checked effects of cholesterol feeding on Ntcp protein levels in plasma membrane fractions (+/+) and Mdr2(-/-) mice on the four isolated from livers of male and female Mdr2 experimental diets by Western blotting (Figure 7) and on hepatic mRNA levels by semi-quantitative RT-PCR (Figure 8). Figure 7: Western blot analysis of hepatic plasma membrane fractions for Na+-taurocholate cotransporting protein (Ntcp), Organic anion transporter protein-1 (oatp-1), bile salt export pump (bsep) and Na+, K+ATPase in male and female control and Mdr2(-/-) mice on reference (R) or reference + cholesterol (C) diets. The amounts of protein loaded onto the gel were standardized to activities of Na/K-ATPase and alkaline phosphatase as described [17]. Data shown are representative for 2 separate membrane preparations (each of 2 pooled mouse livers) per group

(-/-) mice showed clearly decreased Ntcp protein levels compared with The Mdr2 (+/+) mice on reference diet, in accordance with previous studies sex-matched Mdr2 [28]. Addition of cholesterol to the reference diet caused a further decrease in Ntcp (-/-) (+/+) mice. Steady levels in Mdr2 mice and also to decreased Ntcp levels in Mdr2 (-/-) state mRNA levels of Ntcp were lower in female Mdr2 mice than in sex-matched controls and further declined upon cholesterol feeding. No significant changes in Ntcp mRNA levels were found in male mice on either diet. Surprisingly, oatp-1 (-/-) mice than in controls, and only reduced by protein levels were higher in Mdr2 dietary cholesterol in the latter. Likewise, bsep protein levels appeared to be (-/-) mice when compared to controls but no marked effects of increased in Mdr2 cholesterol feeding were noted in either strain. No clear effect of Mdr2-Pgpdeficiency or cholesterol feeding on mRNA levels of these transporters as well a s of mrp2 (canalicular organic anion transporter) were observed, with the exception of a modest but significant induction of bsep mRNA levels by cholesterol feeding in female mice.

48

Physiological functions of biliary lipid secretion Figure 8: Steady state mRNA level of Ntcp, oatp-1, bsep, mrp2 and ß-actin was determined by RT-PCR in control and Mdr2(-/) mice (A). Data shown are representative for at least 3 separate RNA isolations per group. The mRNA levels were quantitated by densitometric analysis, related to ß-actin levels, and presented as % of control value (Mdr2(+/+) mice on reference diet) (B). The values represent mean ± SD ( n=3-4 per group). Differences between the dietary groups were analyzed by one-way ANOVA analysis and Newmann-Keuls t-test posthoc analysis, (*) p < 0.05.

DISCUSSION Impaired biliary lipid secretion in Mdr2(-/-) mouse is associated with a marked decrease in plasma HDL cholesterol in presence of normal hepatic cholesterol levels. To investigate whether the decrease in plasma cholesterol levels in the (-/-) mouse is directly due to the impaired delivery of phospholipids and/or Mdr2 (-/-) mice diets supplemented with these cholesterol to the intestine, we fed Mdr2 lipids for a considerable period of time. The biliary pathway delivers approximately six to eight times more phospholipids and two to three times more cholesterol to (+/+) mice than dietary intake does when animals are fed the intestine of Mdr2 regular lab chow. We have added phosphatidylcholine and/or cholesterol to the diet in amounts exceeding normal biliary delivery by a factor of approximately ten and thirty, respectively, to ensure the presence of sufficient amounts of these lipids in the intestinal lumen. No changes were observed in plasma cholesterol levels after feeding (+/+) and Mdr2(-/-) mice diets supplemented with PC. This observation is not in Mdr2 line with data from Rioux et al. [29], who found a decrease in plasma cholesterol and triglyceride levels after feeding a phospholipid-enriched diet for a period of only four days to rats. These deviating results are possibly due to differences in duration of phospholipid feeding, phospholipid source and/or animal species. (+/+) mice during PC + cholesterol Plasma cholesterol transiently increased in Mdr2 feeding (not shown), which is in agreement with findings of others [30]. The addition of PC and/or cholesterol did not normalize the plasma cholesterol levels (-/-) in Mdr2 towards levels found in control mice. We analyzed hepatic cholesterol (-/-) levels to assess whether dietary cholesterol was actually absorbed in Mdr2 mice. Since a similar increase in hepatic cholesterol content after cholesterol (+/+) and Mdr2(-/-) mice, dietary cholesterol must have feeding was found in Mdr2 (-/-) been absorbed to a considerable degree in Mdr2 mice. Yet, this influx of dietary cholesterol was not reflected in elevation of plasma cholesterol levels, even in (-/-) mice are unable to increase biliary cholesterol spite of the fact that Mdr2 (+/+) mice do (Figure 6). These results indicate that the secretion disposal as Mdr2 49

Chapter 3: Hypercholanemia in Mdr2 knockout mice

of phospholipids and/or cholesterol into bile, and not the mere presence of these lipids in the intestine, is important in the regulation of plasma HDL cholesterol levels. We reported earlier that mRNA levels of apolipoprotein A-I, the major (-/-) and control mice. Other apolipoprotein on HDL, did not differ between Mdr2 proteins involved in the regulation of HDL levels in plasma, i.e., the HDL-receptor (SR-BI) [26,27] and the recently described Tangier disease gene, ABC-1 [31-33], (-/-) mice. Indeed, a could play a role in the decreased HDL levels found in Mdr2 (-/-) slightly increased protein expression of SR-BI in Mdr2 mice might contribute to low HDL levels found in these animals, as has been found after adenoviralmediated overexpression of SR-BI in mice [34]. However, cholesterol feeding (-/-) and control mice, in line decreased hepatic SR-BI protein levels in both Mdr2 with the observation that hepatic SR-BI protein levels are reduced in cholesterolfed rats [35]. Decreased SR-BI expression was not associated with increased HDL levels in either group, suggesting that, under the conditions employed, hepatic SRBI is not a major determinant of plasma cholesterol levels in mice. Cholesterol feeding led to a strong increase of plasma bilirubin and bile salt (-/-) levels in Mdr2 mice. Conjugated as well as unconjugated bilirubin levels were increased: the latter may be a result of erythrocyte damage induced by the high bile (-/-) mice leading to increased conversion of hemoglobin into salt levels in Mdr2 bilirubin. The increase in conjugated bilirubin is indicative for altered hepatic (-/-) handling. Plasma transaminase activities were significantly higher in Mdr2 compared to controls on the reference diet and did not increase further after (-/-) mice did lead to a mild cholesterol feeding. Cholesterol feeding in Mdr2 increase in plasma alkaline phosphatase activity, indicative for alterations at the level of the canalicular membrane. This, together with the increased in plasma bilirubin and bile salt levels at first sight suggested the induction of cholestasis by dietary cholesterol. However, no changes in bile flow and/or biliary bile salt and (-/-) mice. Biliary bilirubin output were induced by dietary cholesterol in Mdr2 cholesterol secretion was significantly increased in control mice showing the ability to remove excess dietary cholesterol via this pathway in the presence of normal mdr2 Pgp function. Furthermore, cholesterol feeding induced bile salt (+/+) mice, as reflected in increased fecal bile salt output. The synthesis in Mdr2 (+/+) mice apparently are capable to eliminate, at least in part, excess dietary Mdr2 (-/-) mice are not. It has been cholesterol via these routes, whereas the Mdr2 described that feeding of excess cholesterol leads to increased bile salt loss from the intestine in rats [36] and humans [37], which has been attributed to cholestyramine-like effects of dietary cholesterol and/or a direct stimulatory effect on hepatic bile salt synthesis. It should be noted that in the studies mentioned diets contained 1% or 2% cholesterol, while we used only 0.25% cholesterol. It should also be noted that no changes were found in mRNA levels of cholesterol 7α-hydroxylase or cholesterol 27-hydroxylase, the two key enzymes in bile salt (+/+) or Mdr2(-/-) mice. Increased activities and synthesis (data not shown) in Mdr2 mRNA levels of these enzymes have been described during feeding of 1% or 2% cholesterol in rats [36] but also in these studies no changes in activity or mRNA levels were observed when feeding less than 1% cholesterol. A simple calculation, based on previously reported values [8], reveals that at least 3% and 15% of the bile salt pool resides in the plasma compartment in (-/-) cholesterol-fed Mdr2 male and female mice, respectively. It may be that a slightly induced bile salt synthesis rate/pool size induced by cholesterol feeding exceeds 50

Physiological functions of biliary lipid secretion

the maximal transport capacity for bile salt secretion in Mdr2(-/-) mice [8], leading to regurgitation in the plasma compartment. Increased plasma bile salt levels, already present during feeding of regular chow [8] and reference diet (this study), may further down-regulate Ntcp levels at the sinusoidal membrane [28], thereby exacerbating the hypercholanemic response. Alternatively, down-regulation of Ntcp may also reflect a physiological response to the cholesterol feeding per se, since (+/+) mice fed cholesterol that such a down-regulation was also observed in Mdr2 did not show elevated plasma bile salt levels. It may be that down-regulation of Ntcp during cholesterol feeding functions to prevent feedback inhibition of bile salt synthesis by circulating bile salts, thereby facilitating conversion of excess cholesterol to bile salts. In fact, it has recently been shown that the promoter of Ntcp in rats contains a putative sterol regulatory element [38], which could explain these findings and supports our hypothesis. Hepatic oatp-1 protein levels (-/-) mice compared to control mice in this appeared to be increased in the Mdr2 study. Since murine oatp-1 is able to transport taurocholate [39], this may be a (-/-) liver ensure maintenance of hepatic bile compensatory response of the Mdr2 salt flux. The decreased protein levels of oatp-1 in control mice after cholesterol feeding may act synergistically with reduced Ntcp protein levels to re-depress bile salt biosynthesis and reflects a physiological adaptation to remove excess cholesterol from the liver. Hepatic protein levels of the bile salt export pump were (-/-) found to be increased in male and female Mdr2 mice, which, to the best of our knowledge, is the first description of increased protein expression of this important transporter under (patho)physiological conditions. Since virtually nothing is known about regulation of bsep, we can only speculate on the underlying mechanisms. (+/+) and Mdr2(-/-) mice, Since no difference in bsep mRNA were found between Mdr2 our data suggest a post-transcriptional event to be responsible for this effect of mdr2 Pgp-deficiency, that may be aimed at maintenance of biliary bile salt secretion capacity in the absence of biliary lipids [29]. The observation that effects of dietary cholesterol on plasma bile salt levels (-/-) were more pronounced in female than in male Mdr2 mice is in agreement with the fact that “basal” bile salt levels are already increased to a larger extent in (-/-) female Mdr2 mice. The reason for this divergence between males and females is not yet clear, but may be related to the higher degree of liver pathology seen in (-/-) females [11,12]. The effects of dietary cholesterol in Mdr2 mice were not due to changes in bile salt composition, since no changes were found by gas (-/-) or chromatographic analysis of biliary bile salt composition in either Mdr2 (+/+) mice fed cholesterol (data not shown). Bilirubin output in to bile was not Mdr2 (-/-) affected in Mdr2 mice fed cholesterol, which may indicate that biliary secretion in these animals already, under normal conditions, operates at maximal capacity. We speculate that the capacity of canalicular secretion of (conjugated) bilirubin in (-/-) Mdr2 mice is compromised due to reduced protein levels of mrp2 (JML de Vree, unpublished results), the major canalicular bilirubin transporter [40], although steady state mRNA levels of mrp2 were not affected by mdr2 Pgp-deficiency or cholesterol feeding. In conclusion, feeding of phospholipids and/or cholesterol at levels exceeding the physiological biliary input of these lipids about ten- to thirty-fold does not normalize low plasma cholesterol levels in Mdr2 Pgp-deficient mice. The results of this study imply that biliary secretion, and not the presence of these lipids in the intestine, exerts specific functions in the regulation of plasma 51

Chapter 3: Hypercholanemia in Mdr2 knockout mice

cholesterol levels. Furthermore, cholesterol feeding of Mdr2 Pgp-deficient mice gives rise to “cholestatic” plasma levels of bilirubin and bile salts without evident (-/-) changes in bile formation, indicating that Mdr2 mice are not able to handle the excess dietary cholesterol. These “cholestatic” features possibly reflect the consequences of relative small alterations in the capacity of hepatic uptake and/or (-/-) canalicular secretion systems in the Mdr2 mice. Down-regulation of Ntcp during cholesterol feeding may be a specific physiological response to accelerate removal of excess cholesterol from the body by preventing feedback repression of hepatic bile salt synthesis.

ACKNOWLEDGMENT The authors thank Renze Boverhof, Vincent Bloks, Deanna Minich, Roelof Ottenhoff, Elly de Wit and Harry van Goor for skillful assistance. These studies were supported by grants 902-23-097 and 900-523-133 from the Netherlands Organization for Scientific Research (NWO) and by a grant from Nutricia B.V., Zoetermeer, The Netherlands. Part of this work has been presented at the 48th Annual Meeting of the American Association for the Study of Liver Diseases, November 1997, Chicago, IL, USA (Voshol et al., Hepatology 1997;26(4):294A, abstract) and Falk Symposium No 108: Bile Acids and Cholestasis, October 1998 Titisee Germany.

REFERENCES 1. Dietschy JM, Turley SD, Spady DK. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res 1993;34:1637-1659. 2. Packard CJ, Shepherd J. The hepatobiliary axis and lipoprotein metabolism: effects of bile acid sequestrants and ileal bypass surgery. J Lipid Res 1982;23:1081-1098. 3. Wilson MD, Rudel LL. Review of cholesterol absorption with emphasis on dietary and biliary cholesterol. J Lipid Res 1994;35:943-955. 4. Duckworth PF, Vlahcevic ZR, Studer EJ, Gurley EC, Heuman DM, Beg ZH, Hylemon PB. Effect of hydrophobic bile acids on 3-hydroxy-3-methylglutaryl-coenzyme A reductase activity and mRNA levels in the rat. J Biol Chem 1991;266:9413-9418. 5. Spady DK, Stange EF, Bilhartz LE, Dietschy JM. Bile acids regulate hepatic low density lipoprotein receptor activity in the hamster by altering cholesterol flux across the liver. Proc Natl Acad Sci U S A 1986;83:1916-1920. 6. Lin Y, Havinga R, Schippers IJ, Verkade HJ, Vonk RJ, Kuipers F. Characterization of the inhibitory effects of bile acids on very-low-density lipoprotein secretion by rat hepatocytes i n primary culture. Biochem J 1996;316:531-538. 7. Lin Y, Havinga R, Verkade HJ, Moshage H, Slooff MJ, Vonk RJ, Kuipers F. Bile acids suppress the secretion of very-low-density lipoprotein by human hepatocytes in primary culture. Hepatology 1996;23:218-228. 8. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38. 9. Oude Elferink RPJ, Ottenhoff R, van Wijland M, Frijters CMG, van Nieuwkerk CM, Groen AK. Uncoupling of biliary phospholipid and cholesterol secretion in mice with reduced expression of mdr2 P- glycoprotein. J Lipid Res 1996;37:1065-1075. 10. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA, van der Valk MA, Offerhaus GJA, Berns AJM, Borst P. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462. 11. Van Nieuwkerk CMJ, Oude Elferink RPJ, Groen AK, Ottenhoff R, Tytgat GNJ, Dingemans KP, Weerman MAVB, Offerhaus GJA. Effects of ursodeoxycholate and cholate feeding on liver disease in FVB mice with a disrupted mdr2 P-glycoprotein gene. Gastroenterology 1996;111:165-171.

52

Physiological functions of biliary lipid secretion 12. Van Nieuwkerk CMJ, Groen AK, Ottenhoff R, van Wijland M, Weerman MAV, Tytgat GNJ, Offerhaus JJA, Oude Elferink RPJ. The role of bile salt composition in liver pathology of mdr2 (/-) mice: Differences between males and females. J Hepatol 1997;26:138-145. 13. Tso P. Intestinal lipid absorption. In: Johnson LR, ed. Physiology of the Gastrointestinal Tract. 3rd Ed. New York: Raven Press, 1987:1867-1907. 14. Davidson NO, Kollmer ME, Glickman RM. Apolipoprotein B synthesis in rat small intestine: regulation by dietary triglyceride and biliary lipid. J Lipid Res 1986;27:30-39. 15. Voshol PJ, Minich DM, Havinga R, Oude Elferink RPJ, Verkade HJ, Groen AK, Kuipers F. Postprandial Chylomicron Formation and Fat Absorption in Multidrug Resistance Gene-2 PGlycoprotein-Deficient Mice. Gastroenterology 2000;118:173-182. 16. Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HMG, Oude Elferink RPJ, Groen AK, Kuipers F. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-glycoprotein-deficient mice. Gastroenterology 1998;114:1024-1034. 17. Koopen NR, Wolters H, Muller M, Schippers IJ, Havinga R, Roelofsen H, Vonk RJ, Stieger B, Meier PJ, Kuipers F. Hepatic bile salt flux does not modulate level and activity of the sinusoidal Na+-taurocholate cotransporter (ntcp) in rats. J Hepatol 1997;27:699-706. 18. Stieger B, Hagenbuch B, landmann L, Hochli M, Schroeder A, Meier PJ. In situ localization of the hepatocytic Na +/Taurocholate cotransporting polypeptide in rat liver. Gastroenterology 1994;107:1781-1787. 19. Lejoyeux M, Bouvard MP, Viret J, Daveloose D, Ades J, Dugas M. Modifications of erythrocyte membrane fluidity from patients with anorexia nervosa before and after refeeding. Psychiatry Res 1996;59:255-258. 20. Setchell KD, Lawson AM, Tanida N, Sjovall J. General methods for the analysis of metabolic profiles of bile acids and related compounds in feces. J Lipid Res 1983;24:10851100. 21. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Biophys 1959;37:911-917.(Abstract) 22. Kuipers F, Van Ree JM, Hofker MH, Wolters H, In t' Veld GI, Havinga R, Vonk RJ, Princen HMG, Havekes LM. Altered lipid metabolism in apolipoprotein E-deficient mice does not affect cholesterol balance across the liver. Hepatology 1996;24:241-247. 23. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the folin reagens. J Biol Chem 1951;193:265-275.(Abstract) 24. Murphy GM, Billing BH, Baron DN. A fluorimetric and enzymatic method for the estimation of serum total bile acids. J Clin Pathol 1970;23:594-598. 25. Dawson-Saunders B, Trapp RG. Basic and clinical biostatistics. International Ed. Englewoods Cliffs NJ: Prentice Hall, 1990: 26. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor [see comments]. Science 1996;271:518520. 27. Rigotti A, Trigatti B, Babitt J, Penman M, Xu S, Krieger M. Scavenger receptor BI--a cell surface receptor for high density lipoprotein. Curr Opin Lipidol 1997;8:181-188. 28. Koopen NR, Wolters H, Voshol PJ, Stieger B, Vonk RJ, Meier PJ, Kuipers F, Hagenbuch B. + + Decreased Na -dependent taurocholate uptake and low expression of the sinoidal Na taurocholate cotransporting protein (Ntcp) in livers of mdr2 P-glycoprotein-deficient mice. J Hepatol 1999;30:14-21. 29. Rioux F, Perea A, Yousef IM, Levy E, Malli L, Carrillo MC, Tuchweber B. Short-term feeding of a diet enriched in phospholipids increases bile formation and the bile acid transport maximum in rats. Biochim Biophys Acta 1994;1214:193-202. 30. Iwata T, Kimura Y, Tsutsume K, Furukawa Y, Kimura S. The effects of various phospholipids on plasma lipoproteins and liver lipids in hypercholesterolemic rats. J Nutr Sci Vitaminol Tokyo 1993;39:63-71. 31. Rust S, Rosier M, Funke H, Real J, Amoura Z, Piette JC, Deleuze JF, Brewer HB, Duverger N, Denefle P, Assmann G. Tangier disease is caused by mutations in the gene encoding ATPbinding cassette transporter 1 [see comments]. Nat Genet 1999;22:352-355. 32. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated i n Tangier disease [see comments]. Nat Genet 1999;22:347-351. 33. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency [see comments]. Nat Genet 1999;22:336-345.

53

Chapter 3: Hypercholanemia in Mdr2 knockout mice 34. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 1997;387:414417. 35. Fluiter K, van der Westhuijzen DR, Van Berkel TJ. In vivo regulation of scavenger receptor BI and the selective uptake of high density lipoprotein cholesteryl esters in rat liver parenchymal and Kupffer cells. J Biol Chem 1998;273:8434-8438. 36. Bjorkhem I, Eggertsen G, Andersson U. On the mechanism of stimulation of cholesterol 7 alpha-hydroxylase by dietary cholesterol. Biochim Biophys Acta 1991;1085:329-335. 37. Duane WC. Effects of lovastatin and dietary cholesterol on sterol homeostasis in healthy human subjects. J Clin Invest 1993;92:911-918. 38. Karpen SJ, Sun AQ, Kudish B, Hagenbuch B, Meier PJ, Ananthanarayanan M, Suchy FJ. Multiple factors regulate the rat liver basolateral sodium-dependent bile acid cotransporter gene promoter. J Biol Chem 1996;271:15211-15221. 39. Hagenbuch B, Adler ID, Schmid TE. Molecular cloning and functional characterization of the mouse organic-anion-transporting polypeptide 1 (Oatp1) and mapping of the gene to chromosome X. Biochem J 2000;345:115-120. 40. Paulusma CC, Elferink RPJO. The canalicular multispecific organic anion transporter and conjugated hyperbilirubinemia in rat and man. J Molecular Med-Jmm 1997;75:420-428.

54

CHAPTER 4 INCREASED HEPATIC VLDL PRODUCTION IN THE ABSENCE OF HEPATOBILIARY LIPID SECRETION IN MDR2 P-GLYCOPROTEINDEFICIENT MICE Peter J Voshol, Rick Havinga, Kees Schoonderwoerd#, Lou B Agellon‡, Jobst † Greeve , Albert K Groen* and Folkert Kuipers Groningen University Institute for Drug Exploration, Center for Liver, Digestive and Metabolic Diseases, University Hospital Groningen, Groningen, The Netherlands, # Department of Biochemistry, Erasmus University Rotterdam, The Netherlands, ‡ Department of Biochemistry, University of Alberta, Edmonton, Canada, † Medizinische Klinik, Universität-Krankenhaus Eppendorf, Hamburg, Germany and *Department of Gastrointestinal and Liver Diseases, Academic Medical Center, Amsterdam, The Netherlands. Submitted

Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice

ABSTRACT Background & Aim: It has been postulated that hepatic very low density lipoprotein (VLDL) production and secretion of phospholipids and cholesterol into bile are functionally linked processes. The aim of this study was to evaluate the effects of absence of hepatobiliary lipid flux on hepatic VLDL secretion in vivo in mice. (-/-) Methods: Mdr2 P-glycoprotein-deficient (Mdr2 ) mice with no biliary phospholipid secretion, impaired cholesterol secretion but normal bile salt secretion into bile and control mice were used to study hepatic VLDL secretion, VLDL composition, and apoB100/B48 kinetics in vivo using Triton WR1339. Hepatic mRNA levels of apoB and microsomal triglyceride transfer protein (MTP), and apoB mRNA editing were assayed by (semi-quantitative) RT-PCR. Hepatic activities of CDP-choline transferase (CT) and phosphatidylethanolamine N-methyltransferase (PEMT) for phospholipid synthesis as well as lipoprotein and hepatic lipase activities were determined. Results: In vivo VLDL triglyceride (+50%), apoB100 (+80%) and B48 (-/-) compared to control mice. (+180%) production rates were increased in Mdr2 Fractional turnover rate of apoB48, but not of apoB100, was increased in the knockouts. No differences in steady state mRNA levels of apoB and MTP, apoB (-/-) and mRNA editing, nor in CT and PEMT activities were found between Mdr2 control mice. Hepatic lipase activity, on the other hand, was significantly higher in (-/-) Mdr2 mice, which may contribute to increased clearance of apoB48-containing particles. Conclusion: Hepatic VLDL production is increased in mice lacking biliary lipid secretion. This study supports the concept that hepatobiliary lipid secretion and hepatic VLDL production are reciprocally interrelated.

56

Physiological functions of biliary lipid secretion

INTRODUCTION Very low density lipoproteins (VLDL) are the triglyceride-rich lipoproteins secreted by the liver and are the precursors of plasma low density lipoproteins (LDL). Hepatic overproduction of VLDL, in particular of relatively large particles, is an important contributor to development of hyperlipidemia in humans [1,2]. Apolipoprotein B (ApoB) is essential for formation and secretion of VLDL particles by the hepatocytes. In contrast to the situation in humans, rodents produce both apoB100- and B48- containing VLDL due to the presence of hepatic apoB mRNA editing activity [3]. In view of its crucial role in the development of hyperlipidemia, and thus for risk of atherosclerosis [4], the regulation of hepatic VLDL production has been and still is studied extensively. Insights in the molecular mechanisms involved has greatly increased in the past couple of years (see [5-8] for review). Yet, the various factors and their interactions that ultimately determine number and size of particles produced in the in vivo situation remain poorly understood. It is clear that the presence of apoB and of microsomal triglyceride transfer protein (MTP) activity, a protein that controls the initial association of lipids with nascent apoB, are absolutely essential [8-10]. In addition, several factors have been identified that modulate hepatic VLDL production acutely, like insulin and catecholamines [8]. Synthesis of lipid constituents, i.e., of cholesterol [11], cholesteryl esters [12-14] and specific phospholipids [15-18] have been shown to play a regulatory role. Other factors, such as apolipoprotein E, may have an additional modulatory action [19,20]. Furthermore, it has been postulated than the flux of lipids destined for biliary secretion through the liver influences lipid composition and secretion of VLDL particles [21,22]. This is, at first sight, not surprising in view of the fact that the liver secretes massive amounts of phosphatidylcholine and cholesterol into bile [23,24]. Thus, diosgenin feeding in rats leads to a strong increase in biliary cholesterol secretion while, at the same time, VLDL-cholesterol output is strongly reduced [21]. Likewise, Rigotti et al. [25] described that in rats fed a bean diet biliary lipid secretion is increased while plasma VLDL concentration and hepatic VLDL production are decreased. Our laboratory has previously shown that fish oil feeding in rats reduces plasma cholesterol and triglyceride levels, an effect that has been attributed to impaired VLDL formation due to accelerated apoB degradation [26], and leads to increased biliary cholesterol and phospholipid secretion [27,28]. It has been suggested that manipulation of a ‘common’ hepatic cholesterol pool leads to reciprocal effects on biliary cholesterol secretion and hepatic VLDL secretion [22,29]. In the present study we studied the effects of absence of biliary lipid (-/-) secretion on VLDL production in Mdr2 P-glycoprotein deficient mice (Mdr2 mice). Mdr2 P-glycoprotein functions as a phospholipid flippase at the canalicular pole of hepatocytes and appears to be essential for biliary phospholipid secretion [30]: (-/-) mice [23,30]. Since biliary biliary secretion of phospholipids is absent in Mdr2 (-/-) cholesterol secretion is linked to that of phospholipids, Mdr2 mice also have a strongly reduced biliary cholesterol secretion [23]. On the other hand, biliary bile salt secretion is not impaired in the Mdr2 Pgp-deficient mice [23]. Recently, we (-/-) mice have strongly reduced plasma High Density demonstrated that Mdr2 Lipoprotein (HDL) cholesterol levels, but an increased plasma apolipoprotein B content while plasma triglycerides are not affected or slightly decreased [31]. Furthermore, we found increased activities of acyl coenzyme A:cholesterol 57

Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice

acyltransferase and HMG-CoA reductase, the rate-controlling enzymes of cholesterol esterification and synthesis, respectively. We now questioned whether (-/-) hepatic VLDL secretion is affected in Mdr2 mice. We measured hepatic VLDLtriglyceride and apoB100/B48 secretion in vivo in Triton WR1339-treated [32] (-/-) Mdr2 and control animals. We also determined expression levels of apoB and MTP and determined apoB mRNA editing in both control and knockout mouse. Furthermore, we checked for potential changes in phospholipid supply by measuring the activities of CDP-choline transferase (CT) and phosphatidylethanolamine N-methyltransferase (PEMT), i.e., the enzymes that catalyze the rate-controlling steps of both pathways of phosphatidylcholine synthesis [33,34]. The results of these studies show that hepatic VLDL secretion i s (-/-) mice, which supports the concept of interaction increased in vivo in Mdr2 between processes involved in lipid secretion into blood and into bile.

MATERIALS AND METHODS Animals: Mice homozygous (Mdr2(-/-)) for disruption of the multidrug resistance (+/+) gene-2 (Mdr2) and control (Mdr2 ) mice of the same FVB-background were obtained from the breeding colony at the Animal Facility of the Academic Medical Center, Amsterdam. All mice were 2-4 months old and weighed 25-30 grams. Mice were housed in a light- and temperature-controlled facility and fed standard labchow. Food and water were available ad libitum. All experiments were approved by the ethical committee on animal testing, University of Groningen, The Netherlands. In vivo hepatic VLDL-triglyceride production: Hepatic production of VLDL (-/-) triglycerides was measured in control and Mdr2 mice after i.v. injection of Triton WR1339, as described before [32]. Animals were fasted overnight prior to the experiments and 12.5 mg of Triton WR1339 (Tyloxapol, Sigma Chemical Co. , St Louis, MO, USA) in 100 µL PBS was injected via the penile vein. Blood samples (75 µL) were drawn before and after Triton injection at 0.5, 1, 1.5 and 2 hours via tail bleeding and a final blood sample (1 mL) was collected by cardiac puncture after five hours. The final blood sample was used for VLDL isolation. Separate mice were bled after an over-night fast for baseline VLDL particle isolation (see below). VLDL isolation and apolipoprotein B production: For isolation of plasma VLDL, 500 µL plasma was covered with 500 µL NaCl/NaBr solution 1.016 g/mL and centrifuged in a Beckman ultra-centrifuge (Beckman Optima, TLX-100), at 625,000 x g [35]. The VLDL fraction was recovered by tube slicing and protein, free cholesterol, cholesterol esters, triglycerides and phospholipids composition was determined as described below. VLDL fractions isolated from basal and five hour blood samples were used for quantitative SDS-Page electrophoresis [32]. A standard containing known amounts of human LDL apoB (0.35, 0.70, 1.4 and 2.1 µg ) prepared as previously described [36], was used for quantitative analysis. After electrophoresis gels were stained with Coomassie Blue and quantified on by gelscan images using a CCD video camera of the ImageMaster VDS system (Pharmacia, Upsalla, Sweden). Each run was performed in duplicate.

58

Physiological functions of biliary lipid secretion

Hepatic steady state mRNA levels and apoB mRNA editing: Total RNA was isolated from liver tissue using a combination of the TRIzol Reagent (GIBCO BRL, Grand Island, NY) and the SV Total RNA isolation system (Promega, Madison WI, USA) according to the manufacturer’s instructions. Single stranded cDNA was synthesized from 4.5 µg RNA and subsequently subjected to polymerase chain reactions (PCR) using specific primers sets for apolipoprotein B (apoB) (sense primer: GACAGTGTCAACAAGGCTTTGTAGTGGGT; antisense primer: GGCAGAGACTATGTGTCCCAGTTTGA), microsomal triglyceride transfer protein (MTP) (sense primer: ATCTGATGTGGACGTTGTGT; antisense primer: CCTCTATCTTGTAGGTAGTG), fatty acid synthase (FAS) (sense primer: ATGCCATGCTGGAGAACCAG; antisense primer: TCTCGGATGCCTAGGATGTG), Diacylglycerol acyl transferase (DGAT) (sense primer: GCATACTTAGGATAGGGCTCAAGC; antisense primer: CCTTGCATTACTCAGGATCAGCAT) and β-actin (sense primer: AACACCCCAGCCATGTACG; antisense primer: ATGTCACGCACGATTTCCC). The PCR products were ran on 2.5% agarose gels and stained with ethidium bromide. Images were taken using a CCD video camera of the ImageMaster VDS system (Pharmacia, Upsalla, Sweden). Editing of apolipoprotein B mRNA was assayed as described previously [3]. In short, total RNA was prepared from liver using tri-Reagent and following the manufacturer’s protocol (Molecular Research Center Inc.). For RT-PCR of specific a primer set for apoB ( antisense primer: CAAGCATTTTTAGCTTTTCAATGATT ; sense primer: TGCCAAAATCAACTTGAATGAAAAAC) were used as described [3]. For every RT-PCR a separate control lacking reverse transcriptase was performed. The PCR products were purified by microspin-columns (S300, Pharmacia) and analyzed for editing by primer extension [37]. Quantification of editing was performed by using a RadiophosphorImager SL as described [37]. CDP-choline transferase (CT) and phosphatidylethanolamine Nmethyltransferase (PEMT) activity and protein levels: Hepatic activities of CDPcholine transferase (CT) and phosphatidylethanolamine N-methyltransferase were assayed in liver homogenates using 50 µg protein of the homogenates was used. The assays were performed as previous described [38]. The values are presented as nmol/min.mg protein. Lipoprotein lipase (LPL) and hepatic lipase (HL) activity: Activities of lipoprotein lipase (LPL) and hepatic lipase were determined in plasma after intravenous injection of 100 µL of heparin (2 IE/100 µL) as described [39]. Miscellaneous methods: Total and free cholesterol and triglycerides were measured using commercially available kits (Boehringer Mannheim, Germany). Phospholipids were assayed by phosphate determination as described [31]. Protein determination was done according to Lowry et al. [40] with BSA (Sigma, St Louis, MO, USA) as standard. Statistical analysis: All results are presented as means ± standard deviations for (-/-) mice the number of animals indicated. Differences between control and Mdr2 were determined by Mann-Whitney, exact 2-tailed U test [41]. Level of significance for all statistical analyses was set at p < 0.05. Analyses was performed using 59

Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice

SPSS for Windows software (SPSS, Chicago, IL, USA)

RESULTS Animal characteristics: Body weight did not differ between Mdr2(-/-) and control (-/-) mice compared to controls mice, whereas liver weight was increased in Mdr2 (Table 1) [23,30]. Plasma total cholesterol and cholesteryl ester concentrations (-/-) mice compared to control mice as shown previously [31]. were lower in Mdr2 Plasma triglyceride and phospholipid (not shown) levels did not differ between the two mouse strains. Fasting levels of apolipoprotein B100 were increased by ~70% in the knockout animals compared to controls, whereas apolipoprotein B48 levels showed no significant difference. Table 1: Animal characteristics of Mdr2(-/-) and control (Mdr2(+/+)) mice. The values are given as mean ± SD for 3-5 animals per group. Statistical significant differences were assessed using Mann-Whitney exact U-test analysis. Mouse

body weight (g) Mdr2(+/+) 29.7 ± 3.4 Mdr2(-/-) 31.4 ± 4.1 * significantly different from

Liver weight (g) 1.2 ± 0.2 2.2 ± 0.2* Mdr2(+/+) mice,

plasma cholesterol (mM) 3.8 ± 0.6 1.2 ± 0.4* p < 0.05.

plasma triglycerides (mM) 1.8 ± 0.5 1.3 ± 0.6

plasma ApoB100 (µg/mL) 38.3 ± 2.1 66.2 ± 7.0*

plasma ApoB48 (µg/mL) 39.7 ± 5.1 32.4 ± 5.8

Table 2: Hepatic triglyceride, apoB100 and apoB48 production rates and fractional turnover rates of apoB100 and apoB48 in Triton WR1339-treated Mdr2(-/-) and control (Mdr2(+/+)) mice. Plasma samples were taken by tail bleeding and analyzed as described in the Material and Method section. The values represent mean ± SD for 3-5 separate animals per group. Statistical significant differences were determined using Mann-Whitney exact U-test. Mouse

Mdr2(+/+) Mdr2(-/-)

TG-PR ApoB100-PR µmol/h.100g BW µg/h.100g BW

9.8 ± 1.2 15.5 ± 2.9*

34.3 ± 4.2 61.7 ± 7.3*

* significant different from Mdr2(+/+) mice.

ApoB100-FTR pools/day

6.3 ± 0.7 6.9 ± 0.7

ApoB48-PR µg/h.100g BW

ApoB48-FTR pools/day

52.5 ± 8.7 9.6 ± 2.5 148.8 ± 29.1 ± 4.3* 26.9*

Figure 1: Plasma increase of triglyceride concentrations in Mdr2(-/-) (dark circles) and Control (Mdr2(+/+)) (open circles) mice after Triton WR1339 injection. Blood samples were taken by tail bleeding as described in the Material and Method section. Data represent mean delta plasma triglyceride concentrations (in mM) ± SD, n = 5 per group. Differences between Mdr2(-/-) and control mice was analyzed using Mann Whitney exact Utest, * p< 0.05.

Hepatic VLDL-triglyceride and apolipoprotein B production in vivo: Fasted (-/-) Mdr2 and control animals were injected with Triton WR 1339 and hepatic VLDL(-/-) mice triglyceride and apolipoprotein B production was determined. Mdr2 showed a 50% increase in hepatic triglyceride production compared to control mice (Figure 1). Hepatic VLDL cholesterol production showed a four-fold increase in knockout animals compared to controls, i.e., 1.7 ± 0.5 versus 0.4 ± 0.2 µmol/h.100g body weight. Hepatic apoB100 and apoB48 production rates and the 60

Physiological functions of biliary lipid secretion

apoB48 fractional turnover rate were significantly increased in Mdr2(-/-) mice compared to control mice when expressed per 100g body weight (Table 2). Analysis of the relative lipid composition of the isolated VLDL particles revealed no change in cholesterol, cholesteryl ester, phospholipid or relative triglyceride (-/-) content in VLDL of Mdr2 mice compared to those of control mice (Table 3). The calculated [42] diameter of the VLDL particles isolated at 5 hours after Triton WR1339 injected revealed an increased size for VLDL particles isolated from (-/-) mice compared to control, i.e., 71.5 ± 2.9 nm versus 71.4 ± 10.4 nm, Mdr2 respectively. Table 3: Relative lipid content of isolated VLDL fractions at 5 hours after Triton WR1339 injection in Mdr2(-/-) and control (Mdr2(+/+)) mice. The VLDL fractions were isolated after ultracentrifugation as described in the Material and Method section. The relative content of triglycerides (TG), phospholipids (PL), cholesterol (C) and cholesteryl ester (CE) are represented as mean ± SD for 3 animals per group. Statistical significant differences were assessed by Mann-Whitney exact U-test analysis. Mouse TG PL C CE (% of total lipid) (% of total lipid) (% of total lipid) (% of total lipid) Mdr2(+/+) 77.5 ± 1.5 14.3 ± 0.4 8.1 ± 1.01 2.9 ± 0.7 Mdr2(-/-) 77.3 ± 2.5 14.6 ± 1.9 8.1 ± 1.2 2.7 ± 0.6

ApoB and MTP mRNA expression levels and apoB editing: To exclude that the (-/-) mice was due to altered observed increased VLDL production in Mdr2 expression of apoB or MTP we determined steady state mRNA levels of these (-/-) and control mice (Figure 2). No changes were proteins in livers of Mdr2 observed in steady state mRNA levels of either apoB or MTP. In addition, expression of fatty acid synthase (FAS) or diacylglycerol-acyl transferase (DGAT) were not affected by mdr2 Pgp-deficiency. We also determined the apoB editing [3] (-/-) and found no differences between Mdr2 and control mice, i.e., 50.7 ± 0.7% and (-/-) and control mice, 56.8 ± 1.3% (n = 4, ns) edited apoB mRNA in Mdr2 respectively. Figure 2: Steady state mRNA level of apolipoprotein B (apoB), microsomal triglyceride transfer protein (mtp), fatty acid synthase (fas), diacylglycerolLacyl transferase (dgat) and ß-actin was determined by RT-PCR in control (Mdr2(+/+)) and Mdr2(-/-) mice. Data shown are representative for at least 3 separate RNA isolations per group.

Lipid supply for VLDL assembly: We have previously shown that activities of HMG(-/-) CoA reductase (+ 190%) and ACAT (+ 80%) are increased in livers of Mdr2 mice [31], suggesting increased de novo supply of cholesterol(esters) in these mice. To (-/investigate whether the supply of phosphatidylcholine may be altered in the Mdr2 ) mice, we determined the activities of CDP-choline transferase (CT) and phosphatidylethanolamine N-methyltransferase (PEMT) in liver homogenates (Table 4). No significant differences were detected in hepatic activities of CT and (-/-) PEMT between Mdr2 and control mice. 61

Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice

Table 4: Activity of CDP-choline transferase (CT) and phosphatidylethanolamine Nmethyltransferase (PEMT) in liver homogenates of Mdr2(-/-) and control (Mdr2(+/+)) mice. Mouse Total CT activity PEMT activity (nmol/min/mg protein) (nmol/min/mg protein) Mdr2(+/+) 1.56 ± 0.34 1.64 ± 0.28 Mdr2(-/-) 2.24 ± 0.58 1.35 ± 0.24

50 µg of total protein was used in the assays, as described in detail in the Material and Method section.

Lipoprotein lipase and hepatic lipase activities: To check whether altered lipase activity in the plasma compartment may be of relevance for the observed differences in handling of apoB100- and apoB48-containing particles, the activities of lipoprotein lipase and hepatic lipase were determined. Lipoprotein lipase activity (-/-) was not different between Mdr2 and control mice, i.e., 11.0 ± 3.2 versus 20.1 ± 7.8 mU/mL, respectively, whereas hepatic lipase activity was increased by ~110% (-/-) in Mdr2 mice compared to controls, i.e., 114.1 ± 22.9 versus 54.5 ± 4.8 mU/mL (p < 0.04), respectively.

DISCUSSION In this study, we show that hepatic VLDL production is increased in mice with absent biliary phospholipid and cholesterol secretion due to mdr2 Pgp-deficiency. Hepatic production rates of VLDL-triglyceride (1.5 times), apoB100 (1.8 times) and (-/-) mice compared to controls. The apoB48 (2.4 times) are increased in Mdr2 (-/-) enlarged liver of Mdr2 mice could, in theory, contribute to the observed increase in hepatic VLDL production, yet the enlargement of the liver is mainly accounted for by bile duct proliferation with fibrosis due to the lipid-free bile formed in mdr2 Pgp deficient mice [43,44]. There are no indications for an increased number of (-/-) mice. As expected, apoB mRNA levels were hepatocytes in the liver of Mdr2 (-/-) and control mice. Furthermore, apoB mRNA editing was similar in Mdr2 (-/-) mice. Therefore, the increased production of comparable to controls in Mdr2 apoB48-containing particles relative to apoB100-containing particles must be due to post-editing events, as has also been observed in fat-laden rat hepatocytes [45]. MTP is suggested to be rate-controlling in the supply of lipid to the nascent apoB (-/-) and control mice, particle. MTP mRNA levels did not differ between Mdr2 although it can obviously not been excluded at this point that increased MTP activity contributes to the observed differences. Alterations in the lipid supply for hepatic VLDL secretion may contribute to (-/-) mice. The capacity of phosphatidylcholine altered VLDL production in Mdr2 synthesis, an important determinant of VLDL particle size and production [15-18], appeared unaffected in the knockouts since the activities of CT and PEMT were (-/-) found to be similar in Mdr2 and control mice. Of course, in the in vivo situation the synthesis of phosphatidylcholine is expected to be decreased since the (-/-) mice. massive biliary phospholipids flux (~14 mg per day) is lacking in Mdr2 (-/-) Although the cholesterol(ester) content in the liver did not differ between Mdr2 and control mice [31], we showed in an earlier study that the activities of HMG-CoA (-/-) mice [31]. Increased activities of reductase and ACAT are increased in Mdr2 these two rate-controlling enzymes could contribute to increased production of (-/-) hepatic VLDL-cholesterol in Mdr2 mice [11-14]. The increased activities of these 62

Physiological functions of biliary lipid secretion

enzymes might in fact be a result of de-repressed cholesterol biosynthesis due to absence of intestinally derived cholesterol entering the liver via the chylomicron remnant pathway [46], due to absence biliary cholesterol secretion and impaired (-/-) chylomicron formation in Mdr2 mice [47]. The results of these studies are consistent with the notion that VLDL production may, in part, be regulated via modulation of hepatic lipid precursor pools, either directly via interference with biliary lipid secretion or indirectly via regulation of cholesterol biosynthesis by the absence of entry into the liver of chylomicron remnants. In addition, based on the present data, it can not be excluded that mdr2 Pgp-deficiency in itself has an affect on VLDL production independent of its effect on hepatobiliary lipid transport. Studies in cultured hepatocytes need to be performed to resolve these issues. Fractional turnover rate of apoB100 was not affected, whereas that of (-/-) apoB48 was significantly higher in Mdr2 mice compared to control animals. As a (-/-) consequence, fasting apoB48 levels were not elevated in Mdr2 mice in spite of its increased production by the liver. The difference between the fractional turnover rates of apoB100 and apoB48 may be related to differential metabolic handling in the circulation [48], for instance by differential interactions of apoB100- and apoB48-containing particles with lipases. Lipoprotein lipase activity was not (-/-) increased, whereas hepatic lipase activity was doubled in Mdr2 mice. It seems that large, apoB48-containing chylomicrons are preferred substrates for lipoprotein lipase [49,50]. ApoB48-containing lipoproteins derived from the intestine are absent in fasted animals, therefore large apoB48-containing VLDL particles produced by the liver are probably more efficiently cleared from the circulation. The increased hepatic lipase activity could, in part, accelerate the clearance of apoB48containing particles by the liver, either by increasing exposure of apolipoprotein E [51] or via direct binding of apoB48 to hepatic lipase [52] which increases receptormediated uptake [51-53]. Alternatively, changes in receptor-mediated uptake systems for apolipoprotein B100-containing particles could contribute to these observations. Previously we showed that hepatic mRNA levels of the LDL-receptor (-/-) are not different between control and Mdr2 mice [31]. Other receptors, potentially involved in apolipoprotein B particle uptake, e.g., LDLR-related protein (LRP), megalin, the VLDL-receptor (VLDLR) and several others [54-58], have not been evaluated. (-/-) The increased hepatic lipase activity found in Mdr2 mice could, in addition to impaired chylomicron formation [47], contribute to low levels of HDL found in these animals [31]: it has recently been demonstrated that hepatic lipase promotes the selective uptake of HDL-cholesterol via the HDL-receptor, SR-BI [59,60], thereby reducing plasma HDL levels [61-63]. Furthermore, mice lacking the hepatic lipase gene show increased plasma HDL-cholesterol levels [64]. In conclusion, these studies show that impaired biliary (-/-) mice is associated with increased phospholipid/cholesterol secretion in Mdr2 hepatic triglyceride and apolipoprotein B production. Increased hepatic production and altered metabolic handling of VLDL contributes to the increased plasma (-/-) apolipoprotein B levels found in Mdr2 mice. References 1. Schaefer EJ, McNamara JR, Genest J, Jr., Ordovas JM. Clinical hypertriglyceridemia. Semin Thromb Hemost 1988;14:143-148.

significance

of

63

Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice 2. Gianturco SH, Bradley WA. Lipoprotein-mediated cellular mechanisms for atherogenesis i n hypertriglyceridemia. Semin Thromb Hemost 1988;14:165-169. 3. Greeve J, Altkemper I, Dieterich JH, Greten H, Windler E. Apolipoprotein B mRNA editing i n 12 different mammalian species: hepatic expression is reflected in low concentrations of apoBcontaining plasma lipoproteins. J Lipid Res 1993;34:1367-1383. 4. Hodis HN, Mack WJ. Triglyceride-rich lipoproteins and progression of atherosclerosis. Eur Heart J 1998;19 Suppl A:A40-4. 5. Yao Z, Mcleod RS. Synthesis and secretion of hepatic apolipoprotein B-containing lipoproteins. Biochim Biophys Acta 1994;1212:152-166. 6. Dixon JL, Ginsberg HN. Hepatic synthesis of lipoproteins and apolipoproteins. Semin Liver Dis 1992;12:364-372. 7. Dixon JL, Ginsberg HN. Regulation of hepatic secretion of apolipoprotein B-containing lipoproteins: information obtained from cultured liver cells. J Lipid Res 1993;34:167-179. 8. Mason TM. The role of factors that regulate the synthesis and secretion of very-low-density lipoprotein by hepatocytes. Crit Rev Clin Lab Sci 1998;35:461-487. 9. Kannel BW, Castelli WP, Gordon T, McNamara PM. Serum cholesterol, lipoproteins, and the risk of coronary heart disease. The Framingham study. Ann Intern Med 1971;74:1-12. 10. Castelli WP. Lipids, risk factors and ischaemic heart disease. Atherosclerosis 1996;124 Suppl:S1-9:S1-9. 11. Thompson GR, Naoumova RP, Watts GF. Role of cholesterol in regulating apolipoprotein B secretion by the liver. J Lipid Res 1996;37:439-447. 12. Musanti R, Giorgini L, Lovisolo P, Pirillo A, Chiari A, Ghiselli G. Inhibition of acylCoA:cholesterol acyltransferase decreases apolipoprotein B-100-containing lipoprotein secretion from HepG2 cells. J Lipid Res 1996;37:1-14. 13. Avramoglu RK, Cianflone K, Sniderman AD. Role of the neutral lipid accessible pool in the regulation of secretion of apoB-100 lipoprotein particles by HepG2 cells. J Lipid Res 1995;36:2513-2528. 14. Nervi F, Bronfman M, Allalon W, Depiereux E, Del Pozo R. Regulation of biliary cholesterol secretion in the rat. Role of hepatic cholesterol esterification. J Clin Invest 1984;74:2226-2237. 15. Fast DG, Vance DE. Nascent VLDL phospholipid composition is altered when phosphatidylcholine biosynthesis is inhibited: Evidence for a novel mechanism that regulates VLDL secretion. Bba-Lipid Lipid Metab 1995;1258:159-168. 16. Vermeulen PS, Lingrell S, Yao ZM, Vance DE. Phosphatidylcholine biosynthesis is required for secretion of truncated apolipoprotein Bs from McArdle RH7777 cells only when a neutral lipid core is formed. J Lipid Res 1997;38:447-458. 17. Verkade HJ, Fast DG, Rusinol AE, Scraba DG, Vance DE. Impaired biosynthesis of phosphatidylcholine causes a decrease in the number of very low density lipoprotein particles in the Golgi but not in the endoplasmic reticulum of rat liver. J Biol Chem 1993;268:2499024996. 18. Vance JE, Vance DE. The role of phosphatidylcholine biosynthesis in the secretion of lipoproteins from hepatocytes. Can J Biochem Cell Biol 1985;63:870-881. 19. Kuipers F, Jong MC, Lin Y, Van Eck M, Havinga R, Bloks V, Verkade HJ, Hofker MH, Moshage H, Van Berkel TJC, Vonk RJ, Havekes LM. Impaired secretion of very low density lipoprotein-triglycerides by apolipoprotein E-deficient mouse hepatocytes. J Clin Invest 1997;100:2915-2922. 20. Mensenkamp AR, Jong MC, van Goor H, van Luyn MJ, Bloks V, Havinga R, Voshol PJ, Hofker MH, van Dijk KW, Havekes LM, Kuipers F. Apolipoprotein E Participates in the Regulation of Very Low Density Lipoprotein-Triglyceride Secretion by the Liver. J Biol Chem 1999;274:35711-35718. 21. Nervi F, Marinovic I, Rigotti A, Ulloa N. Regulation of biliary cholesterol secretion. Functional relationship between the canalicular and sinusoidal cholesterol secretory pathways in the rat. J Clin Invest 1988;82:1818-1825. 22. Stone BG, Erickson SK, Craig WY, Cooper AD. Regulation of rat biliary cholesterol secretion by agents that alter intrahepatic cholesterol metabolism. Evidence for a distinct biliary precursor pool. J Clin Invest 1985;76:1773-1781. 23. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38. 24. Cohen DE. Hepatocellular transport and secretion of biliary lipids. Curr Opin Lipidol 1999;10:295-302. 25. Rigotti A, Marzolo MP, Ulloa N, Gonzalez O, Nervi F. Effect of bean intake on biliary lipid secretion and on hepatic cholesterol metabolism in the rat. J Lipid Res 1989;30:1041-1048. 26. Wang H, Chen X, Fisher EA. N-3 fatty acids stimulate intracellular degradation of apoprotein B in rat hepatocytes. J Clin Invest 1993;91:1380-1389.

64

Physiological functions of biliary lipid secretion 27. Smit MJ, Temmerman AM, Wolters H, Kuipers F, Beynen AC, Vonk RJ. Dietary fish oilinduced changes in intrahepatic cholesterol transport and bile acid synthesis in rats. J Clin Invest 1991;88:943-951. 28. Smit MJ, Verkade HJ, Havinga R, Vonk RJ, Scherphof GL, In 't Veld G, Kuipers F. Dietary fish oil potentiates bile acid-induced cholesterol secretion into bile in rats. J Lipid Res 1994;35:301-310. 29. Stone BG, Evans CD. Evidence for a common biliary cholesterol and VLDL cholesterol precursor pool in rat liver. J Lipid Res 1992;33:1665-1675. 30. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA, van der Valk MA, Offerhaus GJA, Berns AJM, Borst P. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462. 31. Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HMG, Oude Elferink RPJ, Groen AK, Kuipers F. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-glycoprotein-deficient mice. Gastroenterology 1998;114:1024-1034. 32. Li X, Catalina F, Grundy SM, Patel S. Method to measure apolipoprotein B-48 and B-100 secretion rates in an individual mouse: evidence for a very rapid turnover of VLDL and preferential removal of B-48- relative to B-100-containing lipoproteins. J Lipid Res 1996;37:210-220. 33. Pelech SL, Pritchard PH, Brindley DN, Vance DE. Fatty acids promote translocation of CTP:phosphocholine cytidylyltransferase to the endoplasmic reticulum and stimulate rat hepatic phosphatidylcholine synthesis. J Biol Chem 1983;258:6782-6788. 34. Ridgway ND, Yao Z, Vance DE. Phosphatidylethanolamine levels and regulation of phosphatidylethanolamine N-methyltransferase. J Biol Chem 1989;264:1203-1207. 35. Pietzsch J, Subat S, Nitzsche S, Leonhardt W, Schentke KU, Hanefeld M. Very fast ultracentrifugation of serum lipoproteins: influence on lipoprotein separation and composition. Biochim Biophys Acta 1995;1254:77-88. 36. Jialal I, Fuller CJ, Huet BA. The effect of a-Tocopherol supplementation on LDL oxidation. Arterioscler Thromb Vasc Biol 1995;15:190-198. 37. Greeve J, Jona VK, Chowdhury NR, Horwitz MS, Chowdhury JR. Hepatic gene transfer of the catalytic subunit of the apolipoprotein B mRNA editing enzyme results in a reduction of plasma LDL levels in normal and watanabe heritable hyperlipidemic rabbits. J Lipid Res 1996;37:20012017. 38. Pelech SL, Power E, Vance DE. Activities of the phosphatidylcholine biosynthetic enzymes in rat liver during development. Can J Biochem Cell Biol 1983;61:1147-1152. 39. Jansen H, Hop W, van Tol A, Bruschke AV, Birkenhager JC. Hepatic lipase and lipoprotein lipase are not major determinants of the low density lipoprotein subclass pattern in human subjects with coronary heart disease. Atherosclerosis 1994;107:45-54. 40. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Biophys 1959;37:911-917.(Abstract) 41. Dawson-Saunders B, Trapp RG. Basic and clinical biostatistics. International Ed. Englewoods Cliffs NJ: Prentice Hall, 1990: 42. Beil UF, Grundy SM. Studies on plasma lipoproteins during absorption of exogenous lecithin in man. J Lipid Res 1980;21:525-536. 43. Van Nieuwkerk CMJ, Oude Elferink RPJ, Groen AK, Ottenhoff R, Tytgat GNJ, Dingemans KP, Weerman MAVB, Offerhaus GJA. Effects of ursodeoxycholate and cholate feeding on liver disease in FVB mice with a disrupted mdr2 P-glycoprotein gene. Gastroenterology 1996;111:165-171. 44. Van Nieuwkerk CMJ, Groen AK, Ottenhoff R, van Wijland M, Weerman MAV, Tytgat GNJ, Offerhaus JJA, Oude Elferink RPJ. The role of bile salt composition in liver pathology of mdr2 (/-) mice: Differences between males and females. J Hepatol 1997;26:138-145. 45. Coussons PJ, Bourgeois CS, Wiggins D, Gibbons GF. Selective recruitment of ApoB-48 for the assembly of VLDL in rat triacylglycerol-enriched hepatocytes. Arterioscler Thromb Vasc Biol 1996;16:889-897. 46. Nervi FO, Dietschy JM. The mechanisms of and the interrelationship between bile acid and chylomicron-mediated regulation of hepatic cholesterol synthesis in the liver of the rat. J Clin Invest 1978;61:895-909. 47. Voshol PJ, Minich DM, Havinga R, Oude Elferink RPJ, Verkade HJ, Groen AK, Kuipers F. Postprandial Chylomicron Formation and Fat Absorption in Multidrug Resistance Gene-2 PGlycoprotein-Deficient Mice. Gastroenterology 2000;118:173-182. 48. Beisiegel U. Lipoprotein metabolism. Eur Heart J 1998;19 Suppl A:A20-3. 49. Karpe F, Humphreys SM, Samra JS, Summers LKM, Frayn KN. Clearance of lipoprotein remnant particles in adipose tissue and muscle in humans. J Lipid Res 1997;38:2335-2343.

65

Chapter 4: Hepatic VLDL secretion in Mdr2 (-/-) mice 50. van Beek AP, van Barlingen HH, de Ruijter-Heijstek FC, Jansen H, Erkelens DW, DallingaThie GM, de Bruin TW. Preferential clearance of apoB-48-containing lipoproteins after heparin-induced lipolysis is modulated by lipoprotein lipase activity. J Lipid Res 1998;39:322332. 51. Brasaemle DL, Cornely-Moss K, Bensadoun A. Hepatic lipase treatment of chylomicron remnants increases exposure of apolipoprotein E. J Lipid Res 1993;34:455-465. 52. Choi SY, Goldberg IJ, Curtiss LK, Cooper AD. Interaction between ApoB and Hepatic Lipase Mediates the Uptake of ApoB- containing Lipoproteins. The Journal of Biological chemistry 1998;273:20456-20462. 53. Krapp A, Ahle S, Kersting S, Hua Y, Kneser K, Nielsen M, Gliemann J, Beisiegel U. Hepatic lipase mediates the uptake of chylomicrons and beta-VLDL into cells via the LDL receptorrelated protein (LRP). J Lipid Res 1996;37:926-936. 54. Herz J, Hamann U, Rogne S, Myklebost O, Gausepohl H, Stanley KK. Surface location and high affinity for calcium of a 500-kd liver membrane protein closely related to the LDL-receptor suggest a physiological role as lipoprotein receptor. EMBO J 1988;7:4119-4127. 55. Saito A, Pietromonaco S, Loo AK, Farquhar MG. Complete cloning and sequencing of rat gp330/"megalin," a distinctive member of the low density lipoprotein receptor gene family. Proc Natl Acad Sci U S A 1994;91:9725-9729. 56. Takahashi S, Kawarabayasi Y, Nakai T, Sakai J, Yamamoto T. Rabbit very low density lipoprotein receptor: a low density lipoprotein receptor-like protein with distinct ligand specificity. Proc Natl Acad Sci U S A 1992;89:9252-9256. 57. Novak S, Hiesberger T, Schneider WJ, Nimpf J. A new low density lipoprotein receptor homologue with 8 ligand binding repeats in brain of chicken and mouse [published erratum appears in J Biol Chem 1996 Oct 25;271(43):27188]. J Biol Chem 1996;271:11732-11736. 58. Kim DH, Iijima H, Goto K, Sakai J, Ishii H, Kim HJ, Suzuki H, Kondo H, Saeki S, Yamamoto T. Human apolipoprotein E receptor 2. A novel lipoprotein receptor of the low density lipoprotein receptor family predominantly expressed in brain. J Biol Chem 1996;271:83738380. 59. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor [see comments]. Science 1996;271:518520. 60. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 1997;387:414417. 61. Dichek HL, Brecht W, Fan J, Ji ZS, McCormick SP, Akeefe H, Conzo L, Sanan DA, Weisgraber KH, Young SG, Taylor JM, Mahley RW. Overexpression of hepatic lipase i n transgenic mice decreases apolipoprotein B-containing and high density lipoproteins. Evidence that hepatic lipase acts as a ligand for lipoprotein uptake. J Biol Chem 1998;273:1896-1903. 62. Hill SA, McQueen MJ. Reverse cholesterol transport--a review of the process and its clinical implications. Clin Biochem 1997;30:517-525. 63. Lambert G, Chase M, Dugi KA, Bensadoun A, Bryan Brewer Jr. H, Santamarina Fojo S. Hepatic lipase promotes the selective uptake of high density lipoprotein-cholesteryl esters via the scavenger receptor B1. J Lipid Res 1999;40:1294-1303. 64. Homanics GE, de Silva H, Osada J, Zhang SH, Wong H, Borensztajn J, Maeda N. Mild dyslipidemia in mice following targeted inactivation of the hepatic lipase gene. J Biol Chem 1995;270:2974-2980.

66

CHAPTER 5 DECREASED NA+ DEPENDENT TAUROCHOLATE UPTAKE AND LOW EXPRESSION OF THE SINUSOIDAL NA+TAUROCHOLATE COTRANSPORTING PROTEIN (NTCP) IN LIVERS OF MDR2 PGLYCOPROTEIN-DEFICIENT MICE. Nynke R. Koopen, Henk Wolters, Peter Voshol, Bruno Stieger, Roel J. Vonk, Peter J. Meier, Folkert Kuipers and Bruno Hagenbuch. Groningen Institute for Drug Studies, Center for Liver, Digestive and Metabolic 1 Diseases, University Hospital Groningen, Groningen, The Netherlands, Division of Clinical Pharmacology and Toxicology, Department of Medicine, University Hospital Zürich, Zürich, Switzerland

Published in Journal of Hepatology (1999) 30: 14-21.

Chapter5: Ntcp in mdr2 knockout mice

ABSTRACT Background / Aims: Ntcp-mediated uptake of bile salts at the basolateral membrane of hepatocytes is required for maintenance of their enterohepatic circulation. Expression of Ntcp is reduced in various experimental models of cholestasis associated with increased plasma bile salt concentrations. Mdr2 Pglycoprotein-deficient mice lack biliary phospholipids and cholesterol but show unchanged biliary bile salt secretion and increased bile flow. These mice are evidently not cholestatic, but plasma bile salt concentrations are markedly increased. The aim of this study was to investigate the role of Ntcp in the elevated bile salt levels in mdr2 P-glycoprotein-deficient mice. Methods: Plasma (+/+) and Mdr2(-/-) mice for membranes were isolated from male wild type Mdr2 + measurement of Na -dependent taurocholate transport and assessment of Ntcp protein levels by Western blotting. Northern blot analysis and competitive RT-PCR were used to determine hepatic Ntcp mRNA levels. Results: Kinetic analysis + showed a 2-fold decrease in the Vmax of Na -dependent taurocholate transport with (-/-) mice compared with Mdr2(+/+) controls. Ntcp protein an unaffected Km in Mdr2 (-/-) levels were 4-6 fold reduced in plasma membranes of Mdr2 mice relative to sexmatched controls. Surprisingly, hepatic Ntcp mRNA levels were not significantly (-/-) affected in the Mdr2 mice. Conclusions: Elevated plasma bile salt levels in mdr2 P-glycoprotein-deficient mice in the absence of overt cholestasis are associated with reduced Ntcp expression and transport activity. This is due to posttranscriptional down-regulation of Ntcp.

68

Physiological functions of biliary lipid secretion

INTRODUCTION Uptake of bile salts from portal blood at the sinusoidal membrane of hepatocytes + predominantly takes place by a sodium-dependent process mediated by Na taurocholate cotransporting protein (Ntcp). Ntcp-mediated uptake is thought to be essential for maintaining the enterohepatic circulation of bile salts. The expression and function of Ntcp is not regulated by physiological fluctuations in hepatic bile salt flux [1], but is down-regulated in various models of experimental cholestasis, including cholestasis induced by endotoxin or TNFα administration, bile duct ligation and ethinylestradiol administration [2-6]. Partial hepatectomy also leads to rapid down-regulation of Ntcp in rats [7]. Cholestatic conditions are usually associated with increased plasma bile salts levels: Ntcp expression appears to be inversely related to plasma bile salt levels, probably reflecting their intracellular concentrations, in cholestatic rat models [8]. Mice in which the gene encoding for mdr2 P-glycoprotein (Pgp) has been (-/-) disrupted (Mdr2 mice) are unable to secrete phospholipids and cholesterol into bile, but show increased bile flow and an unchanged biliary bile salt secretion [9]. These mice are evidently not cholestatic when cholestasis is defined a s “impairment or cessation of bile flow” [10-12]. Yet, these mice have elevated plasma bile salt and bilirubin levels. Furthermore, plasma levels of alkaline phosphatase, aspartate transaminase and alanine transaminase are increased (+/+) control mice, indicating damage of liver when compared with (+/-) and Mdr2 parenchyma. Morphologically, the livers of mdr2 knockout mice show some degeneration of hepatocytes, ductular proliferation and portal inflammation. Liver pathology in these mice has been shown to be related to the formation of lipid-free bile, exerting cytotoxic actions of bile salts towards bile duct epithelial cells [13,14]. To provide a mechanistic basis for the elevated plasma bile salt levels in the + absence of cholestasis in mdr2 Pgp-deficient mice, we determined the Na dependent transport of taurocholate in plasma membrane vesicles isolated from livers of these mice and we examined hepatic Ntcp protein and Ntcp mRNA levels.

MATERIALS AND METHODS Chemicals 3 [ H(G)]-taurocholate (3.47 Ci/mmol; 99% pure by HPLC and thin layer chromatography) was obtained from Du Pont/New England Nuclear (Boston, MA, USA). Unlabeled taurocholate was obtained from Calbiochem (La Jolla, CA, USA). The polyclonal Ntcp antibody (K4) and the complementary DNA used were described previously [1,15,16]. All other chemicals were of reagent grade or the highest purity grade commercially available and purchased from Sigma Chemicals (St. Louis, MO, USA) or Amersham (Little Chalfont, UK). Animals (-/-) (+/+) mice of the FVB strain [17] used Homozygous Mdr2 mice and control Mdr2 in these experiments were bred at the animal laboratory of the University of Amsterdam. Animals were used at 3-6 months of age and were kept in a lightand temperature-controlled environment. The mice had free access to lab chow and tapwater prior to the experiments. The animals received humane care and 69

Chapter5: Ntcp in mdr2 knockout mice

experimental protocols complied with the local guidelines for use of experimental animals. Prior to removal of the liver, the mice were anaesthetized with halothane and a blood sample was obtained by cardiac punction. The liver was weighed and immediately transferred to ice-cold NaHCO3 buffer (see below). A small part of the liver was removed at this point and frozen quickly in liquid nitrogen for subsequent RNA isolation. Analyses Bile salts in plasma were determined by an enzymatic fluorimetric assay [18]. Aspartate transaminase (AST), alanine transaminase (ALT) and bilirubin in plasma were measured by standard laboratory techniques. Isolation of liver plasma membranes and determination of enzyme activities Plasma membranes were isolated by a procedure adapted from the one described by Emmelot et al. [19]. Five grams of liver tissue, pooled from three mice, was cut in small pieces in 25 ml 1mM NaHCO3, pH 7.4 with 17 mg/l PMSF (phenylmethylsulfonylfluoride) and homogenized by seven strokes in a loose dounce (Braun, Melsungen, Germany). This homogenate was filtered through cheesecloth and diluted to a total volume of 35 ml NaHCO3 per 5 grams of liver. The homogenate was then centrifuged for 10 min at 1500g. The supernatant was removed and the pellet was resuspended in 35 ml fresh NaHCO3 buffer. This was centrifuged again for 10 min at 1000g. The supernatant was removed again and the remaining pellet was resuspended and centrifuged again at 1000g, for 10 min. This was repeated three times in total. The remaining pellet was resuspended in NaHCO3 buffer to a total of 3.6 ml and 10 ml of 62.2% (w/w) sucrose was added under mild stirring. This suspension was divided over two ultracentrifuge tubes, and was overlayered with respectively 6 ml 44.68%, 8 m l 40.81% and 6 ml 37.02% sucrose. The tubes were filled up with 0.25 M sucrose. These gradients were centrifuged for 1.5 hr at 90.000gav in a Centrikon TI28.38 rotor, in a Centrikon T-1080 ultracentrifuge (Kontron Instruments, Milan, Italy). The bands enriched in plasma membranes floating on the 40.8% and 44.68% layers were recovered, pooled, 4 times diluted with NaHCO3 and subsequently centrifuged for 15 min at 7500g. The pellet was resuspended in 40 ml NaHCO3 buffer and centrifuged for 10 min at 2500 g. The final membrane pellet was resuspended in buffer containing 300 mM sucrose, 0.2 mM CaCl2, 10 mM MgS04, 10 mM Hepes pH 7.5, homogenized by 50 strokes through a syringe needle and stored immediately in liquid nitrogen. Protein concentrations were determined according to Lowry [20]. Relative + + enrichments of Na / K -ATPase as a marker enzyme for the basolateral membrane fraction, alkaline phosphatase as a marker enzyme for the canalicular plasma membrane fraction and succinate cytochrome C reductase as marker for the contamination with mitochondria, i.e. the activity of these enzymes in the isolated plasma membrane preparation divided by their activity in the homogenate, was used to determine the degree of purification of the + + isolated membranes in the different experimental groups. Na / K ATPase [21], alkaline phosphatase [22] and cytochrome C reductase [23] were measured using a Uvikon 931 spectrophotometer (Kontron Instruments, Milan, Italy). 70

Physiological functions of biliary lipid secretion

Western Blotting Plasma membranes equivalent to 20 µg of protein were electrophoresed through a 10% polyacrylamide gel at 100 V. The proteins were electrophoretically transferred onto a nitro-cellulose filter (Amersham, Little Chalfont, UK) by tank blotting. Ponceau S staining was performed to check equal protein transfer. The filters were blocked overnight at 4°C in a solution of Tris-buffered saline with 0.1% Tween and 4% skim-milk powder pH 7.4. The blots were incubated with the primary antibody Ntcp (K4) in a 1:10.000 dilution for 3 hrs at room temperature, washed and immune complexes were detected using horseradish peroxidase-conjugated donkey anti rabbit IgG by the ECL Western blotting kit (Amersham, Little Chalfont, UK). Protein density was determined by scanning the blots using an Image Master VDS system (Pharmacia Biotech, Upsalla, Sweden) Transport studies. Transport studies were carried out in plasma membrane vesicles using a rapid filtration technique [24]. Five µl membrane vesicles (15 µg protein) were preincubated at 25°C for 1 min. Uptake was initiated by addition of 20 µl prewarmed incubation medium (final concentration: 100 mM NaCl or KCl, 100mM sucrose, 10 mM Hepes pH 7.5, 0.2 mM CaCl2 and 10 mM MgSO4 , bovine serum 3 albumin (BSA) 1 mg/ml , [ H]-taurocholate was added in different concentrations) to the membranes. Uptake was performed at 25°C. Uptake was stopped by adding 750 µl of ice-cold stop solution (100 mM sucrose, 100 mM KCl, 10 mM Hepes pH 7.5, 0.2 mM CaCl2 and 10 mM MgSO4 ) to the incubation medium. The sample was immediately filtered through a 0.45 µm Millipore filter (Millipore, Bedford, MA) that was prewashed with 1 ml stop solution containing 1 mM unlabeled taurocholate, and subsequently washed twice with 4 ml ice-cold stop solution. The filters were dissolved in Ultima gold MV scintillation fluid (Packard Instruments, Dowers Grove, IL) and counted in a liquid scintillation counter type Packard 1500 (Packard Instruments, Dowers Grove, IL). Northern Blotting Total RNA was isolated according to Chromczynski and Sacchi [25], separated on agarose formaldehyde gel and transferred to a nylon membrane, Hybond N (Amersham, Little Chalfont, UK), by overnight blotting. cDNA probes were labelled 8 9 using a random primed labelling kit to a specific activity of 10 -10 cpm/µg. Blots were prehybridized in hybridization solution (0.5 M NaHPO4, 1 mM Na2EDTA and 7 % SDS, pH 7.2) and 100 µg herring sperm DNA per ml, and hybridized at 65°C overnight at 1-2 *106 cpm/ml in hybridization solution. They were washed twice for 15 min in 2* SSC washing buffer ( 0.3 M NaCl, 30 mM Na-citrate and 1% SDS, pH 7.0) at 65°C and subsequently two times in 1* SSC washing buffer ( 0.15 M NaCl, 15 mM Na-citrate and 1% SDS ,pH 7.0) at 65°C. Activities were corrected for concentration differences, using 28S rRNA as an internal control Reverse transcription Total RNA was isolated using the Rneasy kit (QIAGEN AG, Basel, Switserland) and 1 µg samples were reverse transcribed with oligo (dT) primers and 15 units of AMV reverse transcriptase (promega, Madison WI) in a 20 µl reaction volume. 71

Chapter5: Ntcp in mdr2 knockout mice

Competative PCR primers specific for the mouse Ntcp (5’-GGTTCTCATTCCTTGCGCCA-3’, bp 535554; 5’-GCATCTTCTGTTGCAGCAGC-3’, bp 1026-1007) were linked to a 600 bp sequence derived from the neomycin gene by PCR using the following primers (5’GGTTCTCATTCCTTGCGCCACCCTGAATGAACTGCAGGAC-3’ forward ; 5’GCATCTTCTGTTGCAGCAGCAGGCGATGCGCTGCGAATCG-3’ reverse). This PCR product was re-amplified with the Ntcp specific primers resulting in a 640 bp fragment which was purified and used as a heterologous competitor fragment for Ntcp. Coamplification of liver cDNA and competitor fragment yielded two PCR products of 491 bp (Ntcp) and 640 bp (competitor). Samples of the reverse transcribed reaction corresponding to 10 ng of total RNA were amplified along with competitor cDNA corresponding to 2, 1, 0.5, 0.25, 0.125 or 0.0625 amol in a 50 230l PCR reaction that contained 0.2 mM dNTPs, 0.4µM of each Ntcp specific primer, 10 mM KCl, 10 mM(NH4)2SO4, 2mM MgSO4, 20mM Tris-HCl (pH8.75), 0.1% Triton X-100, 0.1 mg/ml BSA and 2.5 U TaqPlus Long polymerase mixture (Stratagene GmbH, Heidelberg, Germany). Cycle conditions were: 2 minutes denaturation at 95°C, 30 cycles of 45 seconds at 95 °C, 45 seconds annealing at 50°C, 1 minute elongation at 72°C, and final elongation for 5 minutes at 72 °C. Ten microliters of the reaction were separated on a 1% TAE agarose gel and after ethidium bromide staining competitor and Ntcp specific bands of equal intensities were determined visually. Statistics Data are expressed as mean ± SD for the indicated number of experiments. Statistical analysis between the experimental groups was assessed using Student’s two tailed t - test. Statistical significance was considered at p-values of < 0.05.

RESULTS Serum parameters The plasma levels of bile salts, bilirubin and the liver-function markers AST and ALT are summarized in Table 1. Plasma concentrations of bile salts are (-/-) mice compared with Mdr2(+/+) elevated significantly, i.e. by 100% in Mdr2 controls. As shown earlier [9,13], AST en ALT activities are markedly higher in the knockout mice than in controls. A smaller, but significant increase was found for serum bilirubin. Table 1. Plasma parameters of liver function in male wild type and mdr2 Pgp-deficient mice.

Mdr2(+/+) Mdr2(-/-)

AST (IU/L) 78 ± 24 203 ± 64 a

ALT (IU/L) 29 ± 6 217 ± 68 a

Bilirubin (µM) 3.7 ± 0.5 5.7 ± 0.7a

Data are given as means ± SD, n=9 in each group. a : significantly different from control p 95% of 3 plasma radioactivity was present in the triglyceride fraction. The plasma H(-/-) (+/+) and triglyceride content was reduced by 70% in Mdr2 mice compared to Mdr2 (+/-) mice at four hours after administration. No differences between Mdr2(+/-) Mdr2 and Mdr2(+/+) were observed. 101

Chapter 7: Prostprandial triglycerides in Mdr2 knockout mice Figure 3: Plasma appearance of 3H-triglycerides after an intragastric load of olive oil containing 3Htriolein and i.v. injection of Triton WR1339 at time point zero. Blood samples were drawn every hour and lipids were extracted from plasma following a Bligh & Dyer extraction. Thin layer chromatography was preformed to isolate the triglyceride fraction for determination of radioactivity by scintilation counting. Scanning of the thin layer plates indicated that essentially all of the 3H-label was in the triglyceride fraction. Values represent dps per milliliter plasma as determined by scintilation counting (mean ± SD), n = 5 per group. Symbols: Mdr2(+/+) mice, open circles; Mdr2(+/-) mice, grey circles; Mdr2(-/-) mice, closed circles. *Differences between Mdr2(-/-) and Mdr2(+/-), Mdr2(+/+) mice at time points two, three and four hours were significant as determined by ANOVA analysis and Newman-Keuls t-test posthoc analysis, p < 0.05. Statistical analyses was performed on SPSS software (SPSS, Chicago, USA).

In a second experiment, Triton WR1339-pretreated mice were sacrified at one, two 3 or four hours after H-triolein administration and radioactivity in the stomach, the intestinal lumen, the intestinal wall and plasma was determined. The amount of (+/+) and Mdr2(-/-) mice at radioactivity remaining in the stomach was similar in Mdr2 all time points studied (data not shown), excluding differences in gastric emptying 3 between the two strains. Figure 4 shows that the H-triglyceride content of the (-/-) (+/+) mice intestinal lumen (top panel) also did not differ between Mdr2 and Mdr2 at any of the time points. Radiolabeled triglycerides accumulated in the intestinal (-/-) (+/+) mice during the course of the experiment: wall (mid panel) of Mdr2 and Mdr2 (-/-) (+/+) this accumulation was significantly higher in the Mdr2 as compared to Mdr2 animals at four hours after administration (41.8 ± 4.8 vs. 26.8 ± 5.6 % dose, p < 0.05). Sequential analyses of small intestinal radioactivity at 4 hours revealed that (-/-) mice accumulated more 3H-triglycerides mid and distal segments of the Mdr2 (+/+) mice, i.e., proximal: 9.3 ± 1.6 vs. 9.7 ± 1.4 % dose; mid: 27.3 than those of Mdr2 ± 1.5 vs. 15.3 ± 1.8 % dose (p < 0.05); distal: 5.2 ± 1.1 vs. 1.8 ± 1.2 % dose (p < 0.05), respectively. These results show that administered fat is taken up by the (-/-) mice, excluding possibility 1. As shown in the lower intestinal cells of Mdr2 3 panel of Figure 4, appearance of H-triglycerides in plasma was reduced in the (-/-) (+/+) mice. Because lipolysis was prevented by Triton Mdr2 compared to the Mdr2 WR1339, excluding possibility 3, these data collectively imply that enterally (-/-) administered fat is taken up at an unaffected rate by the intestinal cells of Mdr2 mice and that its secretion from the intestinal wall into the blood compartment i s delayed. At four hours after the fat load, intestinal tissue was collected for microscopical examination after staining for neutral fat by ORO (Figure 5). Fat droplets in the intestine of control mice were mainly localized to the interstitium of the villi, (-/-) probably in the lymph ducts (Figure 5-A. In Mdr2 mice (Figure 5-B), on the other 102

Physiological function of biliary lipid secretion

hand, there was intense staining of large fat droplets within the enterocytes and less staining in the interstitium. Table 2: Lipid composition of chylomicron fractions isolated from plasma of Mdr2(+/+), Mdr2(+/-) and Mdr2(-/-) mice. Mdr2

Diet

+/+ +/-/-

LF LF LF

Protein (%)

2.8 ±0.8 3.3 ± 0.8 4.2 ± 0.4

Lipid mass (mg)

3.8 ± 0.9 3.0 ± 0.4 1.1 ± 0.5a

Free cholesterol (%)

3.9 ± 0.5 2.5 ± 0.5 2.3 ± 0.4

Cholesterylester (%)

1.6 ± 0.01a 4.6 ± 1.0 5.3 ± 0.3

Triglycerides (%)

80.9 ± 5.8 76.5 ± 3.2 78.1 ± 0.4

Phospholipids (%)

14.1 ± 4.4 16.4 ± 3.2 14.3 ± 0.3

Chylomicrons were isolated by ultracentrifugation of 500 µL plasma collected at four hours after an intragastric olive oil load and intravenous injection of 12.5 mg Triton WR1339, as indicated in the Materials and Method section. Total and free cholesterol, phospholipids and triglycerides were determined using commercially available assay kits and total lipid mass was calculated as the sum of total cholesterol, phospholipids and triglycerides. Protein content of the chylomicron fraction was determined according to Lowry et al. [32]. Values represent percentage of the lipid class of the total lipid mass and are given as mean ± SD, n = 3. Statistical analysis was performed on SPSS software, SPSS, Chicago, USA. a significant difference between Mdr2(-/-) and Mdr2(+/-)/Mdr2(+/+) mice, p < 0.05.

Figure 4: 3H-triglyceride content of the small intestinal lumen (A), the small intestinal wall (B) and plasma appearance (C) at different time points after intragastric installation of 3H-triolein labeled olive oil in Mdr2(+/+) and Mdr2(-/-) mice. The small intestine and plasma were collected at indicated time points after an intragastric olive oil load containing 3H-triolein and intravenously injected Triton WR1339, as outlined in the Material en Method section. The small intestine was flushed with 5 mM taurocholate to eliminate residual luminal 3Hlabel. The tissues were homogenized and 3Htriglyceride content in luminal wash, tissue homogenates and plasma samples were determined by scintilation counting. Total recovery of radioactivity (stomach, small intestine, large intestine, taurocholate-wash, plasma and liver) exceeded 86% of the administered dose in all experiments. Values represent percentage of the dose in the intestinal lumen wash, tissue homogenates and plasma at one, two and four hours after intragastric administration, n = 4 per group. Symbols: Mdr2(+/+) mice, open circles; Mdr2(-/-) mice, closed circles. *Differences between Mdr2(-/-) and Mdr2(+/+) mice were significant as determined by Mann-Whitney U test analysis, p < 0.05. Statistical analyses was performed on SPSS software (SPSS, Chicago, USA).

Chylomicron formation and composition: At four hours after an intragastric fat load in Triton WR1339-pretreated mice, chylomicrons were isolated by ultracentrifugation and their composition was determined. As shown in Table 2, no significant differences were observed in the relative contribution of free cholesterol, triglycerides or phospholipids to the total lipid content of the isolated chylomicron fractions between the three groups. A somewhat larger contribution of cholesterol (+/-) and Mdr2(-/-) mice when esters was found in particles isolated from Mdr2 (+/+) mice. The chylomicron fraction isolated from Mdr2(-/compared to those of Mdr2 ) mice contained approximately 70% less lipid mass (sum of total cholesterol, 103

Chapter 7: Prostprandial triglycerides in Mdr2 knockout mice

phospholipids and triglycerides) than those of Mdr2(+/+) and Mdr2(+/-) mice, in accordance with the data obtained with radiolabeled triolein.

A

Figure 5: Representative small intestinal sections of Mdr2(+/+) (A) and Mdr2(-/-) mice (B), collected approximal 30 centimeters distal from the stomach at four hours after an intragastric olive oil load. The small intestine was flushed with ice-cold PBS and immediately frozen at -80oC. The 4 µm sections were stained with ORO and counterstained with haematoxilin (magnification 120 x). Arrowheads indicate the small fat droplets in the intestinal interstitium of Mdr2(+/+) mice (A) and the large fat droplets in the enterocytes of Mdr2(-/-) mice (B).

B

Fat balance studies: To explore the physiological consequence of impaired chylomicron release into the plasma compartment, total fat absorption was measured using a three day fat balance in mice fed either a low-fat (14 en%) or a high-fat (35 en%) diet for two weeks. Surprisingly, no differences were observed between the absorption coefficients in the three groups of mice on the low-fat diet (Table 3): all groups were able to absorb more than 98% of their dietary fat in this (-/-) mice showed a marginal decrease in situation. On a high-fat diet, the Mdr2 (+/+) and Mdr2(+/-) mice, but were still able absorption coefficient compared to Mdr2 to absorb ~95% of their dietary intake. Table 3: Total daily dietary fat intake (µmol), fecal fat output (µmol) and fat absorption coefficient (%) in Mdr2(+/+), Mdr2(+/-) and Mdr2(-/-) mice fed low-fat (LF) or high-fat (HF) diets. Mdr2 Diet Dietary lipid intake Fecal lipid output Absorption coefficient (µmol) (%) (µmol) +/+ LF 1710 ± 140 40 ± 80 97.7 ± 4.3 +/LF 1680 ± 900 30 ± 40 97.8 ± 2.5 30 ± 30 98.4 ± 1.5 -/LF 1810 ± 170 +/+ +/-/-

HF HF HF

4640 ± 1060 b 5430 ± 640 b 4980 ± 550 b

50 ± 30 130 ± 50 b 250 ± 90 b,c

98.8 ± 0.7 97.7 ± 1.2 94.9 ± 2.5 a

Dietary fat intake and fecal fat output were determined over a period of three days. Fecal and dietary fat content were quantified by gaschromatographic analysis as described in the Material and Method section. Values represent the dietary intake and fecal output over the whole three-day period. The apparent absorption coefficient was calculated as input-output/input x 100%. Values are mean ± SD, n = 7. Statistical analysis was performed using SPSS software (SPSS, Chicago, USA). a significant difference between Mdr2(-/-) and Mdr2(+/+) mice on same diet, p < 0.05. b significant difference between high- and low-fat diets per mouse strain, p < 0.05. c significant difference between Mdr2(-/-) and Mdr2(+/-)/Mdr2(+/+) mice on same diet, p < 0.05.

104

Physiological function of biliary lipid secretion

Plasma cholesterol and triglycerides levels showed similar absolute increases in reponse to feeding of the high-fat diet in all groups (Table 4). In contrast, livers of (-/-) (+/+) Mdr2 mice accumulated significantly more triglycerides than those of Mdr2 (+/-) and Mdr2 mice under these conditions, indicative for altered hepatic handling of (-/-) dietary fat by Mdr2 mice. Table 4: Plasma cholesterol and triglyceride concentrations and hepatic triglyceride content of Mdr2(-/-), Mdr2(+/-) and Mdr2(+/+) mice on low-fat (LF) and high-fat (HF) diets. Mdr2 Diet Plasma cholesterol Plasma triglycerides Hepatic triglycerides (mmol/L) (%LF) (mmol/L) (%LF) (µmol/liver) (%LF) +/+ LF 5.3 ± 0.5 0.7 ± 0.5 27.3 ± 9.6 +/LF 5.1 ± 0.4 1.0 ± 0.6 31.5 ± 7.3 0.5 ± 0.2 22.4 ± 8.7 -/LF 2.0 ± 0.5b +/+ +/-/-

HF HF HF

6.4 ± 1.0a (+ 20%) 6.3 ± 0.9a (+ 44%) 3.7 ± 0.8ab (+ 85%)

1.1 ± 0.4 (+ 57%) 1.6 ± 0.5 (+ 60%) 1.1 ± 0.4a (+ 120%)

35.9 ± 3.7 (+ 32%) 37.3 ± 3.2 (+ 18%) 55.5 ± 13.1ab (+ 148%)

Mice were anesthesized and blood samples were collected via cardiac puncture and total cholesterol and triglycerides were determined using commercially available assay kits. Values represent mean ± SD, n = 7. Hepatic triglyceride levels were measured in liver homogenates after a modified Bligh & Dyer lipid extraction [27], and expressed as total amount per liver, mean ± SD, n = 4. Statistical analyses was performed on SPSS software (SPSS, Chicago, USA). Values in parentheses indicate percentage change induced by the high-fat diet compared to the low-fat diet a significant difference between high- and low-fat diets per mouse genotype, p < 0.05. b significant difference between Mdr2(-/-) and Mdr2(+/-)/Mdr2(+/+) mice, p < 0.05.

DISCUSSION In this study we have addressed the role of biliary lipids, e.g., phospholipids (lecithin) and cholesterol, in postprandial triglyceride secretion by the intestine and overall fat absorption in vivo in intact mice. Studies in bile diverted rats and cultured cells have indicated that biliary phospholipids may fulfill an independent role in the process of intestinal fat absorption [8,10,16] but the physiological consequences hereof for the intact animal have remained unclear sofar. The present study shows that the characteristic plasma triglyceride response found in control animals after an intragastric fat load is completely abolished in mdr2 Pglycoprotein-deficient mice, that lack biliary phospholipids and cholesterol but do have normal bile salt secretion [19]. Under normal conditions dietary fats are incorporated into chylomicrons and subsequently transported via the lymph into the bloodstream. ApoB-48 is essential for chylomicron formation [24]. Yet, the (-/-) absence of a postprandial response in Mdr2 mice is unlikely related to (relative) apoB-48 deficiency in their intestine. First, we were able to demonstrate that apoB (-/-) (+/+) mice. mRNA levels in the intestine of Mdr2 mice are similar to those in Mdr2 This is in agreement with studies from Davidson et al. [14], showing no significant changes in apoB mRNA levels in the absence of bile or during infusion of bile components in rats. Second, infusion of rat bile into the intestine partly restored the (-/-) mice. Since bile capacity to elicit a postprandial triglyceride response in Mdr2 (-/-) mice, these results salts are already abundant in the intestinal lumen of Mdr2 indicate that the presence of biliary lipids per se is required for this response to (-/-) occur. The postprandial plasma triglyceride response in Mdr2 mice infused with rat bile was less pronounced and delayed when compared to that in control mice (compare figures 1 and 2). This is possibly explained by the fact that the oil load was given directly into the duodenum during the infusion period, thereby bypassing 105

Chapter 7: Prostprandial triglycerides in Mdr2 knockout mice

the physiological stimulation of pancreatic secretion and gallbladder contraction via cholecystokinin release and the contribution of lingual lipase to fat hydrolysis. Lingual lipase accounts for approximately 10-30% of the hydrolysis of dietary fat in rats [34]. As a consequence, the actual uptake of administered fat in the bile infusion experiment may have been delayed when compared to that of the intragastric fat load in the experiments shown in figure 1. In addition, the intestine (-/-) of Mdr2 mice has been deprived of biliary lipids from birth and this may have physiological consequences for triglyceride handling by intestinal cells. Despite these limitations, the bile infusion experiment clearly shows that the intestine of (-/-) mice is able to evoke a postprandial triglyceride response when the Mdr2 appropriate bile components are available. To differentiate directly between the potential causes underlying the (-/-) mice, i.e., decreased defective postprandial triglyceride response in Mdr2 uptake of fat by intestinal cells [35,36], impaired delivery from the intestine to the plasma compartment [11], or accellerated lipolysis of chylomicrons in the circulation [26], the fate of intragastrically installed radiolabeled triglycerides was followed in Triton WR1339-injected animals. Since chylomicron lipolysis was eliminated in these experiments, accelerated lipolysis could be excluded as the 3 (-/-) cause of the impaired H-triglyceride appearance in Mdr2 mice observed in this experiment. Because the luminal content of radioactivity did not differ between (+/+) and Mdr2(-/-) mice and the amount of radioactivity present in the intestinal Mdr2 wall was actually higher in the latter group, impaired uptake of fat by the intestinal 3 epithelium is unlikely responsible for the decreased plasma appearence of H(-/-) mice. It should be noted that the plasma appearance of triglycerides in Mdr2 (+/+) (figure 3) was slower than labeled triglycerides in Triton WR1339-injected Mdr2 (+/+) mice (figure 1), although in both that of mass triglycerides in untreated Mdr2 cases a similar load of fat was administered. This is probably explained by rapid incorporation into postprandial lipoproteins of unlabeled triglycerides from endogenous sources present in the enterocytes [37]. Collectively, the data strongly indicate that intragastrically administered fat is able to enter the intestinal cells of (-/-) Mdr2 mice but is subsequently less efficiently transported into the lymph in the absence of biliary lipids. This is supported by the observation that, at four hours after intragastric fat administration, ORO-positive material is mainly retained in the (-/-) (+/+) mice there is a clear shift towards enterocytes of Mdr2 mice while in Mdr2 the interstitium of the intestinal villi. Both from the labeling experiments and from measurement of chylomicron lipid mass, it appeared that plasma lipid accumulation after intragastric fat loading (-/-) mice compared to Mdr2(+/+) mice treated with Triton was ~70% lower in Mdr2 WR1339. Together with the chylomicron fraction analysis these results indicate (+/+) mice are secreted that chylomicrons of similar composition and size as in Mdr2 (-/-) mice, but at a lower rate. The total absence of a by the intestine of Mdr2 (-/-) mice (figure 1) is therefore most likely postprandial response in untreated Mdr2 explained by rapid hydrolysis of the few particles that are formed. No differences in 3 plasma H-triglyceride accumulation and chylomicron lipid mass were found (+/-) and Mdr2(+/+) mice, indicating that 60% of the normal biliary between Mdr2 phospholipid output is sufficient to maintain adequate chylomicron formation in this experimental set-up. Mathur et al. [17] showed in vitro that a certain threshold concentration of phosphatidylcholine is necessary for stimulation of chylomicron secretion by CaCo2 cells. Apparently, these requirements are fulfilled in the 106

Physiological function of biliary lipid secretion

Mdr2(+/-) mice. Since chylomicron surface materials, i.e., phospholipids and cholesterol, provide an important source for HDL lipids [38,39] it is tempting to (-/-) speculate that decreased formation and secretion of chylomicrons in Mdr2 mice contributes to the low HDL-cholesterol levels found in these mice [22]. (-/-) mice were Surprisingly, a three day fecal fat balance revealed that Mdr2 able to absorb more than 98% of dietary fat when fed a low-fat diet. Even on a high(-/-) fat diet, Mdr2 mice absorbed ~95% of their dietary fat, although in this case the (+/+) and absorption coefficient was slightly decreased when compared to Mdr2 (+/-) mice. Similar absolute increases in plasma cholesterol and triglyceride Mdr2 (-/-) (+/-) and Mdr2(+/+) mice. The levels were induced by high-fat feeding in Mdr2 , Mdr2 changes in plasma lipid concentrations were of the same order of magnitude a s reported by others [40,41] in mice fed similar high-fat/low-cholesterol diets and demonstrate that the metabolic actions of dietary fats leading to elevation of plasma lipid levels, which are in all likelihood mainly exerted after their absorption, are not affected by Mdr2 Pgp-deficiency. Several factors may contribute to the (-/-) efficient overall lipid absorption in Mdr2 mice. Experiments with bile-diverted rats have shown that fat absorption is delayed in time [42] and that it shifts from proximal to more distal parts of the intestine [42,43] in the absence of bile in the 3 intestine. Absence of biliary lipids alone may have similar effects: both the Htriolein data as well as histochemistry show that the fat is accumulating more in (-/-) distal parts of the intestine of Mdr2 mice. In addition, absorption of dietary fat in the form of free fatty acids via the portal vein may occur, as proposed by Mansbach et al. [44,45]. Mansbach et al. [45] found that portal absorption of long acyl chain lipids in bile-diverted rats depends on the lipid load and is greatly reduced when phosphatidylcholine is included in a lipid infusion mixture. Thus, unchanged overall fat absorption may in part be associated with increased portal long-chain (-/-) mice. We found a significant increase in hepatic fatty acid absorption in Mdr2 (-/-) triglyceride content in Mdr2 mice on the high-fat diet compared to the low-fat diet, (+/+) and Mdr2(+/-) mice. This while no significant increase was observed in Mdr2 may be a consequence of direct entry of intestinally-derived fatty acids into the liver, (-/-) mice. Portal followed by their incorporation in hepatic triglycerides, in the Mdr2 concentrations of free fatty acids at four hours after an intragastric olive oil bolus (+/+) and Mdr2(-/-) mice, i.e., 1.0 ± 0.3 and 0.8 ± 0.1 were not different between Mdr2 mmol/L, respectively. However, since portal blood flow has not been measured in these mice, these data can not be interpreted with respect to the actual fatty acid delivery to the liver. In conclusion, we have shown that the “postprandial” entry of triglycerides (-/-) mice in vivo, due to delayed chylomicron into plasma is decreased in Mdr2 production by the enterocytes. Based on the present results and on literature data [5,6,8,12,14,16], we propose that the absence of biliary phospholipids i s responsible for this phenomenon, since biliary cholesterol does not seem to have a major role in intestinal chylomicron secretion [16]. Because chylomicron surface lipids provide an important source of HDL lipids, impaired postprandial chylomicron production may, at least in part, explain the low HDL levels found in (-/-) mice [22]. In spite of impaired chylomicron formation, overall fat the Mdr2 (-/-) mice. In contrast, cholesterol absorption a s absorption is not affected in Mdr2 determined by a dual isotope procedure is reduced by ~50% in these animals [22], indicative for separate mechanisms of absorption for dietary long-chain fatty acids and for cholesterol. Our data support the existence of alternative, chylomicron107

Chapter 7: Prostprandial triglycerides in Mdr2 knockout mice

independent mechanisms of dietary long-chain fatty acid uptake that ensure maintenance of efficient fat absorption in situations in which chylomicron formation is disturbed.

ACKNOWLEDGMENTS The authors would like to thank Henk Wolters, Juul Baller and Roelof Ottenhoff for skillful technical assistance. Part of this work has been presented at the 71th Scientific Sessions of the American Heart Association, 8-12 November, Dallas, TX, USA and has been published in abstract form (Supplement to Circulation, 1998, vol. 98(17), I-35). This work is supported by grant 902-23-097 from The Netherlands Organization for Scientific Research (NWO).

REFERENCES 1. Hofmann AF, Borgstrom B. Physio-chemical state of lipids in intestinal content during their digestion and absorption. Fed Proc 1962;21:43-50. 2. Staggers JE, Hernell O, Stafford RJ, Carey MC. Physical-chemical behaviour of dietary and biliary lipids during intestinal digestion and absorption: 1. Phase behaviour and aggregation states of model lipid systems patterned after aqueous duodenal contents of healthy adult human beings. Biochemistry 1990;29:2028-2040. 3. Hernell O, Staggers JE, Carey MC. Physical-chemical behavior of dietary and biliary lipids during intestinal digestion and absorption. 2. Phase analysis and aggregation states of luminal lipids during duodenal fat digestion in healthy adult human beings. Biochemistry 1990;29:2041-2056. 4. Gilat T, Somjen GJ. Phospholipid vesicles and other cholesterol carriers in bile. Bba-Rev Biomembranes 1996;1286:95-115. 5. Scow RO, Stein Y, Stein O. Incorporation of dietary lecithin and lysolecithin into lymph chylomicrons in the rat. J Biol Chem 1967;212:4919-4924. 6. Tso P, Balint JA. Formation and transport of chylomicrons by enterocytes to the lymphatics. Am J Physiol 1986;250:G715-26. 7. Beil UF, Grundy SM. Studies on plasma lipoproteins during absorption of exogenous lecithin in man. J Lipid Res 1980;21:525-536. 8. Tso P, Lam J, Simmonds WJ. The importance of the lysophosphatidylcholine and choline moiety of bile phosphatidylcholine in lymphatic transport of fat. Biochim Biophys Acta 1978;528:364-372. 9. Tso P, Balint JA, Simmonds WJ. Role of biliary lecithin in lymphatic transport of fat. Gastroenterology 1977;73:1362-1367. 10. Tso P, Simmonds WJ. Importance of luminal lecithin in intestinal absorption and transport of lipid in the rat. Aust J Exp Biol Med Sci 1977;55:355-357. 11. Tso P, Kendrick H, Balint JA, Simmonds WJ. Role of biliary phosphatidylcholine in the absorption and transport of dietary triolein in the rat. Gastroenterology 1981;80:60-65. 12. Bennett Clark S. Chylomicron composition during duodenal triglyceride and lecithin infusion. Am J Physiol 1978;235:E183-E190. 13. Mansbach CM, Arnold A, Cox MA. Factors influencing triacylglycerol delivery into mesenteric lymph. Am J Physiol 1985;249:G642-G648. 14. Davidson NO, Drewek MJ, Gordon JI, Elovson J. Rat intestinal apolipoprotein B gene expression. Evidence for integrated regulation by bile salt, fatty acid, and phospholipid flux. J Clin Invest 1988;82:300-308. 15. Davidson NO, Kollmer ME, Glickman RM. Apolipoprotein B synthesis in rat small intestine: regulation by dietary triglyceride and biliary lipid. J Lipid Res 1986;27:30-39. 16. Field FJ, Born E, Chen H, Murthy S, Mathur SN. Regulation of apolipoprotein B secretion by biliary lipids in CaCo-2 cells. J Lipid Res 1994;35:749-762. 17. Mathur SN, Born E, Murthy S, Field FJ. Phosphatidylcholine increases the secretion of triacylglycerol-rich lipoproteins by CaCo-2 cells. Biochem J 1996;314:569-575. 18. Verkade HJ, Vonk RJ, Kuipers F. New insights into the mechanism of bile acid-induced biliary lipid secretion. Hepatology 1995;21:1174-1189.

108

Physiological function of biliary lipid secretion 19. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA, van der Valk MA, Offerhaus GJA, Berns AJM, Borst P. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462. 20. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38. 21. Oude Elferink RPJ, Ottenhoff R, van Wijland M, Frijters CMG, van Nieuwkerk CM, Groen AK. Uncoupling of biliary phospholipid and cholesterol secretion in mice with reduced expression of mdr2 P- glycoprotein. J Lipid Res 1996;37:1065-1075. 22. Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HMG, Oude Elferink RPJ, Groen AK, Kuipers F. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-glycoprotein-deficient mice. Gastroenterology 1998;114:1024-1034. 23. Kuipers F, Havinga R, Bosschieter H, Toorop GP, Hindriks FR, Vonk RJ. Enterohepatic circulation in the rat. Gastroenterology 1985;88:403-411. 24. Havel RJ. Postprandial lipid metabolism: an overview. Proc Nutr Soc 1997;56:659-666. 25. Steiner G, Haynes FJ, Yoshino G, Vranic M. Hyperinsulinemia and in vivo very-low-density lipoprotein triglyceride kinetics. Am J Physiol 1984;246:E187-E192. 26. Steiner G, Poapst ME, Shumak SL, Foster DM. Metabolism of the apolipoprotein Bcontaining lipoproteins. Methods Enzymol 1986;129:395-420. 27. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Biophys 1959;37:911-917.(Abstract) 28. Lin Y, Havinga R, Verkade HJ, Moshage H, Slooff MJ, Vonk RJ, Kuipers F. Bile acids suppress the secretion of very-low-density lipoprotein by human hepatocytes in primary culture. Hepatology 1996;23:218-228. 29. Pietzsch J, Subat S, Nitzsche S, Leonhardt W, Schentke KU, Hanefeld M. Very fast ultracentrifugation of serum lipoproteins: influence on lipoprotein separation and composition. Biochim Biophys Acta 1995;1254:77-88. 30. Kalivianakis M, Minich DM, Bijleveld CMA, Van Aalderen WMC, Stellaard F, Laseur M, Vonk RJ, Verkade HJ. Fat malabsorption in cystic fibrosis patients on enzyme replacement therapy is due to impaired intestinal uptake of long-chain fatty acids. Am J Clin Nutr 1999;69:127-134. 31. Chromcyzynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Ann Biochem 1987;162:156-158. 32. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the folin reagens. J Biol Chem 1951;193:265-275.(Abstract) 33. Dawson-Saunders B, Trapp RG. Basic and clinical biostatistics. International Ed. Englewoods Cliffs NJ: Prentice Hall, 1990: 34. Liao TH, Hamosh P, Hamosh M. Fat digestion by lingual lipase: mechanism of lipolysis in the stomach and upper small intestine. Pediatr Res 1984;18:402-409. 35. Tso P. Intestinal lipid absorption. In: Johnson LR, ed. Physiology of the Gastrointestinal Tract. 3rd Ed. New York: Raven Press, 1987:1867-1907. 36. Carey MC, Hernell O. Digestion and absorption of fat. Semin Gastroint Dis 1992;3:189208.(Abstract) 37. Shiau YF, Popper DA, Reed M, Umstetter C, Capuzzi D, Levine GM. Intestinal triglycerides are derived from both endogenous and exogenous sources. Am J Physiol 1985;248:G164-G169. 38. Redgrave TG, Small DM. Quantification of the transfer of surface phospholipids of chylomicrons to the high density fraction during the catabolism of chylomicrons in the rat. J Clin Invest 1979;64:162-171. 39. Eisenberg S. Plasma lipoprotein conversions. Methods Enzymol 1986;129:347-366. 40. Srivastava RA. Saturated fatty acid, but not cholesterol, regulates apolipoprotein AI gene expression by posttranscription mechanism. Biochem Mol Biol Int 1994;34:393-402. 41. Srivastava RA. Regulation of the apoliprotein E by dietary lipids occurs by transcriptional and post-transcriptional mechnism. Mol Cell Biochem 1996;155:153-162. 42. Melin T, Qi C, Nilsson A. Bile but not chyle lipoprotein is an important source of arachidonic acid for the rat small intestine. Prostaglandins Leukot Essent Fatty Acids 1996;55:337-343. 43. Knoebel LK. Intestinal absorption in vivo of micellar and nonmicellar lipid. Am J Physiol 1972;223:255-261. 44. Mansbach CM, Dowell RF, Pritchett D. Portal transport of absorbed lipids in rats. Am J Physiol 1991;261:G530-G538. 45. Mansbach CM, Dowell RF. Portal transport of long acyl chain lipids: effects of phosphatidylcholine and low infusion rates. Am J Physiol 1993;264:G1082-G1089.

109

Chapter 7: Prostprandial triglycerides in Mdr2 knockout mice

110

CHAPTER 8 BILIARY LIPIDS ARE NOT REQUIRED FOR INTESTINAL ABSORPTION AND PLASMA STATUS OF LINOLEIC ACID IN MICE

Deanna M. Minich, Peter J. Voshol, Rick Havinga, Frans Stellaard, Folkert Kuipers, Roel J. Vonk and Henkjan J. Verkade Groningen University Institute for Drug Exploration, Center for Liver, Digestive and Metabolic Diseases, Department of Pediatrics, University Hospital Groningen, Groningen, The Netherlands

Published in Biochimica et Biophysica Acta, 1441 (1999) 14-22

Chapter 8: EFA absorption and status in Mdr2 knockout mice

ABSTRACT Biliary phospholipids have been hypothesized to be important for essential fatty acid homeostasis. We tested this hypothesis by investigating the intestinal absorption and the status of linoleic acid in mdr2 Pgp-deficient mice which secrete phospholipid-free bile. In mice homozygous knockout for disruption of the mdr2 (-/-) (+/+) mice, dietary linoleic acid absorption was gene (Mdr2 ) and wildtype Mdr2 13 determined by 72-h balance techniques. After enteral administration, [ C]-linoleic 13 acid absorption was determined by measuring [ C]-linoleic acid concentrations in feces and in plasma. The status of linoleic acid was determined in plasma and in liver by calculating the molar percentage of linoleic acid and the triene:tetraene 13 ratio. Although plasma concentration of [ C]-linoleic acid at 2 h after enteral (-/-) compared to Mdr2(+/+) mice administration was significantly lower in Mdr2 13 (PÛ0.05), net intestinal absorption of dietary linoleic acid or of [ C]-linoleic acid (+/+) and Mdr2(-/-) mice. Molar percentage of linoleic acid and the was similar in Mdr2 (-/-) triene:tetraene ratio were not different in whole plasma or in liver of Mdr2 compared to Mdr2(+/+) mice. Present data indicate that biliary (phospho)lipids are involved in the rate of appearance in plasma of enterally administered linoleic acid, but are not required for net intestinal absorption or plasma status of linoleic acid. 112

Physiological functions of biliary lipid secretion

INTRODUCTION Since essential fatty acids (EFAs) cannot be synthesized de novo by mammals, their concentration in the body depends on adequate dietary supply and subsequent efficient absorption. The classical indicator of overall EFA-deficiency i s an increased ratio of plasma concentration of eicosatrienoic acid (20:3n-9) compared to that of arachidonic acid (20:4n-6). A triene:tetraene (20:3n-9/20:4n-6) ratio above 0.2 would justify classification as EFA-deficient in humans [1]. Specifically, the status of linoleic acid (LA;18:2n-6), the major dietary EFA, i s conventionally determined by measuring its concentration in relation to that of other fatty acids (mol %) [1,2]. Theoretically, decreased plasma concentrations of LA can be the result of decreased absorption, increased catabolism, or a redistribution of LA over the various body compartments, including plasma. Impairments in LA status have been associated with severe clinical symptoms [3]. Biliary phospholipids could be important for the maintenance of EFA status, based on their well-documented role in the lymphatic transport of dietary lipid under physiological conditions [4-9]. In bile-diverted rats, the lymphatic triglyceride content has been demonstrated to increase during intestinal infusion of triolein and bile salts and can be enhanced further by the inclusion of phosphatidylcholine (PC) into the perfusate [5,6,10-13]. Also, the supply of biliary phospholipids to the bile-diverted rat intestine resulted in an increase in the synthesis of apolipoprotein B-48 (apo B-48), the apolipoprotein needed for chylomicron formation [14,15]. Finally, although it has not been demonstrated, the EFA-rich acyl chain composition of the PC molecule may be relevant for chylomicron production and/or for maintenance of the intestinal mucosa membrane. In this study, we investigated if biliary lipids (i.e. phospholipids, cholesterol) play a role in the absorption of LA and in the maintenance of physiological plasma concentrations of LA. Mice lacking the mdr2 gene product in the bile canalicular (-/-) membrane, also known as mdr2 knockout (Mdr2 ) mice, lack biliary phospholipids and have a strongly reduced (~97%) cholesterol secretion into bile, (-/-) mice in spite of normal bile salt secretion rates [16]. The availability of Mdr2 allow the opportunity to investigate the role of biliary lipid secretion for LA absorption and homeostasis in vivo [16-18]. In the present study, we determined 13 (+/+) and mdr2 the absorption of dietary and [ C]-LA and the status of LA in Mdr2 knockout male mice. Our results indicate that biliary lipids are not required for intestinal absorption and plasma status of linoleic acid in mice.

MATERIALS AND METHODS Animals: Two-month old male Mdr2(+/+) and mdr2 knockout (Mdr2(-/-)) mice with a FVB background were used [19]. Animals were obtained from the colony at the Central Animal Facility, Academic Medical Center, Amsterdam, The Netherlands. Experimental protocols were approved by the Ethics Committee for Animal Experiments, Faculty of Medical Sciences, University of Groningen, Groningen, The Netherlands. Two weeks before the experiment, the mice (~ 25 g) were individually-housed and allowed tap water and chow (Hope Farms B.V., Woerden, The Netherlands) (Fig. 1a) ad libitum. Animals were housed in a light-controlled (lights on 6 AM - 6 PM) environment. 113

Chapter 8: EFA absorption and status in Mdr2 knockout mice

Experimental procedures: After an overnight fast, mice of both genotypes (n=7 per group) were anesthetized with halothane and a baseline blood sample was obtained by tail bleeding. Blood was collected in micro-hematocrit tubes containing heparin and centrifuged to obtain plasma. Directly after taking the blood 13 sample, 100 µL lipid, containing [ C]-linoleic acid, was slowly administered by intragastric gavage. This amount of lipid provided enough volume for reliable, reproducible administration of the labeled compound. The lipid bolus was composed of olive oil (25% v/v; fatty acid composition: 16:0, 14%; 18:1n-9, 79%; 18:2n-6, 8%) and medium chain triglyceride oil (75% v/v; composed of extracted coconut oil and synthetic triglycerides; fatty acid composition: 6:0, 2%; 8:0, 50-65% 13 max.;10:0, 30-45%; 12:0, 3% max.), and contained a tracer amount of [U- C]-LA 13 (0.90 µmol) (Martek Biosciences Corporation, Columbia, MD, USA); [U- C]-LA was 99% enriched with a chemical purity exceeding 97%. The bolus represented ~25% and ~4% of the daily molar lipid intake and the caloric intake, respectively. Blood samples were collected by tail bleeding 2 and 4 h after bolus administration. Feces samples were collected in 24 h fractions beginning 24 h before bolus administration and ending 72 h afterwards. Chow ingestion was measured by daily weighing of chow containers. At 72 h, a large blood sample (0.6-1.0 mL) was obtained by heart puncture, and liver was removed. In a separate experiment, mice (n=6) were anaesthetized by intraperitoneal injection of Hypnorm (fentanyl/fluanisone) and diazepam and their gallbladders were cannulated for collection of bile for 1 h as described previously [20]. Analytical techniques: Lipid extraction and methylation. Lipids from bile or from plasma were extracted and methylated according to Lepage and Roy [21]. After freeze-drying and mechanical homogenization, aliquots of chow and feces were subject to the same procedure [21]. Duplicate aliquots of liver homogenate (n=3 per group) were extracted [22] and methylated [21] as described previously. Resulting fatty acid methyl esters from all biological samples were analyzed by gas chromatography to measure total and individual amounts of major fatty acids and, for plasma, liver, and feces, by gas chromatography combustion isotope ratio mass spectrometry 13 (GC-C-IRMS) to measure the [ C]-enrichment of LA and LA metabolites. Biliary phospholipid content was determined in bile samples collected for one hour using a commercially available kit (WAKO Chemicals GmbH, Neuss, Germany). Gas liquid chromatography. Fatty acid methyl esters in plasma were separated and quantified by gas liquid chromatography as detailed in [23]. Fatty acids were quantified using heptadecanoic acid (17:0) as internal standard. 2.3.3 Gas chromatography-combustion-isotope ratio mass spectrometry (GC-C13 IRMS): [ C]-enrichment of the LA methyl esters was determined by using a Finnigan MAT Delta S IRMS interfaced to a Varian 3400 gas chromatograph via a capillary oxidation furnace (Finnigan MAT, Bremen, Germany). The furnace i s maintained at 800°C and consists of a 0.5 mm internal diameter ceramic tube containing an oxidized copper wire and platinum as a catalyst. An aliquot (2 µL) of the hexane layer containing the derivatized fatty acids was injected into the gas chromatograph (CP Sil 88, 50 m x 0.32 mm, 0.2 µm film thickness, Chrompack, 114

Physiological functions of biliary lipid secretion

Middleburg, The Netherlands), using the splitless mode. The carrier gas was helium maintained at a column head pressure of 19 p.s.i. The injector temperature was 280°C, and the oven was programmed from an initial temperature of 80°C to a final temperature of 225°C in 3 temperature steps (80°C held 1 min; 80-150°C, ramp 30°C/min; 150-190°C, ramp 5°C/min; 190-225°C, ramp 10°C/min, held 5 12 + 13 + 17 min). CO2 and CO2 ions were measured at m/z 44 and 45. Correction for O 18 13 was achieved through measurement of O abundance at m/z 46 [24]. [ C] 13 abundance was expressed as the Î CPDB value, i.e. the difference between the sample value and the reference compared to the Pee Dee Belemnite limestone. 13 13 Î CPDB values were converted to atom % [ C] values. Enrichment is expressed by 13 subtracting the baseline [ C] abundance from all enriched values. The enrichment 13 13 (atom % excess) is converted to mol % [ C]-LA. The [ C]-LA concentration i s 13 13 calculated from the LA concentration and mol % [ C]-LA. The concentration of [ C]LA in plasma is then expressed as the percentage of the dose administered per milliliter plasma (% dose/mL). Calculations Linoleic acid (LA) absorption using 72-h balance techniques. Absorption of dietary 13 LA and of [ C]-LA was measured using balance techniques, in which the amount of LA excreted in feces over 72 h was subtracted from the amount of dietary LA ingested during 72 h, together with bile LA (net molar absorption), and then expressed as a percentage of the amount LA ingested during 72 h (percentage of absorption). Net absorption of LA = LA ingested + Biliary LA/72 h (mol) - LA fecal excretion/72 h (mol) % LA absorbed = LA ingested + Biliary LA/72 h (mol) - LA fecal excretion/72 h (mol) LA ingested + Biliary LA/72 h (mol)

x 100%

Similar calculations were performed for [13C]-LA. Essential fatty acid (EFA) and linoleic acid (LA) status. The triene:tetraene ratio was calculated for plasma and for liver by dividing the concentration of 20:3n-9 by that of 20:4n-6. In plasma and in liver, n-6 fatty acid status was calculated using the sum of the area of major fatty acids (>90%) (16:0, 16:1n-7, 18:0, 18:1n-9, 18:1n-7, 18:2n-6, 18:3n-6, 20:3n-6, 20:3n-9, 20:4n-6) and then expressing the area of each individual n-6 fatty acid as a percentage of the total amount. Biliary fatty acid molar percentages. Relative concentrations (molar percentages) of major fatty acids in bile were calculated using the sum of the area of major fatty acid (>90%) peaks (16:0, 18:0, 18:1n-9, 18:2n-6, 20:4n-6) and then expressing the area of each individual fatty acid as a percentage of the total amount. Statistics: Values represent means ± S.E.M. for the indicated number of animals per group. Using SPSS 6.0 statistical software (Chicago, IL, USA), significance of differences was calculated using the two-tailed Student’s t-test for normally distributed, unpaired data or a Mann-Whitney U test for data that were not normally 115

Chapter 8: EFA absorption and status in Mdr2 knockout mice

distributed. Variance between data was determined using Levene’s Test for Equality of Variances. P Û 0.05 was considered significant.

RESULTS Body weight and chow ingestion: During the experiment, there was no significant difference in body weight (30.4 Ò 0.5 g vs 30.8 Ò 0.6 g; P>0.05) or in chow ingestion for 72 h (11.8 Ò 0.4 g/72 h vs 12.5 Ò 0.4 g/72 h; equal to 442 Ò 15 kcal/72 (+/+) and Mdr2(-/-) mice. h vs 469 Ò 15 kcal/72 h) between Mdr2

Linoleic acid (LA) quantification in chow and in bile: For accurate balance measurements, we quantified LA in chow and in bile. The chow contained 51.2 mol% LA (Fig. 1a) and 0.155 µmol lipid/mg chow. The LA (+/+) mice was 31.4 ± 0.9 mol% (mean ± S.E.M.) content of bile from male FVB Mdr2 (Fig. 1b). Based on the phospholipid secretion rate in these mice (15.7 ± 0.7 nmol phospholipids/min/100g BW, n=6), total daily biliary LA input to the intestine for a 25 g mouse was calculated to be 3.6 µmol/day (Fig. 1b). Using the average daily (+/+) and Mdr2(-/-) mice (4.05 Ò 0.01 g/day), the ingestion of chow for both Mdr2 average amount of LA ingested daily was estimated to be 317 µmoles (Fig. 1a). Thus, biliary LA secretion amounted only to approximately 1% of LA ingested per (+/+) mice. day (3.6 µmol/d vs 317 µmol/d) in Mdr2 Linoleic acid (LA) absorption: LA absorption was determined by balance techniques (i.e. ingestion and fecal 13 excretion) and by measuring plasma appearance of [ C]-LA after enteral lipid bolus administration. Dietary linoleic acid (LA) and [13C]-LA balances. 13 (+/+) and Mdr2(-/-) mice In Fig. 2a and 2b, dietary LA and [ C]-LA balance data of Mdr2 are shown. No differences between groups were found for ingestion, excretion or 13 net intestinal absorption. No [ C]-enrichments of other fecal fatty acids were noted, 13 indicating that the minor amount of unabsorbed [ C]-LA was not metabolized in 13 the intestinal lumen. Also, the percentage of dietary LA or of [ C]-LA was not (+/+) (-/-) and Mdr2 mice, and in each group exceeded 96% different between Mdr2 (Fig.3). Plasma [13C]-linoleic acid (LA). 13 Fig. 4 shows the time course pattern of [ C]-LA appearance in plasma after 13 (+/+) and Mdr2(-/-) mice. After administration, enteral administration of [ C]-LA to Mdr2 13 (+/+) mice, reaching a maximum [ C]-LA concentrations increased within 2 h in Mdr2 value of 0.020 ± 0.004 µmol [13C]-LA/mL plasma. In Mdr2(-/-) mice, maximum values 13 were measured at 4 h after bolus administration (0.016 ± 0.003 µmol [ C]-LA/L plasma). At 4 h, a plateau phase seemed not yet to have been reached, although it (-/-) is difficult to reach such a conclusion with only three data points. In Mdr2 mice, the concentration of [13C]-LA at 2 h was significantly decreased (0.009 ± 0.001 µmol [13C]-LA/mL) compared to Mdr2(+/+) mice (PÛ 0.05). 116

Physiological functions of biliary lipid secretion 350

50

300 250

40

200

30

150

20

100

10 20:4n-6

18:3n-3

18:2n-6

B

18:1n-9

18:0

50 16:0

0

0

5

Relative fatty acid concentrations (mol%)

4

30

3

20

2

10

20:4n-6

*

18:3n-3

18:2n-6

18:1n-9

18:0

16:0

1

Biliary fatty acid content (µmol/day)

40

0

Fatty acid consumption (µmol/day)

60

Relative fatty acid concentrations (mol%)

A

Fig. 1a and 1b. Relative long-chain fatty acid concentration (mol%) in chow (1a) and bile (1b), and daily input of these fatty acids (µmol/day) via chow and bile in male FVB wildtype mice. Molar percentage (mol%) is based on the total amount of major fatty acids: palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1n-9), linoleic acid (18:2n-6), linolenic acid (18:3n-3), and arachidonic acid (20:4). Chow samples ground to fineness and measured in duplicate. Chow provided 0.155 µmol lipid/mg chow (average daily chow ingestion: 4.05 Ò 0.01 g). Bile samples are the mean of 3 wildtype male mice. Phospholipid input (15.7 ± 0.7/min/100 g, n=6) based on bile samples that were obtained during the first hour after cannulation of the gallbladder. *=not detectable.

0

Linoleic acid (LA) status Plasma. Total fatty acid and LA concentrations were considerably reduced in (-/-) mice compared to Mdr2(+/+) mice, in accordance with the plasma from Mdr2 reduced triglyceride levels which have been described before [20] (total fatty acids: 7.96 ± 0.36 mM vs 13.04 ± 0.81 mM; LA: 2.08 ± 0.13 mM vs 3.47 ± 0.25 mM; for -/and +/+ mice, respectively; P 80%) of biliary origin. The sequential steps of intestinal cholesterol absorption have been studied extensively [4] but the actual mechanism(s) responsible for uptake by the intestinal cells from the lumen is not known. It has been suggested that cholesterol uptake is energy-independent and reflects passive diffusion down a concentration gradient [17]. Other studies indicate that cholesterol uptake is a protein-mediated process. Turnhofer et al. [18] provided evidence to suggest that uptake of cholesterol may be catalyzed by an intrinsic membrane protein. Recently, Landschulz et al. [19] have reported that a member of the scavenger receptor family, scavenger receptor, class B, type I (SR-BI) i s expressed in the intestine of rodents. Furthermore, Hauser et al. [20] have recently shown SR-BI is present in the small intestinal brush border of rabbits and, in in vitro experiments, it appears to facilitates uptake of free cholesterol from bile salt micelles and phospholipid vesicles into brush border membrane vesicles. SR-BI has recently been identified as a High Density Lipoprotein (HDL) receptor [21,22] involved in selective uptake of cholesterylesters from HDL by various organs, including liver and steriodogenic tissues [19,23,24]. In addition, SR-BI facilitates both non-lipoprotein cholesterol uptake [25] as well as free cholesterol efflux from cultured cells [26]. So far, however, nothing is known about regulation of intestinal SR-BI expression and whether alterations in its expression are actually associated with changes in cholesterol absorption efficiency In view of the role of bile constituents in cholesterol absorption and the proposed role of SR-BI in this process, we have investigated whether bile components influence intestinal SR-BI expression in rats and mice. Bile delivery into the intestine is completely blocked in bile duct-ligated rats and mice leading to accumulation of bile components in liver and plasma and to elevated plasma cholesterol levels [27-29]. Long-term bile diverted rats also experience a complete absence of bile in the intestinal lumen but without the potentially interfering consequences of cholestasis [30]. To differentiate between actions of biliary bile (-/-) salts and lipids, we used mdr2 P-Glycoprotein deficient (Mdr2 ) mice [31], in 125

Chapter 9: Regulation of intestinal SR-BI

which biliary phospholipids and cholesterol secretion is strongly impaired whereas bile salt secretion is unaffected [32].

MATERIALS AND METHODS Animals: Male Wistar rats (~300g) from the breeding colony of the University of Groningen were used. Bile-diverted rats were prepared as described previously [30] by providing the animals with a permanent silastic bile duct catheter. Bile was diverted for 7 days prior to the actual experiments. Bile duct ligation was performed in rats and FVB mice under halothane anesthesia. These animals were used 5 days after surgery. Mice homozygous for disruption of the multidrug resistance (-/-) (+/+) gene-2 (Mdr2 ) and control (Mdr2 ) mice of the same FVB-background were obtained from the breeding colony at the Animal Facility of the Academic Medical Center, Amsterdam. All mice were ~3 months of age. Animals were housed in a temperature- and light- (12 hours light cycle) controlled environment and were fed a standard lab-chow ad libitum. The experimental protocols were approved by the ethical committee on animal testing, University of Groningen, The Netherlands. Intestinal SR-BI protein levels: Animals were anesthesized with Halothane and the small intestines were rapidly removed and divided in two equal parts and ® flushed with phosphate-buffered saline containing protease inhibitors (Complete , Boehringer Mannheim, Mannheim, Germany). Intestinal mucosa was scraped for homogenization in buffer containing 250 mM sucrose, 10 mM Tris-base (pH 7.4) ® and protease inhibitors (Complete ). From these homogenates, brush border membrane (BBM) fractions were isolated by calcium precipitation as described by Schmitz et al. [33]. In short, homogenates were mixed with buffer (50 mM sucrose, 2 mM Tris, pH 7.4) containing CaCl2 (final concentration 10 mM). The mixture was TLX Tabletop incubated for 15 min on ice and centrifuged 2000 x g (Optima o Ultracentrifuge, Beckman, Fullerton, CA, USA) for 15 min at 4 C. The supernatant o was centrifuged at 20,000 x g for another 15 min at 4 C. The remaining pellet (P2 or BBM) was resuspended in homogenization buffer. Alkaline Phosphatase activity, used as a marker for enrichment of the BBM [33], was determined using the method described by Keeffe et al. [34]. After determination of total protein concentrations, equal amounts of protein, i.e., 5 µg for BBM and 30 µg for total membrane fractions, were loaded on a 4-15% gradient SDS-Page gel (BioRad, Hercules, USA) and electophoresed at 100 V. Proteins were blotted onto nitrocellulose membranes (BioRad, Hercules, USA) by tankblotting (300 mA, 2h). Nitrocellulose membranes were blocked overnight in 5% skim milk powder solution in Tris buffered saline (TBS) containing 0.1 % Tween and subsequently incubated with the primary antibody (rabbit polyclonal anti-murine SR-BI, 495 [21]) diluted 1:10.000 in 5% skim milk powder in TBSTween for 2h at room temperature. After washing a secondary antibody, anti-rabbit Ig linked to Horse Radish Peroxidase (Amersham, Little Chalfort, UK), diluted 1:1000 in 5% skim milk powder in TBS-Tween, was added for another hour. Detection was performed using ECL (Amersham) according to the manufacturers instructions. Liver total membrane fractions used for comparison were prepared as described [35]. For Western blot analysis of liver homogenates, ~ 1 µg of total membrane proteins were separated by SDS-Page. The ß-subunit of Na+/K+126

Physiological functions of biliary lipid secretion

ATPase constitutive expression levels were used as a reference signal detected with, antibodies kindly provided by Dr. Wilbert Peters (Nijmegen, The Netherlands). Deglycosylation of BBM and liver homogenate proteins was performed by incubation with N-deglycosylase (PNGase kit, New England Biolabs, Beverly, MA) following the manufacturer’s instructions. Imunohistochemistry and confocal laser analysis: Liver and small intestinal sections were collected, immediately frozen in liquid isopentane and 4 µm slices were cut of these tissues and fixed with acetone. The first antibody, anti-SR-BI (rabbit anti-murine SR-BI in 1% BSA/PBS) [21] was incubated followed by washing with PBS. Endogenous peroxidase was inhibited using 30% methanol, 0.3% H2O2 and detection was done with peroxidase-linked rabbit anti-guinea pig-Ig (Dako A/S, Glostrup, Denmark) with an amplification step using goat anti-rabbit-Ig (Dako A/S). 3-Amino-9-ethylcarbozole (Sigma, St. Louis, MO) was used as a substrate and tissue was counterstained with haematoxylin. For confocal scan microscopy Detection was performed using FITC-linked anti-rabbit Ig. Intestinal SR-BI mRNA levels: Total RNA was isolated from intestinal tissue a combination of the TRIzol Reagent (GIBCO BRL, Grand Island, NY) and the SV Total RNA isolation system (Promega, Madison WI, USA) according to the manufacturer’s instructions. Single stranded cDNA was synthesized from 4.5 µg RNA and subsequently subjected to polymerase chain reactions (PCR) using specific primers sets for rat and mouse HMG-CoA reductase (HMGR) (sense primer: 5’-GACACTTACAATCTGTATGATG-3’; antisense primer: 5’CTTGGAGAGGTAAAACTGCCA-3’), SR-BI (sense primer: 5’CTCATCAAGCAGCAGGTGCTCA-3’; antisense primer: 5’GAGGATTCGGGTGTCATGAA-3’) and β-actin (sense primer: 5’AACACCCCAGCCATGTACG-3’; antisense primer: 5’-ATGTCACGCACGATTTCCC3’). The PCR products were ran on 2.5% agarose gels and stained with ethidium bromide. Images were taken using a CCD video camera of the ImageMaster VDS system (Pharmacia, Upsulla, Sweden). Intestinal cholesterol absorption: Intestinal cholesterol absorption was determined using the dual-isotope ratio method of Zilversmit and Hughes [36], a s recently modified for use in rodents by Turley et al. [37]. In short, animals were 3 given an intravenous dose of H-labeled cholesterol (0.54 mg/5.0 µCi for rats and 0.27 mg/2.5 µCi for mice) dissolved in Lipofundin S (Lipofundin S 20%, B. Braun Melsungen AG, Melsungen, Germany) and, at the same time, an oral dose of 14Clabeled cholesterol (0.18 mg/2.5 µCi for rats and 0.07 mg/1.0 µCi for mice) dissolved in medium-chain triglyceride oil. After 48 hours, a blood sample was 14 C-labeled and 3H-labeled drawn by tail bleeding and the ratio between cholesterol was determined in plasma by scintillation counting. Intestinal cholesterol absorption was calculated as described previously [35]. Biochemical analysis: Protein contents of tissue total membrane fractions and BBM fractions were determined using the Lowry method [38]. Plasma cholesterol levels were determined using a commercially available kit (Boehringer Mannheim, Mannheim, Germany). Plasma amino transaminases (ALT and AST), alkaline phosphatase and total bilirubin were determined by standard clinical chemical 127

Chapter 9: Regulation of intestinal SR-BI

procedures. Contents of cholesterol in intestinal homogenates were determined after lipid extraction [39] as described previously [40]. Statistical analysis: Results are presented as means ± standard deviations for the number of animals indicated. Differences between three experimental groups were determined by one-way ANOVA analysis, with posthoc comparison by Newmann Keuls t-test [41]. Differences between two experimental groups were determined using Mann Whitney U test [41]. Level of statistical significance of the difference was set at p < 0.05. Analyses were performed using SPSS for Windows software (SPSS, Chicago, IL, USA)

Results Plasma biochemical analyses: In order to evaluate the role of bile components on SR-BI expression, we used bile-diverted rats, bile duct-ligated rats and mice and (-/-) mice. Plasma bilirubin, AST, ALT and cholesterol levels were markedly Mdr2 increased in bile duct-ligated rats when compared to control rats, while no changes were noted in bile-diverted rats (Table 1). Body weight and food intake were similar for all three groups (data not shown). Transaminases and bilirubin (-/-) mice as compared to wildtype mice, a s were clearly also elevated in Mdr2 previously described [32,42]. Bile duct ligation in wild type mice provoked a more pronounced increase in these parameters. Plasma cholesterol was reduced in (-/-) Mdr2 mice [35] and increased in cholestatic mice. Table 1: Plasma biochemical analysis of mice. Species Experimental AST condition (U/L) 59 ± 9 Rat control 475 ± 261a BDL 66 ± 4 BD 78 ± 24 Mouse control (-/-) 203 ± 64b Mdr2 409 ± 32b BDL

bile-diverted rats duct-ligated rats and mice and Mdr2(-/-) ALT (U/L) 34 ± 6 131 ± 80a 48 ± 7 29 ± 6 217 ± 68b 372 ± 124b

Bilirubin (µmol/L) 7.3 ± 2.3 181 ± 42a 10.0 ± 5.3 3.7 ± 0.5 5.7 ± 0.7b 138 ± 31b

Cholesterol (mmol/L) 1.9 ± 0.2 6.7 ± 4.3a 1.6 ± 0.1 3.5 ± 0.8 1.5 ± 0.9b 5.6 ± 2.1b

Cholesterol absorption (%) 57 ± 10 2 ± 1a 5 ± 2a 70 ± 13* 42 ± 8b* 2 ± 1b

All results are given as mean ± SD (n = 3-5). Plasma AST, ALT, bilirubin and cholesterol were determined by standard clinical chemical procedures. Cholesterol absorption was determined via the dual isotope method [37]. BDL = bile duct-ligated; BD = bile diversion; Mdr2(-/-) = mdr2 Pglycoprotein-deficiency. a significantly different from control rats, p < 0.05. b significantly different from control mice, p < 0.05 published previously in reference [35].

Intestinal cholesterol absorption: Cholesterol absorption, as quantified by the the dual isotope method [36,37], was strongly decreased in bile duct-ligated and bilediverted animals (Table 1). As reported previously [35], the absence of biliary (-/-) mice was associated with a ~40% phospholipid and cholesterol in Mdr2 reduction of cholesterol absorption efficiency. Total cholesterol content of the intestinal mucosa did not differ between control, bile-diverted and bile duct ligated rats, with values ranging from 8.5 - 10.5 nmol/mg protein and 11-12 nmol/mg protein for proximal and distal parts of the intestine, respectively. Similar results 128

Physiological functions of biliary lipid secretion

were observed in Mdr2(-/-) or BDL mice, ranging 14 - 18 nmol/mg protein and 19 23 nmol/mg protein for proximal and distal parts of the intestine, respectively. Intestinal SR-BI protein expression: Protein levels of SR-BI were assessed by Western analysis in brush border membrane (BBM) fractions of proximal and distal segments of rat intestine. As previously reported [19], the protein band detected in proximal BBM was ~ 78 kDa in size, i.e., ~ 4 kDa less than in hepatic total membrane fractions (~ 82 kDa) (Figure 1). Both hepatic and intestinal membrane fractions showed a SR-BI immunoreactivity at ~ 60 kDa after Ndeglycosylase treatment (Figure 1), indicating tha presence of a similar intact SRBI amino acid chain in both tissues. The relative abundance of SR-BI was evidently lower in intestine than in liver of rats. Similar results were obtained for mouse intestine (data not shown). Figure 1: Western blot of SR-BI in hepatic plasma membranes and intestinal brush border membranes isolated from rats. Deglycosylation was performed as described in the Material and Method section. N-Gly = N-deglycosylase, L = Liver, I = intestine. The amount of protein loaded was 1 µg for hepatic and 5 µg for intestinal preparations. The molecular weight standards are indicated.

A

B

C

D

Figure 2: Immunohistochemical (A, B) and confocal microscopy (C, D) of SR-BI in frozen small intestinal sections from rodents. A = control rat; B = control mouse; C = control rat; D = control rat (no anti-SR-BI added). The small intestinal sections shown are taken ~15 centimeters distal from the stomach. Arrow heads indicate the apical membrane staining of the enterocytes. The magnification used was 20x (A and B) and 40x (C and D).

Immunohistochemistry showed specific SR-BI staining of the apical membranes of rat and mouse enterocytes (Figure 2 A and B). This apical membrane staining was found throughout the whole length of the intestine. Only enterocytes were stained: the abundant goblet cell were all negative. Confocal microscopy confirmed the immunohistochemistry data and showed a strong apical staining of enterocytes of rats, while some intracellular staining was also evident (Figure 2 C). 129

Chapter 9: Regulation of intestinal SR-BI

Western blot analysis of brush border membranes isolated from different parts of the rat intestine revealed that SR-BI is more abundant in proximal parts of the intestine than in distal parts (Figure 3, compare lanes 2 and 3). BBM isolated from mouse intestine also showed higher abundancy of SR-BI protein in proximal than in distal parts (Figure 4, compare lanes 1 and 2). Figure 3: Representative Western blot of SR-BI in small intestinal total membrane (TM) and brush border membrane (BBM) fractions of control (C), bile duct-ligated (BDL) and bile-diverted (BD) rats. Proximal (P) and distal (D) parts of the intestine were used. Hepatic plasma membranes (L) were included as a positive control. The amounts of protein loaded was 1 µg for hepatic and 5 µg for intestinal preparations. Na+/K+ATPase was used as a control signal (nd = not determined).

Regulation of intestinal SR-BI expression by bile components: Protein levels of SR-BI in proximal and distal parts of the intestine were strongly reduced in bile duct-ligated rats (Figure 3, lanes 4 and 5) when compared to control rats (Figure 3, lanes 2 and 3) in both total membranes (TM) and brush border membranes (BBM). In bile diverted rats, the decrease in intestinal SR-BI levels was more pronounced when total intestinal membrane fractions instead of BBM were analyzed (Figure 3, top panel). In this case, only a weak band was found in the proximal intestine of bile-diverted rats. SR-BI levels decreased most pronouncedly in the BBM of the distal intestine to undetectable levels, whereas the proximal part showed only a minor decrease in comparison to controls. Bile duct-ligated mice also showed strongly reduced protein levels of SR-BI in the intestine (Figure 4). In contrast, (-/-) Mdr2 mice displayed a relatively small decrease in SR-BI protein in the proximal part of the intestine, i.e., approximately by 40% compared to control mice (Figure 4). Figure 4: Representative Western blot of SR-BI in intestinal brush border membranes of control (C), Mdr2(-/-) and bile duct-ligated (BDL) mice. Proximal (P) and distal (D) parts of the intestine were used. The amounts of protein loaded was 10 µ g. Na+/K+-ATPase was used as a control signal.

To investigate whether the decrease in protein levels of SR-BI is mediated via transcriptional or post-transcriptional mechanisms, we evaluated steady state levels of intestinal SR-BI mRNA by RT-PCR in rats with manipulations of the biliary tract (Figure 5). The mRNA levels of HMG-CoA reductase (HMGR), a key enzyme in cholesterol synthesis, were used for comparison. HMGR mRNA was more abundant in distal parts of the intestine in control and bile duct-ligated rats (Figure 5). As expected, bile-diverted rats showed a strong increase of HMGR mRNA levels, which was particulary evident in the proximal intestine. In accordance with localization with of the SR-BI protein, SR-BI mRNA was most abundant in proximal 130

Physiological functions of biliary lipid secretion

intestine of control rats (Figure 5, lanes 1 and 2). Steady state SR-BI mRNA levels were reduced by ~ 50% in the bile duct-ligated rats when expressed relative to βactin mRNA (Figure 5, bottom panel). This decrease was statistically significant (p < 0.05) for the proximal part of the intestine only. Bile diverted rats did not show a significant change in SR-BI mRNA levels compared to the control rats. In a similar fashion, bile duct-ligated mice showed a strong reduction in SR-BI mRNA levels (-/-) mice did not show any change in mRNA levels compared to whereas Mdr2 control mice (Figure 6) Figure 5: RT-PCR analysis of intestinal HMG-CoA reductase (HMGR) and SR-BI mRNA levels in control (C), bile duct-ligated (BDL) and bile-diverted (BD) rats. The mRNA levels of HMG), SR-BI and ß-actin shown represent a pool of three individual animals. The bottom panel shows relative amounts of SR-BI to ß-actin mRNA. The ratio between SR-BI and ßactin mRNA was determined in three independent samples (mean ± SD). (*) significantly different from control rats, p < 0.05; (#) significantly different from the proximal part of the intestine, p < 0.05 as determined by Mann Whitney U-test.

Figure 6: RT-PCR analysis of intestinal SR-BI mRNA levels in control (C), Mdr2(-/-) and bile duct-ligated (BDL) mice. The mRNA levels of SR-BI and ß-actin shown represent a pool of three different animals. The bottom panel shows relative amounts of SR-BI to ß-actin. The ratio between SR-BI and ß-actin were determined in three independent samples (mean ± SD). (*) significantly different from control mice, p < 0.05; (#) significantly different from the proximal part of the intestine, p < 0.05 as determined by Mann Whitney U-test.

DISCUSSION The results of this study confirmed the presence of SR-BI in rat and mouse intestine and clearly demonstrate that the protein is present at the apical membrane of the enterocytes. Furthermore, we demonstrate that SR-BI is more abundant in proximal than in distal segments of the intestine, i.e., a distribution pattern that mirrors that of HGMR, the rate-limiting enzyme in cholesterol biosynthesis. Finally, intestinal SR-BI appeared to be down-regulated at posttranslational and translational levels in both bile-deficient rodent models. As previously described [19] the molecular weight of the protein bands recognized by the anti SR-BI antibody in intestinal brush border membranes of rats and mice was ~ 4 kDa lower than that found in the liver. Deglycosylation of hepatic plasma membranes and intestinal brush border membranes proteins yielded 131

Chapter 9: Regulation of intestinal SR-BI

bands at ~ 60 kDa, approaching the size of the native protein based on its amino acid sequence [21]. Whether intestinal SR-BI is indeed less glycosylated than hepatic SR-BI in the in vivo situation or whether it reflects an artifact due to the isolation procedure used is not known. Hauser et al. [20] reported a ~ 84 kDa protein in intestinal brush border membranes of rabbits, identical in size a s adrenal rabbit SR-BI, using a similar isolation procedure. We further confirmed the presence of SR-BI in the brush border membrane by immunohistochemistry, demonstrating clear staining of the apical membrane of enterocytes. Apical membrane staining was found along the whole length of the small intestine, however, levels of SR-BI were much higher in proximal parts of the intestine than in distal parts. Since SR-BI has been implicated in intestinal cholesterol absorption [20], these results would be in accordance with the proximal absorption of dietary cholesterol, as reported by Arnesjö et al. [43] and Borgström [44] in humans. However, other reports [45-47] indicate absorption along the whole length of the intestine. Our RT-PCR data confirmed the more proximal expression of SR-BI, since steady state mRNA levels of SR-BI were approximately three times higher in the proximal than in the distal parts. Intestinal SR-BI protein levels were reduced in both bile-deficient rat models, suggesting that bile components play a role in the regulation of intestinal SR-BI expression. The decrease was more pronounced in the total membrane fractions of bile-diverted rats than in brush border membrane fractions, which may indicate altered sorting of SR-BI in the intestinal cells, i.e., an accellerated recruitment of cellular SR-BI towards the apical membrane in the bile diverted rats. Confocal microscopy suggested that, in addition to the apical membrane, SR-BI i s also present intracellularly in enterocytes of control rats. Data presented in Figure 5 demonstrated that SR-BI down-regulation i s exerted at a post-transcriptional level in bile-diverted rats, while in bile duct-ligated rats transcriptional events may contribute (Figure 5 and 6). Accumulation of bile components and/or cholesterol in the plasma could play a role in alternative regulation of SR-BI protein in the intestine of bile duct-ligated animals. This hypothesis is consistent with the finding that mRNA levels of HMGR are decreased in the intestine of bile duct-ligated animals. Accumulation of cholesterol in plasma and liver of cholesterol-fed rats has been shown to be associated with a decrease of hepatic SR-BI protein levels [48,49]. However, total cholesterol content in the intestine from the different animal models revealed no differences, indicating that intestinal cholesterol accumulation is not required to down-regulate SR-BI expression in these bile-manipulated rodent models. In the rat models used we could not distinguish which of the bile components contribute to regulation of SR-BI in the intestine. To further investigate this issue, we determined intestinal SR-BI protein levels and mRNA levels in mdr2 P-glycoprotein-deficient mice. Results show that absence of biliary phospholipids and cholesterol reduces the protein levels of SR-BI in the intestine to a similar extent as seen in the bile-diverted rats without affecting steady SR-BI mRNA levels. Together, these results indicate that specifically the biliary lipids are specifically involved in the post-transcriptional regulation of SR-BI expression in the intestine. Further research, including intestinal infusion of bile components into bile-diverted rats, will give more insight in the specific role of bile components in the regulation of SR-BI in the intestine. 132

Physiological functions of biliary lipid secretion

Intestinal cholesterol absorption was strongly decreased in both rat models with deficient bile delivery. At first sight, these data would support a relationship between the intestinal SR-BI protein levels and cholesterol absorption efficiency a s suggested by Hauser et al. [20]. Data from Hauser et al. indicate that SR-BI protein would account for approximately 50% of the uptake of cholesterol, in brush border membrane vesicles, with a remaining ~ 50% accounted for by ‘passive diffusion’. In bile duct-ligated animals and bile-diverted animals no bile is present in the intestine leading to complete absence of cholesterol solubilisation vehicles [7,12]. Protein levels of SR-BI are below detection limits in bile duct-ligated rats while in bile-diverted rats protein levels are only reduced by ~50%. Cholesterol absorption is decreased by > 95% in both models. These results suggest that absence of bile in the intestine mainly accounts for the strongly decreased intestinal cholesterol (-/-) absorption. In Mdr2 mice, with no biliary phospholipid and cholesterol delivery into the intestine, cholesterol absorption was down by ~50% and protein levels of SR-BI were reduced by ~40%. In contrast, both bile duct-ligated (DM Minich, Thesis, University of Groningen, 1999) and bile-diverted rats [50] absorb up to 60% of dietary fats (non cholesterol fats) while control rats absorb ~ 92% of their dietary (-/-) mice are capable to absorb > 95% of their dietary fat [51,52]. fats [50]. Mdr2 Thus, these results do not rule out a role of intestinal SR-BI in absorption of dietary cholesterol but, at the same time, indicate that a role in dietary lipid absorption, a s also suggested by Hauser et al. [20], is highly unlikely. In conclusion, we demonstrated the presence of SR-BI in the intestinal apical membrane of enterocytes of rats and mice and a reduction of SR-BI protein levels in two independent rat models and a mouse model of cholesterol malabsorption characterized by the absence of bile in the intestinal lumen and in a mouse model with cholesterol malabsorption due to the absence of biliary lipid secretion. Our data suggests that biliary lipids play may a role in the posttranscriptional regulation of SR-BI, which could include accelerated breakdown of the protein and/or lower translation efficiency. Under cholestatic conditions (bile duct-ligated rats and mice) accumulation of cholesterol in plasma may lead to transcriptional down-regulation of intestinal SR-BI expression. It should be noted, however, that the precise role of SR-BI in cholesterol absorption remains to be defined. The recently generated SR-BI knockout mouse [53] provides the model of choice to address this issue.

REFERENCES 1. Dietschy JM, Turley SD, Spady DK. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res 1993;34:1637-1659. 2. Jones PJH. Regulation of cholesterol biosynthesis by diet in humans. Am J Clin Nutr 1997;66:438-446. 3. Tso P, Balint JA. Formation and transport of chylomicrons by enterocytes to the lymphatics. Am J Physiol 1986;250:G715-26. 4. Wilson MD, Rudel LL. Review of cholesterol absorption with emphasis on dietary and biliary cholesterol. J Lipid Res 1994;35:943-955. 5. Cooper AD. Hepatic uptake of chylomicron remnants. J Lipid Res 1997;38:2173-2192. 6. Swell L, Trout EC, Hopper JJR, Field, Jr., Treadwell CR. Specific function of bile salts i n cholesterol absorption. Proc Soc Exp Biol Med 1958;98:174-176. 7. Westergaard H, Dietschy JM. The mechanism whereby bile acids micelles increase the rate of fatty acid and cholesterol uptake into the intestinal mucosal cell. J Clin Invest 1976;58:97108.

133

Chapter 9: Regulation of intestinal SR-BI 8. Carey MC, Hernell O. Digestion and absorption of fat. Semin Gastroint Dis 1992;3:189208.(Abstract) 9. Tso P. Intestinal lipid absorption. In: Johnson LR, ed. Physiology of the Gastrointestinal Tract. 3rd Ed. New York: Raven Press, 1987:1867-1907. 10. Staggers JE, Hernell O, Stafford RJ, Carey MC. Physical-chemical behaviour of dietary and biliary lipids during intestinal digestion and absorption: 1. Phase behaviour and aggregation states of model lipid systems patterned after aqueous duodenal contents of healthy adult human beings. Biochemistry 1990;29:2028-2040. 11. Hernell O, Staggers JE, Carey MC. Physical-chemical behavior of dietary and biliary lipids during intestinal digestion and absorption. 2. Phase analysis and aggregation states of luminal lipids during duodenal fat digestion in healthy adult human beings. Biochemistry 1990;29:2041-2056. 12. Siperstein MD, Chaikoff IL, Reinhardt WO. C14-cholesterol: Obligatory function of bile i n intestinal absorption of cholesterol. J Biol Chem 1952;198:111-114. 13. Simmonds WJ, Hofmann AF, Theodor E. Absorption of cholesterol from a micellar solution: intestinal perfusion studies in man. J Clin Invest 1967;46:874-890. 14. Hofmann AF, Yeoh VJ. The relationship between concentration and uptake by rat small intestine, in vitro, for two micellar solutes. Biochim Biophys Acta 1971;233:49-52. 15. Thornton AG, Vahouny GV, Treadwell CR. Absorption of lipids from mixed micellar bile salt solutions. Proc Natl Acad Sci U S A 1968;127:629-632. 16. Sehayek E, Ono JG, Shefer S, Nguyen LB, Wang N, Batta AK, Salen G, Smith JD, Tall AR, Breslow JL. Biliary cholesterol excretion: A novel mechanism that regulates dietary cholesterol absorption. Proc Natl Acad Sci U S A 1998;95:10194-10199. 17. Westergaard H, Dietschy JM. Delineation of the dimensions and permeability characteristics of the two major diffusion barriers to passive mucosal uptake in the rabbit intestine. J Clin Invest 1974;54:718-732. 18. Thurnhofer H, Schnabel J, Betz M, Lipka G, Pidgeon C, Hauser H. Cholesterol-transfer protein located in the intestinal brush-border membrane. Partial purification and characterization. Biochim Biophys Acta 1991;1064:275-286. 19. Landschulz KT, Pathak RK, Rigotti A, Krieger M, Hobbs HH. Regulation of scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroidogenic tissues of the rat. J Clin Invest 1996;98:984-995. 20. Hauser H, Dyer JH, Nandy A, Vega MA, Werder M, Bieliauskaite E, Weber FE, Compassi S, Gemperli A, Boffelli D, Wehrli E, Schulthess G, Phillips MC. Identification of a receptor mediated absorption of dietary cholesterol in the intestine. Biochemistry 1998;37:17843-17850. 21. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor [see comments]. Science 1996;271:518520. 22. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 1997;387:414417. 23. Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M, Williams DL. Scavenger receptor class B, type I (SR-BI) is the major route for the delivery of high density lipoprotein cholesterol to the steroidogenic pathway in cultured mouse adrenocortical cells. Proc Natl Acad Sci U S A 1997;94:13600-13605. 24. Xu S, Laccotripe M, Huang X, Rigotti A, Zannis VI, Krieger M. Apolipoproteins of HDL can directly mediate binding to the scavenger receptor SR-BI, an HDL receptor that mediates selective lipid uptake. J Lipid Res 1997;38:1289-1298. 25. Stangl H, Cao G, Wyne KL, Hobbs HH. Scavenger receptor, class B, tupe I-dependent stimulation of cholesterol estrification by high density lipoproteins, low density lipoprpteins, and nonlipoproteins cholesterol. J Biol Chem 1998;273:31002-31008. 26. Llera-Moya Md, Rothblat GH, Connelly MA, Kellner-Weibel G, Sakr SW, Phillips MC, Williams DL. Scavenger receptor BI (SR-BI) mediates free cholesterol flux independently of HDL tethering to the cell surface. J Biol Chem 1999;40:575-580. 27. Ritland S, Bergan A. Plasma concentration of lipoprotein-X (LP-X) in experimental bile duct obstruction. Scand J Gastroenterol 1975;10:17-24. 28. Calandra S. The relation between plasma cholesterol and cholesterol synthesis in rats with experimental biliary obstruction. Eur J Clin Invest 1973;3:385-390. 29. Elferink RP, Ottenhoff R, van Marle J, Frijters CM, Smith AJ, Groen AK. Class III Pglycoproteins mediate the formation of lipoprotein X in the mouse. J Clin Invest 1998;102:1749-1757. 30. Kuipers F, Havinga R, Bosschieter H, Toorop GP, Hindriks FR, Vonk RJ. Enterohepatic circulation in the rat. Gastroenterology 1985;88:403-411.

134

Physiological functions of biliary lipid secretion 31. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA, van der Valk MA, Offerhaus GJA, Berns AJM, Borst P. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462. 32. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38. 33. Schmitz J, Preiser H, Maestracci D, Ghosh BK, Cerda JJ, Crane RK. Purification of the human intestinal brush border membrane. Biochim Biophys Acta 1973;323:98-112. 34. Keeffe EB, Scharschmidt BF, Blankenship NM, Ockner RK. Studies of relationships among bile flow, liver plasma membrane NaK-ATPase, and membrane microviscosity in the rat. J Clin Invest 1979;64:1590-1598. 35. Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HMG, Oude Elferink RPJ, Groen AK, Kuipers F. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-glycoprotein-deficient mice. Gastroenterology 1998;114:1024-1034. 36. Zilversmit DB, Hughes LB. Validation of a dual-isotope plasma ratio method for measurment of cholesterol absorption in rats. J Lipid Res 1974;15:465-473.(Abstract) 37. Turley SD, Herndon MW, Dietschy JM. Reevaluation and application of the dual-isotope plasma ratio method for the measurement of intestinal cholesterol absorption in the hamster. J Lipid Res 1994;35:328-339. 38. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the folin reagens. J Biol Chem 1951;193:265-275.(Abstract) 39. Froyland L, Asiedu DK, Vaagenes H, Garras A, Lie O, Totland GK, Berge RK. Tetradecylthioacetic acid incorporated into very low density lipoprotein: Changes in the fatty acid composition and reduced plasma lipids in cholesterol-fed hamsters. J Lipid Res 1995;36:2529-2540. 40. Rule DC, Liebman M, Liang YB. Impact of different dietary fatty acids on plasma and liver lipids is influenced by dietary cholesterol in rats. J Nutr Biochem 1996;7:142-149. 41. Dawson-Saunders B, Trapp RG. Basic and clinical biostatistics. International Ed. Englewoods Cliffs NJ: Prentice Hall, 1990: 42. Koopen NR, Wolters H, Voshol PJ, Stieger B, Vonk RJ, Meier PJ, Kuipers F, Hagenbuch B. + + Decreased Na -dependent taurocholate uptake and low expression of the sinoidal Na taurocholate cotransporting protein (Ntcp) in livers of mdr2 P-glycoprotein-deficient mice. J Hepatol 1999;30:14-21. 43. Arnesjö B, Nilsson A, Barrowman J, Borgström B. Intestinal digestion and absorption of cholesterol and lecithin in the human. Scand J Gastroenterol 1969;4:653-665. 44. Borgström B. Studies on intestinal cholesterol absorption in the human. J Clin Invest 1960;39:809-815. 45. Byers SO, Friedman M, Gunning B. Observations concerning the production and excretion of cholesterol in mammalsXI. The intestinal site of absorption and excretion of cholesterol. Am J Physiol 1953;175:375-379. 46. Feldman EB, Henderson DH. Cholesterol absorption by jejunum and ileum. Biochim Biophys Acta 1969;193:221-224. 47. McIntyre N, Kirsch K, Orr JC, Isselbacher KL. Sterols in the small intestine of the rat, guinea pig and rabbit. J Lipid Res 1971;12:336-346. 48. Fluiter K, Sattler W, De Beer MC, Connell PM, van der Westhuyzen DR, Van Berkel TJ. Scavenger receptor BI mediates the selective uptake of oxidized cholesterol esters by rat liver. J Biol Chem 1999;274:8893-8899. 49. Fluiter K, van der Westhuijzen DR, Van Berkel TJ. In vivo regulation of scavenger receptor BI and the selective uptake of high density lipoprotein cholesteryl esters in rat liver parenchymal and Kupffer cells. J Biol Chem 1998;273:8434-8438. 50. Minich DM, Kalivianakis M, Havinga R, van Goor H, Stellaard F, Vonk RJ, Kuipers F, Verkade HJ. Bile diversion in rats leads to a decreased plasma concentration of linoleic acid which is not due to decreased net intestinal absorption of dietary linoleic acid. Biochim Biophys Acta 1999;1438:111-119. 51. Minich DM, Voshol PJ, Havinga R, Stellaard F, Kuipers F, Vonk RJ, Verkade HJ. Biliary phospholipid secretion is not required for intestinal absorption and plasma status of linoleic acid in mice. Biochim Biophys Acta 1999;1441:14-22. 52. Voshol PJ, Minich DM, Havinga R, Oude Elferink RPJ, Verkade HJ, Groen AK, Kuipers F. Postprandial chylomicron formation and fat absorption in multidrug resistance gene-2 Pglycoprotein-deficient mice. Gastroenterology 2000;118:173-182. 53. Rigotti A, Trigatti BL, Penman M, Rayburn H, Herz J, Krieger M. A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl Acad Sci USA 1997;94:12610-12615.

135

Chapter 9: Regulation of intestinal SR-BI

136

CHAPTER 10 GENERAL DISCUSSION

Chapter 10: General discussion

This thesis deals with the physiological role of biliary lipid secretion in the maintenance of cholesterol homeostasis in the body. The liver plays a central role in cholesterol metabolism, participating in synthesis, redistribution and catabolism of the sterol. Biliary secretion of bile salts, cholesterol and phospholipids reflects one of the distinct functions of the liver that is crucial for several of these aspects. Under normal physiological circumstances, biliary bile salt secretion drives biliary cholesterol/phospholipid secretion (chapter 1). The generation of mdr2 P(-/-) glycoprotein-deficient (Mdr2 ) mice made it possible to evaluate the physiological functions of biliary lipids in the in vivo situation, since these mice show absence of biliary phospholipid secretion, a strongly impaired biliary cholesterol secretion, but unaffected biliary bile salt secretion. The results of studies described in this thesis show that the hepatobiliary flux of cholesterol (and phospholipids) into the intestine is of key importance in the regulation of whole body cholesterol homeostasis; its relevance goes far beyond the long-known function of bile in removal of excess cholesterol from the body. (-/-) mice is associated with an 1. The absence of biliary lipid secretion in Mdr2 increased fecal cholesterol secretion (chapter 2). This is paradoxical in view of the fact that, under normal conditions, bile delivers far more cholesterol to the intestine than dietary intake does (chapter 1), particularly in mice fed standard (-/-) mice low-cholesterol chow. The increased fecal cholesterol content in Mdr2 must be derived from the diet or from the intestine itself. Similar observations were made in our laboratory in rats with a permanent bile fistula, that also showed a increased fecal cholesterol excretion [1], i.e., by a factor of 2 (-/-) mice. Although intestinal cholesterol compared to a factor of 4 in Mdr2 (-/-) absorption is decreased in Mdr2 mice by ~50% (chapter 2, 9), the contribution of dietary cholesterol could not account for the strong increase in fecal sterols observed. It is most likely that intestinal cholesterol biosynthesis is derepressed due to the absence of biliary cholesterol delivery to the intestine [2]. The finding that intestinal mRNA levels of HMG-CoA reductase are markedly increased in rats with a permanent bile fistula (chapter 9) confirms this hypothesis. An accelerated desquamation of enterocytes due to the exposure to (-/-) mice may also contribute to the increase in fecal lipid-free bile in Mdr2 cholesterol. Changes in intestinal cholesterol synthesis do not necessarily reflect in plasma cholesterol kinetics, as shown by compartimental analysis of the decay of labeled cholesterol (Chapter 2). (-/-) 2. Plasma HDL-cholesterol levels are strongly decreased in Mdr2 mice (chapter 2). Low HDL levels could be due to reduced formation of nascent HDL particles, to impaired conversion of nascent HDL into mature particles or to increased clearance from the circulation. Steady state mRNA levels of apolipoprotein A-I, the major apolipoprotein constituent of HDL, in both liver (chapter 2) and intestine (relative ratio apoA-I mRNA to 28S mRNA 1.0 ± 0.5 versus 1.0 ± 0.6, for (-/-) mice, respectively) did not differ between Mdr2(-/-) and control and Mdr2 control mice. Reduced intestinal cholesterol absorption (chapter 2) and/or the impaired chylomicron formation (chapter 7) might contribute to low HDL, because chylomicrons provide surface material needed for formation of mature HDL particles from nascent HDL particles [3]. The absence of mdr2 Pgpdependent biliary secretion of cholesterol/phospholipids in itself, and not the presence of these lipids in the intestine is crucial for the observed decrease of (-/-) plasma HDL in Mdr2 mice, since dietary supplementation of excess bile-type 138

Physiological fuctions of biliary lipid secretion

phospholipids and/or cholesterol did not lead to increased plasma cholesterol or HDL levels (chapter 3). Recently, mutations in the gene encoding the ATPbinding Cassette transporter ABC-1 are shown to be involved in the phenotype of Tangier disease, characterized by absence of HDL, and familial HDLdeficiency [4-6]. It may be that alterations in ABC-1 expression contribute to the (-/-) mice. Preliminary studies showed no low HDL levels found in Mdr2 (-/-) mice (P.J. Voshol, differences in ABC-1 expression in the intestine of Mdr2 personal observations, 1999), but expression in other organs may well be affected. Furthermore, a novel gene of the ABC superfamily, ABC-8, was found to be involved in regulation of macrophage cholesterol and phospholipid transport [7], demonstrating the possibility of more novel genes to be involved in HDL metabolism. In addition, altered kinetic behavior of HDL due to alterations in expression of the HDL receptor, SR-BI [8], could contribute to the low HDL (-/-) levels found in Mdr2 mice [9]. Data showed that hepatic protein expression of SR-BI indeed is increased in these mice (chapter 3). Also hepatic lipase activity (-/-) mice (chapter 4). Hepatic lipase has been shown to is increased in Mdr2 facilitate HDL-cholesterol ester uptake via SR-BI in the liver and to reduce plasma HDL levels [10]. These (preliminary) data suggest that the HDL kinetics (-/-) mice and further investigations are needed to might be altered in Mdr2 resolve this issue. Hepatic VLDL, apoB100 and apoB48 production are (-/-) mice when compared to controls (chapter 4), increased in vivo in the Mdr2 while mRNA levels of apoB, apoB mRNA editing activity and microsomal triglyceride transfer protein (MTP) did not differ between the two groups. The capacity of phosphatidylcholine synthesis, essential for VLDL production [11] (-/-) did not seem to differ between Mdr2 and control mice, since activities of CDPcholine transferase and phosphatidylethanolamine N-methyltransferase, two key-enzymes in phosphatidylcholine biosynthesis [12], were similar in both groups. Increased activities of HMG-CoA reductase and ACAT (chapter 2) may contribute to the observed 4-fold increase in hepatic VLDL-cholesterol (-/-) production (chapter 4) in Mdr2 mice and, in fact, to increased VLDL formation per se [13,14]. The de-repressed activity of both enzymes is probably due to the absence of chylomicron cholesterol-mediated down-regulation of these enzymes (chapter 7) [15]. The fractional turnover rate of apoB100 did not differ (-/-) mice, while the fractional turnover rate of apoB48 was increased in Mdr2 suggesting altered handling of apoB100- and apoB48-containing VLDL particles resulting in the observed increased fasting plasma apoB100 levels in (-/-) Mdr2 mice whereas fasting apoB48 and triglycerides levels were not different from those in control mice. 3. The absence of biliary lipid secretion leads to bile duct proliferation [16] and i s associated with decreased Ntcp expression (chapter 5) in the liver and increased abst expression in liver (cholangiocytes) and intestine (chapter 6) of (-/-) Mdr2 mice. Abst expression in cholangiocytes of the liver is hypothesized to be involved in intrahepatic shunting of bile salts, especially in cholestatic conditions [17]. The increased expression of abst and decreased expression of Ntcp probably reflect compensatory reactions of bile salt transport functions in reaction to the formation of lipid-free bile. Although the total bile salt pool i s (-/-) mice, the pool size and fractional turnover rate of the increased in Mdr2 (-/-) primary, relative hydrophobic, bile salt cholate did not differ between Mdr2 and (-/-) control mice. It seems that in Mdr2 mice the relative hydrophilic bile salts are 139

Chapter 10: General discussion

more efficiently maintained in the enterohepatic circulation. Substrate specificity (-/-) analysis showed that muricholates, the major bile salts in Mdr2 mice, do not have a higher affinity for abst than more hydrophobic bile salts like taurocholate [18], implying that other factors must be involved. Despite the increased total bile salt pool size, the synthesis of the primary bile salt cholate appeared not to (-/-) (-/-) be affected in Mdr2 mice. The more hydrophilic bile salt pool of Mdr2 mice (chapter 6) is apparently less potent in activating the newly identified bile salt receptor FXR [19] and thereby less effective in repressing cholesterol 7αhydroxylase. 4. Absence of biliary lipids is associated with changes in the kinetics of fat (-/-) mice absorption. Chylomicron formation is strongly impaired in the Mdr2 (chapter 7). Bile type phospholipids have been shown to stimulate secretion of apoB-containing particles in rats with a permanent bile fistula [20] and in CaCo2 cells [21]. Surprisingly, total fat (chapter 7) and essential fatty acid (chapter 8) absorption appeared to be normal while cholesterol absorption was strongly (-/-) impaired (chapter 2) in Mdr2 mice, indicating that separate mechanisms are involved in both absorption processes. The increased bile salt pool size (-/-) (chapter 6) could contribute to the relatively efficient fat absorption in Mdr2 mice [22]. Alternatively, absorption may shift from proximal to more distal parts 3 of the intestine: both H-triolein kinetic studies and histochemistry data showed (-/-) accumulation of fat in more distal parts of intestine of Mdr2 mice (chapter 7). In addition, limited absorption of free fatty acids via the portal system may occur [23]. The HDL receptor, SR-BI, is expressed in the intestinal cells of rabbits and has been suggested to play a role in intestinal cholesterol absorption [24]. SRBI is also present in the apical membrane of rat and mice and is shown to be down-regulated in bile-deficient states (bile diversion and bile duct-ligation) and (-/-) in Mdr2 mice (chapter 9). Complete absence of bile (diversion and bile ductligation) leads to almost complete absence of intestinal cholesterol absorption (chapter 9), while biliary lipid deficiency leads to a 50% reduction of cholesterol absorption efficiency (chapter 2). Thus, these results do not rule out a role of intestinal SR-BI in absorption of dietary cholesterol but the recently generated SR-BI knockout mouse [25] provides the model of choice to definitely pinpoint the role of SR-BI in intestinal cholesterol absorption. Its role in absorption of other fats from the intestine, as proposed by Hauser et al. [24], is highly unlikely since all animal models used absorb 60-95% of their dietary fats (chapter 7, chapter 8, DM Minich, Thesis, University of Groningen, 1999 and [26]). Studies described in this thesis show that bile formation is important in the regulation of plasma levels of anti-atherogenic HDL and atherogenic apoB-containing lipoproteins and thus in the risk of cardiovascular diseases. Absence of biliary lipid secretion is present in all cholestatic liver diseases. Recently, a subtype of progressive intrahepatic cholestasis having a defect in the MDR3 gene (PFIC-3) (-/-) mice, these patients have no biliary [27] was described. Like Mdr2 phospholipid secretion and show similar liver pathology, which may be more severe due to the relatively hydrophobic bile salt pool in humans. Overall, our studies give further insight in the pathophysiological consequences of PFIC-3. In conclusion: bile forms the physiological connection between liver and intestine and serves several important functions in these organs that control plasma lipoprotein concentrations and thus the risk of cardiovascular disease. 140

Physiological fuctions of biliary lipid secretion

References 1. Bandsma RH, Stellaard F, Vonk RJ, Nagel GT, Neese RA, Hellerstein MK, Kuipers F. Contribution of newly synthesized cholesterol to rat plasma and bile determined by mass isotopomer distribution analysis: bile-salt flux promotes secretion of newly synthesized cholesterol into bile. Biochem J 1998;329:699-703. 2. Meijer GW, Smit MJ, Van Der Palen JG, Kuipers F, Vonk RJ, Van Zutphen BF, Beynen AC. Dietary cholesterol-induced down-regulation of intestinal 3-hydroxy-3-methylglutaryl coenzyme A reductase activity is diminished in rabbits with hyperresponse of serum cholesterol to dietary cholesterol. J Nutr 1993;123:695-703. 3. Havel RJ. Postprandial lipid metabolism: an overview. Proc Nutr Soc 1997;56:659-666. 4. Rust S, Rosier M, Funke H, Real J, Amoura Z, Piette JC, Deleuze JF, Brewer HB, Duverger N, Denefle P, Assmann G. Tangier disease is caused by mutations in the gene encoding ATPbinding cassette transporter 1 [see comments]. Nat Genet 1999;22:352-355. 5. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated i n Tangier disease [see comments]. Nat Genet 1999;22:347-351. 6. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency [see comments]. Nat Genet 1999;22:336-345. 7. Stokkers P, van den Berg M, Buller H, Rings E. Patchy and mosaic protein expression in the small intestine. J Pediatr Gastroenterol Nutr 1994;19:133-135. 8. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science 1996;271:518-520. 9. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 1997;387:414417. 10. Lambert G, Chase M, Dugi KA, Bensadoun A, Bryan Brewer Jr. H, Santamarina Fojo S. Hepatic lipase promotes the selective uptake of high density lipoprotein-cholesteryl esters via the scavenger receptor B1. J Lipid Res 1999;40:1294-1303. 11. Vance DE, Lingrell S, Fast DG, Verkade HJ. Control of Phosphatidylcholine Biosynthesis and its Role in Lipoprotein Assembly. In: Op den Kamp JAF, ed. Dynamics of Membrane Assembly. Berlin: Springer-Verlag, 1992:59-75. 12. Fast DG, Vance DE. Nascent VLDL phospholipid composition is altered when phosphatidylcholine biosynthesis is inhibited: Evidence for a novel mechanism that regulates VLDL secretion. Bba-Lipid Lipid Metab 1995;1258:159-168. 13. Thompson GR, Naoumova RP, Watts GF. Role of cholesterol in regulating apolipoprotein B secretion by the liver. J Lipid Res 1996;37:439-447. 14. Musanti R, Giorgini L, Lovisolo P, Pirillo A, Chiari A, Ghiselli G. Inhibition of acylCoA:cholesterol acyltransferase decreases apolipoprotein B-100-containing lipoprotein secretion from HepG2 cells. J Lipid Res 1996;37:1-14. 15. Nervi FO, Weis HJ, Dietschy JM. The kinetic characteristics of inhibition of hepatic cholesterogenesis by lipoproteins of intestinal origin. J Biol Chem 1975;250:4145-4151. 16. Mauad TH, van Nieuwkerk CM, Dingemans KP, Smit JJ, Schinkel AH, Notenboom RG, van den Bergh Weerman MA, Verkruisen RP, Groen AK, Oude Elferink RP, et al. Mice with homozygous disruption of the mdr2 P-glycoprotein gene. A novel animal model for studies of nonsuppurative inflammatory cholangitis and hepatocarcinogenesis. Am J Pathol 1994;145:1237-1245. 17. Lazaridis KN, Pham L, Tietz P, Marinelli RA, deGroen PC, Levine S, Dawson PA, Larusso NF. Rat cholangiocytes absorb bile acids at their apical domain via the ileal sodium-dependent bile acid transporter. J Clin Invest 1997;100:2714-2721. 18. Kramer W, Stengelin S, Baringhaus KH, Enhsen A, Heuer H, Becker W, Corsiero D, Girbig F, + Noll R, Weyland C. Substrate specificity of the ileal and hepatic Na /bile acid cotransporters of the rabbit. I. Transport studies with membrane vesicles and cell lines expressing the cloned transporters. J Lipid Res 1999;40:1604-1617. 19. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Willson TM, Zavacki AM, Moore DD, Lehmann JM. Bile acids: natural ligands for an orphan nuclear receptor [see comments]. Science 1999;284:1365-1368.

141

Chapter 10: General discussion 20. Tso P, Kendrick H, Balint JA, Simmonds WJ. Role of biliary phosphatidylcholine in the absorption and transport of dietary triolein in the rat. Gastroenterology 1981;80:60-65. 21. Mathur SN, Born E, Murthy S, Field FJ. Phosphatidylcholine increases the secretion of triacylglycerol-rich lipoproteins by CaCo-2 cells. Biochem J 1996;314:569-575. 22. Jolley CD, Dietschy JM, Turley SD. Genetic differences in cholesterol absorption in 129/Sv and C57BL/6 mice: effect on cholesterol responsiveness. Am J Physiol 1999;276:G1117G1124. 23. Mansbach CM, Dowell RF. Portal transport of long acyl chain lipids: effects of phosphatidylcholine and low infusion rates. Am J Physiol 1993;264:G1082-G1089. 24. Hauser H, Dyer JH, Nandy A, Vega MA, Werder M, Bieliauskaite E, Weber FE, Compassi S, Gemperli A, Boffelli D, Wehrli E, Schulthess G, Phillips MC. Identification of a receptor mediated absorption of dietary cholesterol in the intestine. Biochemistry 1998;37:17843-17850. 25. Rigotti A, Trigatti BL, Penman M, Rayburn H, Herz J, Krieger M. A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl Acad Sci USA 1997;94:12610-12615. 26. Minich DM, Kalivianakis M, Havinga R, van Goor H, Stellaard F, Vonk RJ, Kuipers F, Verkade HJ. Bile diversion in rats leads to a decreased plasma concentration of linoleic acid which is not due to decreased net intestinal absorption of dietary linoleic acid. Biochim Biophys Acta 1999;1438:111-119. 27. de Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J, Deleuze JF, Desrochers M, Burdelski M, Bernard O, Oude Elferink RP, Hadchouel M. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci U S A 1998;95:282-287.

142

Physiological functions of biliary lipid secretion

SUMMARY

The liver plays an central role in maintenance of cholesterol homeostasis. I: The liver is involved in the regulation of blood cholesterol levels via the uptake and secretion of cholesterol-containing lipoproteins and by synthesis of proteins involved in lipoprotein metabolism. II: The liver is capable to synthese cholesterol in relatively large amounts: the amount of newly synthesized cholesterol i s considerable larger than the amount taken up via the diet. III: The liver is the only organ capable to remove excess cholesterol from the body, namely via secretion into bile. Biliary secretion occurs either as free cholesterol or after conversion to bile salts: in both forms cholesterol eventually ends up in the feces. Earlier research from our laboratory showed that bile and bile formation, in addition to this secretory role has important other functions in the maintenance of cholesterol homeostasis. Except for cholesterol and bile salts, bile contains high concentrations of phospholipids. The amount of phospholipids and cholesterol secreted via the bile into the intestine is much larger than the amount that i s entering via the diet. Almost all of the biliary phospholipids and ~60% of the biliary cholesterol is reabsorbed from the intestine. Biliary phospholipids exert several important functions in the body. In the bile phospholipids, cholesterol and bile salts form so-called mixed micelles and protect, thereby, the cells lining the biliary tree against the detergent action of bile salts. Furthermore, biliary phospholipids are suggested to exert a specific function in the intestinal lipid absorption. Since biliary lipid secretion is strongly coupled to that of bile salts, is has been extremely difficult to examine the specific functions of biliary lipids independently from those of the biliary bile salts. Recent insights in the bile formation process and the transporter proteins involved herein made it possible to address this issue in a direct manner. The Mdr2 gene product, mdr2 P-glycoprotein, has been found to act as a phosholipid translocator involved in flipping of bile-specific (i.e. phosphatidylcholine) phospholipids from the inner to the outer leaflet of the canalicular membrane. This step is essential for biliary secretion of phospholipids. In 1993 the Netherlands Cancer Research Institute in Amsterdam (-/-) developed mdr2 Pgp-deficient (Mdr2 ) mice by means of homologous (-/-) recombination. Mdr2 mice showed complete absence of phospholipid secretion into bile and since biliary cholesterol secretion is strongly coupled to that of phospholipids, also an impaired biliary cholesterol secretion (-98%). Biliary bile (-/-) mouse made it salt secretion appeared normal in these mice. The Mdr2 possible to examine specifically the pathophysiological consequences of absence of biliary lipid secretion. The research described in this thesis deals with the physiological role of biliary lipids in the regulation of the cholesterol levels in blood, bile salt metabolism and intestinal fat absorption processes. 143

Summary

Chapter 1 gives an overview of hepatic cholesterol and bile salt metabolism and of plasma lipoprotein metabolism. Recent knowledge on bile formation and biliary lipid secretion is addressed in detail and the scope of the studies i s described in this chapter. Chapter 2 deals with the effects of absent biliary lipid secretion on hepatic and plasma lipoprotein metabolism. No differences in hepatic cholesterol(ester), (-/-) mice and phospholipid or triglycerides content were observed between Mdr2 control mice. Plasma HDL-cholesterol and apolipoprotein A-I levels were strongly (-/-) mice, while apolipoprotein B contents in the VLDL and LDL reduced in Mdr2 fractions were increased. The activity of hepatic HMG-CoA reductase, the key enzyme in the biosynthesis of cholesterol, was increased. Cholesterol absorption (-/-) mice and fecal neutral sterol loss was was reduced by ~50% in Mdr2 approximately 4-fold increased. This last result implies that total body cholesterol biosynthesis is increased, a phenomenon in which the intestinal tract has an important role. To examine whether this plasma phenotype could be (partially) normalized by dietary manipulation, phospholipids and cholesterol were added to the diets of mice. Dietary supplementation of phospholipids and/or cholesterol had no effect (-/-) on plasma cholesterol and/or triglycerides levels in the Mdr2 mice (Chapter 3). It seems that biliary secretion of these lipids has a specific role which can not be replaced by the presence of an excess of these lipids in the intestine. Addition of cholesterol to the diet appeared to lead to a ‘cholestasic’ picture in the knockout mice based on increased plasma bile salt and bilirubin levels, especially in (-/-) female Mdr2 mice . Despite the markedly increased plasma levels of bile salts and bilirubin no changes in bile flow, biliary bile salt or bilirubin secretion were (-/-) mice, but the expression of transporter observed in cholesterol-fed Mdr2 proteins involved in hepatic uptake of bile salts were decreased. The liver has a role in the secretion of cholesterol into bile as well as into the circulation. Cholesterol is packed in so-called VLDL particles that are secreted into the circulation. The hepatobiliary lipid flux it thought to be an important regulator of hepatic VLDL secretion. VLDL particles are secreted to supply peripheral tissue with energy-rich substrates during fasting. Beside cholesterol(esters) these particles contain triglycerides and are the precursors of the atherogenic LDL particles. Several factors (e.g., insulin, cholesterol synthesis, phospholipid synthesis) are involved in the regulation of VLDL secretion. Absence of biliary lipid (-/-) secretion led to an altered VLDL particle secretion in the Mdr2 mice (Chapter 4). (-/-) mice were larger and The VLDL particles isolated from plasma of Mdr2 contained more triglycerides than the VLDL particles isolated from control mice. Under steady state conditions plasma triglyceride levels were similar and plasma (-/-) apolipoprotein B levels were in Mdr2 mice compared to controls, indicating that triglycerides are rapidly cleared in these mice. 144

Physiological functions of biliary lipid secretion

Bile salts play an important role in the regulation of cholesterol metabolism. After secretion in bile, bile salt are efficiently reabsorbed from the intestine and rapidly transported back to the liver. This so-called enterohepatic circulation depends on the presence of specific transporter proteins for hepatic uptake (Sodium-dependent taurocholate co-transporting protein, Ntcp), secretion into bile (bile salt export pump, bsep) and reabsorption from the intestine (apical sodiumdependent bile salt transporter, abst). Plasma bile salt concentration are (-/-) mice, also on a low-cholesterol diet. Sodium-dependent increased in Mdr2 (-/-) mice uptake and protein levels of Ntcp were decreased in livers from Mdr2 compared to controls (Chapter 5). No differences in steady state mRNA levels were observed between the two mouse stains indicating that Ntcp is down(-/-) regulated at a posttranscriptional level in Mdr2 mice. The absence of biliary lipid secretion, leading to the bile duct proliferation in (-/-) mice, is associated with an increased protein expression of the apical Mdr2 sodium-dependent bile salt transporter (abst) in the liver as well as in the intestine (-/-) of Mdr2 mice (Chapter 6). Hepatic expression of abst was limited to the cells lining the biliary tree, the cholangiocytes. The increased expression of abst was associated with a 70% increase of total bile salt pool size. No changes in pool size, fractional turnover rate and synthesis rate of the primary, relatively hydrophobic bile salt cholate were observed, indicating that more hydrophilic bile (-/-) salt species present in the bile of Mdr2 mice is more efficiently maintained in the enterohepatic circulation. The last chapters of this thesis deal with the effects of absence of biliary lipid secretion on intestinal fat and cholesterol absorption processes. Chylomicron (-/-) mice compared to control formation and secretion was impaired in the Mdr2 (-/-) mice (Chapter 7). After infusion of complete rat bile into the intestine of Mdr2 mice chylomicron secretion could be partly restored. The results show that ingested fat is able to enter the enterocytes where it appears to accumulate. Interestingly, total fat absorption, determined by a 72 h fat-balance, was not (-/-) mice. Mdr2(-/-) mice may compensate the impaired affected in the Mdr2 chylomicron formation by using a longer part of the intestine in this absorption process during a longer time span: accumulation of fat was mainly in the distal parts of the intestine. Alternatively, direct transport of fatty acids via the portal vein to the liver may take place. The absence of biliary lipid secretion led to delayed plasma appearance of (-/-) mice linoleic acid, but again total linoleic absorption was not altered in Mdr2 when compared to control mice (chapter 8). The linoleic acid status in liver and (-/-) mice and control mice. The results of plasma did not differ between Mdr2 Chapter 7 and 8 clearly show that biliary lipid secretion is important in the kinetics of chylomicron formation and secretion but seems of less importance for overall fat absorption efficiency. 145

Summary

Recent data from literature indicated that biliary cholesterol regulates the absorption of dietary cholesterol from the intestine. SR-BI, the HDL receptor, was shown to be present in the intestine of rabbits and was thought to play a role in the intestinal cholesterol absorption. SR-BI was found to be present in the apical membrane of rat and mouse enterocytes and more abundant in proximal than in distal parts of the intestine (Chapter 9). In bile duct-ligated animals, experiencing absence of bile from the intestine and cholestasis, protein levels of SR-BI were virtually absent. Bile-diverted rats, also experiencing absence of bile from the (-/-) mice showed decreased protein intestine but without cholestasis, and Mdr2 levels of SR-BI in their intestines. All animal models used in this study showed a strongly impaired intestinal cholesterol absorption. These studies indicate that biliary lipids are important in the regulation of intestinal SR-BI expression. The exact role of SR-BI in intestinal cholesterol absorption, however, remains to be established. The results of studies described in this thesis show that the hepatobiliary flux of cholesterol (and phospholipids) into the intestine is important in the regulation of whole body cholesterol homeostasis that goes for beyond its long-known function in removal of excess cholesterol from the body. 1. The absence of biliary lipid secretion is associated with an increased fecal cholesterol secretion. This is paradoxaal in view of the fact the biliary delivery of cholesterol exceeds dietary intake by at least a factor 2. Rats with a permanent bile fistula also show a strongly increased fecal cholesterol secretion. Intestinal cholesterol biosynthesis is probably enhanced due to the absence of biliary lipid delivery, supported by the fact that intestinal mRNA levels of HMG-CoA reductase in bile-diverted rats were markedly increased (Chapter 9). Kinetic studies show that changes in intestinal cholesterol synthesis do not necesarily reflec in the plasma cholesterol kinetics. (Chapter 3). (-/-) mice. Low 2. Plasma HDL-cholesterol levels are strongly decreased in Mdr2 HDL levels in humans are associated with a higher risk for cardiovascular diseases. The impaired chylomicron secretion could in part explain the low HDL (-/-) levels found in the Mdr2 mice, since chylomicrons provides surface material needed for HDL formation. Other effects may contribute to this, e.g., alterations in HDL kinetics. Hepatic VLDL and apoB secretion are increased in the in vivo situation, contributing to the high apoB levels found in the VLDL and LDL (-/-) fractions of Mdr2 mice. Both increased VLDL and LDL levels are associated with higher risk for cardiovascular diseases in humans. 3. The absence of biliary lipid secretion leads to bile duct proliferation and increased expression of abst in liver and intestine and to decreased Ntcp (-/-) mice and is associated with increased total expression in the liver of Mdr2 plasma bile salt concentrations and an increased bile salt pool size. Both the 146

Physiological functions of biliary lipid secretion

increased expression of abst and decreased expression of Ntcp probably reflect compensatory reactions on bile salt transport functions in reaction to the formation of lipid-free bile. The increased protein levels of abst in proliferating bile ducts seems to be associated with cholehepatic shunting, leading to higher (-/-) choleretic activity in Mdr2 mice. 4. Absence of biliary lipid is associated with changes in the kinetics of fat (-/-) mice absorption. Chylomicron formation is strongly impaired in the Mdr2 while total fat absorption is normal. Cholesterol absorption is strongly decreased in the knockouts, indicating that separate mechanisms are involved in both absorption processes. This knowledge is of importance is the development of cholesterol-lowering therapies based on selective blockade of the intestinal cholesterol absorption process. The increased bile salt pool (see (-/-) above) in the Mdr2 mice may contribute to the efficient fat absorption. Bile forms the physiological connection between the liver and the intestine, and i s an important factor in these organs that control plasma lipoprotein concentrations and thus the risk of cardiovascular disease.

147

Summary

148

Physiological functions of biliary lipid secretion

SAMENVATTING

De lever neemt een centrale plaats in in de regulering van de cholesterol huishouding. I: De lever speelt een belangrijke rol in de handhaving van het cholesterol gehalte in het bloed via de opname uit en uitscheiding naar het bloed van cholesterol-bevattende lipoproteinen en via de aanmaak van enzymen die het lipoproteinen metabolisme in de circulatie beïnvloeden. II: De lever maakt cholesterol in relatief grote hoeveelheden aan: de aanmaak van cholesterol in het lichaam is aanzienlijk groter dan de inname via de voeding. III: De lever is het enige orgaan dat in staat is cholesterol uit het lichaam te verwijderen in kwantitatief belangrijke hoeveelheden, namelijk via de uitscheiding in de gal. De uitscheiding vindt plaats in de vorm van vrij cholesterol of na omzetting van cholesterol in galzouten: in beide vormen verlaat het cholesterol uiteindelijk het lichaam via de faeces. Onder andere uit eerdere studies in ons laboratorium i s gebleken dat, naast de genoemde uitscheidingsfunctie, gal en het galvormingsproces op zich van belang zijn in de regulering van het cholesterol metabolisme op de verschillende niveaus in het lichaam. Gal bevat behalve cholesterol en galzouten ook hoge concentraties fosfolipiden. De hoeveelheid cholesterol en fosfolipiden die per dag via de gal in de darm wordt uitgescheiden is vele malen groter dan de hoeveelheid die via de voeding de darm binnenkomt. Bijna alle gal fosfolipiden en ongeveer 60% van het gal cholesterol worden heropgenomen uit de darm. Gal fosfolipiden hebben verschillende belangrijke taken. In de gal vormen fosfolipiden en cholesterol samen met galzouten “gemengde micellen” en beschermen op deze wijze de cellen die langs de galgangen liggen tegen de detergerende werking van de galzouten. Bovendien i s gesuggereerd dat fosfolipiden ook een functie vervullen in de absorptie van voedingsvet uit de darm. Omdat de galuitscheiding van fosfolipiden en cholesterol sterk gekoppeld is aan die van galzouten, was het tot voor kort moeilijk om de specifieke functies van deze lipiden onafhankelijk van die van de galzouten te onderzoeken. Een gerichte aanpak werd mogelijk door de recent sterk toegenomen kennis van het galvormingsproces en de daarbij betrokken transporteiwitten. Zo bleek het eiwit dat wordt gemaakt na aflezing van het mdr2 gen, het mdr2 P-glycoproteine (Pgp), betrokken te zijn bij de translocatie van fosfolipiden van de binnenste naar de buitenste “leaflet” van het gal canaliculaire membraan in de lever. Deze stap is essentieel voor de galuitscheiding van fosfolipiden. In 1993 is in het Nederlands Kanker Instituut te Amsterdam een muizenmodel ontwikkeld waarin middels homologe recombinatie het mdr2 gen i s (-/-) muis. In de Mdr2(-/-) muis bleek geen uitscheiding van geïnactiveerd: de Mdr2 fosfolipiden uitscheiding naar de gal plaats te vinden. Deze bevinding heeft het inzicht in de regulering van dit uitscheidingsproces sterk vergroot, hoewel het exacte moleculaire mechanisme ervan nog steeds onduidelijk is. Ook de (-/-) muis cholesterol uitscheiding in de gal is sterk verminderd (-98%) in de Mdr2 omdat deze gekoppeld is aan de fosfolipiden uitscheiding. De galzout uitscheiding (-/-) muizenmodel is het dus is echter normaal in deze muizen. Met het Mdr2 mogelijk om de gevolgen van een specifieke afwezigheid van gal fosfolipiden en cholesterol te onderzoeken. Het doel van het in dit proefschrift beschreven onderzoek is de fysiologische rol van deze gallipiden in de regulering van het cholesterol gehalte in het bloed, het galzout metabolisme en in vetabsorptie processen in de darm. 149

Samenvatting

Hoofdstuk 1 geeft een inleiding over het cholesterol en galzout metabolisme in de lever en het lipoproteinen metabolisme. Verder wordt de huidige kennis van galvorming en uitscheiding van gallipiden samengevat. In hoofdstuk 2 worden de effecten van de afwezigheid van lipiden secretie in de gal op het cholesterol gehalte in lever en plasma en op de cholesterol kinetiek beschreven. Er werden geen verschillen waargenomen in het gehalte aan (-/-) en cholesterol(ester), fosfolipiden en triglyceriden in de lever tussen Mdr2 controle muizen. Plasma HDL-cholesterol en apolipoproteine A-I concentraties (-/-) muizen, terwijl plasma apolipoproteine B waren sterk verlaagd in Mdr2 concentraties in de VLDL en LDL fracties verhoogd waren. De activiteit van het HMG-CoA reductase, het snelheidsbepalende enzym in de cholesterol biosynthese, in de lever was verhoogd. Cholesterol absorptie uit de darm bleek (-/-) met 50% verlaagd te zijn in de Mdr2 muis en de fecale uitscheiding van neutrale sterolen was 4 maal hoger dan in controle muizen. Deze laatste bevinding geeft aan dat de totale cholesterol synthese in het lichaam verhoogd moet zijn en dat het darmstelsel daarin een belangrijke rol speelt. Om te bepalen of het fenotype (deels) genormaliseerd kan worden via dieet manipulatie zijn fosfolipiden en cholesterol aan het voedsel van de muizen toegevoegd. Suppletie van fosfolipiden en/of cholesterol in de voeding had geen (-/-) muizen (Hoofdstuk 3). effect op het plasma cholesterol gehalte in Mdr2 Blijkbaar hebben de lipiden uitgescheiden via de gal een specifieke rol en is de aanwezigheid van deze lipiden in het darmlumen op zich niet van cruciaal belang (-/-) in dit opzicht. Wel bleek de toevoeging van cholesterol in de voeding van Mdr2 muizen te leiden tot een “cholestatisch beeld” met sterk verhoogde plasma galzout (-/-) en bilirubine concentraties, vooral in vrouwelijke Mdr2 muizen. De galvorming en de galzout- of bilirubinesecretie in de gal bleken niet te veranderen na cholesterol suppletie, maar de expressie van transporter eiwitten verantwoordelijk voor opname van galzouten uit het bloed door levercellen was sterk verlaagd in de (-/-) cholesterol-gevoede Mdr2 muis. De lever scheidt cholesterol uit zowel naar de gal als naar het bloed. Bij dit laatste proces wordt cholesterol in de lever verpakt in VLDL deeltjes en zo uitgescheiden in de circulatie. Er zijn aanwijzingen in de literatuur dat de flux van lipiden naar de gal bijdraagt aan de regulatie van VLDL uitscheiding. VLDL deeltjes worden door de lever uitgescheiden om perifere weefsels van energierijke substraten te voorzien tijdens periodes van vasten. Deze deeltjes bevatten, naast cholesterol(esters), ook triglyceriden en zijn de voorlopers van atherogene LDL deeltjes. Diverse factoren (o.a. insuline, cholesterol synthese, fosfolipiden synthese) zijn betrokken bij de regulatie van het VLDL (-/-) uitscheidingsproces. De afwezigheid van gal lipiden secretie in de Mdr2 muizen bleek geassocieerd met een veranderde secretie van VLDL deeltjes door de lever (-/-) muizen waren (Hoofdstuk 4). VLDL deeltjes geïsoleerd uit plasma van Mdr2 groter en bevatten meer triglyceriden dan VLDL van controle muizen. Uit het feit dat onder ‘steady state’ condities het plasma triglyceriden gehalte gelijk was terwijl het (-/-) muis kan worden plasma apolipoproteine B gehalte verhoogd was in de Mdr2 (-/-) muizen dan in afgeleid dat de triglyceriden efficiënter geklaard worden in Mdr2 controles. Galzouten spelen een belangrijke rol in de regulering van het cholesterol metabolisme, zowel op lever- als op darmniveau. Na uitscheiding in de gal worden galzouten efficiënt geresorbeerd en teruggevoerd naar de lever om daar opnieuw 150

Physiological functions of biliary lipid secretion

in de gal te worden uitgescheiden. Deze zogenaamde enterohepatische circulatie berust op de aanwezigheid van specifieke transport systemen voor opname uit het bloed (“Sodium-dependent taurocholate co-transporting protein”, Ntcp), uitscheiding naar de gal (“bile salt export pump”, bsep) en reabsorptie uit de darm (-/-) muizen zijn (“apical sodium-dependent bile salt transporter”, abst). In Mdr2 plasma galzout concentraties licht verhoogd ten opzichte van controle waarden, ook wanneer de muizen op een laag-cholesterol dieet worden gehouden. De natrium-afhankelijke galzout opname en de eiwit expressie van Ntcp waren lager (-/-) in de lever van Mdr2 muizen dan die van controle muizen (Hoofdstuk 5). Op het niveau van de mRNA gehalte werden geen veranderingen waargenomen tussen (-/-) de groepen, hetgeen impliceert dat down-regulatie van Ntcp in Mdr2 muizen op posttranscriptioneel niveau wordt gereguleerd.. De afwezigheid van gallipiden in de gal en de daarmee gepaard gaande galgang proliferatie bleek geassocieerd te zijn met een verhoogde expressie van (-/-) muizen. De verhoogde de apicale galzout transporter (abst) in lever van Mdr2 uitscheiding van lipiden-vrije galzouten via de gal was tevens geassocieerd met (-/-) muizen (Hoofdstuk 6). een verhoogde abst expressie in de darm van Mdr2 Lever expressie van abst is beperkt tot de cholangiocyten die de galgangen (-/-) muizen bleek bekleden. Deze verhoogde eiwit expressie van abst in de Mdr2 geassocieerd te zijn met een 70% toename van de galzout pool grootte. Echter, pool grootte, fractionele ‘turnover’ en synthese van het primaire galzout cholaat, een relatief hydrofoob galzout, was niet veranderd, hetgeen een aanwijzing is dat (-/-) muizen worden de meer hydrofiele galzout soorten die in de gal van Mdr2 gevonden efficiënter in de enterohepatische circulatie worden geconserveerd dan het meer hydrofobe cholaat. De laatste hoofdstukken van dit proefschrift behandelen de effecten van afwezigheid van gal lipiden secretie op de intestinale vet- en cholesterolabsorptie. Chylomicronen vorming en secretie door de darm bleek sterk vertraagd te zijn in (-/-) de Mdr2 muizen ten opzichte van de controle muizen (Hoofdstuk 7). Door gal in (-/-) muizen te infunderen bleek de vorming van de darm van deze Mdr2 chylomicronen gedeeltelijk te kunnen worden hersteld. De resultaten laten zien dat voedingsvetten wel in het darmepitheel worden opgenomen en vervolgens daar accumuleren. Een interessante bevinding was dat de totale vetabsorptie uit de (-/-) darm, gemeten met een 72-uurs vetbalans, niet was verminderd in de Mdr2 muizen. Een verklaring hiervoor kan zijn dat het lichaam de verminderde chylomicronen vorming compenseert door gedurende een langere tijdsperiode een groter deel van de darm actief in het absorptie proces te betrekken. Ondersteuning voor deze hypothese kan gevonden worden in het feit dat het (-/-) muizen. Het i s voedingsvet meer distaal in de darm accumuleert in Mdr2 theoretisch ook mogelijk dat vet deels direct via de poortader naar de lever wordt getransporteerd. De afwezigheid van gal lipiden secretie leidde tot een vertraagde opname in het plasma maar niet tot een veranderde totale absorptie van linoleenzuur, een (-/-) muizen essentieel vetzuur dat het lichaam niet zelf kan aanmaken, in de Mdr2 (-/-) (Hoofdstuk 8). Ook de lever en plasma status van linoleenzuur in Mdr2 muizen bleek niet aangetast te zijn. De resultaten van Hoofdstuk 7 en 8 gezamenlijk duiden er op dat gal lipiden secretie een rol speelt in de kinetiek van chylomicronen vorming/uitscheiding maar minder van belang is voor ‘overall’ efficiëntie van vet absorptie. 151

Samenvatting

Recente gegevens uit de literatuur duiden er op dat cholesterol in de gal een regulerende functie kan hebben in de efficiëntie waarmee voedingscholesterol uit de darm wordt opgenomen. Het SR-BI eiwit, de HDL receptor, is recent aangetoond in de darm van konijnen en het is gepostuleerd dan dit eiwit een rol vervult in de cholesterol absorptie. SR-BI bleek aanwezig te zijn in de apicale membraan van enterocyten in ratten en muizen en de expressie was hoger in de proximale delen van de darm (Hoofdstuk 9). In ratten en muizen waarbij de galgang werd afgebonden, leidend tot afwezigheid van gal in de darm en cholestase, bleek het SR-BI eiwit praktisch afwezig te zijn in de darm. In ratten waarin de gal via een canule buiten het lichaam werd geleid, een situatie waarbij geen gal in de darm komt, maar geen cholestase wordt geïnduceerd, was SR-BI nog wel aanwezig in de darm maar met een aanzienlijk lagere expressie dan in (-/-) controle ratten. Ook de Mdr2 muizen vertoonden een lagere eiwit expressie van SR-BI in de darm dan controle muizen. In alle diermodellen was sprake van een gestoorde cholesterol absorptie. Deze studies ondersteunen de hypothese dat gallipiden een rol spelen in de regulering van SR-BI expressie in de darm. Echter de exacte rol van SR-BI in de cholesterol absorptie is nog onduidelijk. De resultaten van deze studies tonen aan dat de flux van cholesterol (en fosfolipiden) van de lever via de gal naar de darm een belangrijke rol speelt in de regulering van het cholesterol metabolisme, die aanzienlijk verder gaat dan een functie in de verwijdering van overmaat cholesterol via deze route. 1. De afwezigheid van gal lipiden secretie leidt in de muis tot een verhoogd fecale cholesterol uitscheiding. Dit is paradoxaal, gezien het feit dat gal kwantitatief aanzienlijk meer (~2 maal) cholesterol levert aan de darm dan het dieet. Echter, ook in ratten met een permanente galfistel is de fecale sterol uitscheiding sterk toegenomen. Waarschijnlijk is de cholesterol synthese in de darm verhoogd als gevolg van afwezigheid van gal lipiden. Dit is in overeenstemming met het feit dat het mRNA gehalte van HMG-CoA reductase verhoogd is in de darm van de galfistel rat (Hoofdstuk 9). Kinetische studie geven aan dat veranderingen in cholesterol synthese in de darm niet per definitie reflecteren in de kinetiek van het sterol in het plasma compartiment (Hoofdstuk 3). (-/-) muizen. Laag HDL i s 2. Het plasma HDL gehalte is sterk verlaagd in de Mdr2 een belangrijke risicofactor voor het ontstaan van hart- en vaatziekten in de mens. Het is waarschijnlijk dat de verminderde chylomicronen vorming bijdraagt aan deze verlaging, aangezien overdracht van oppervlakte componenten van chylomicronen een belangrijke stap is in de vorming van HDL deeltjes. Andere factoren spelen echter mogelijk ook een rol, zoals een veranderde HDL kinetiek. De VLDL-triglyceriden en apoB secretie door de lever in de in vivo situatie is toegenomen, hetgeen bijdraagt aan verhoogde (-/-) muizen. Zowel apolipoproteine B spiegels in VLDL en LDL in Mdr2 verhoogde VLDL als LDL gehaltes zijn geassocieerd met een hoger risico op hart- en vaatziekten in de mens. 3. De afwezigheid van gallipiden secretie leidt tot galgang proliferatie. De hiermee geassocieerde verhoogde expressie van de apicale galzout transporter in lever (-/-) muis gaat en darm en de verlaagde Ntcp expressie in de lever van de Mdr2 gepaard met verhoogde plasma galzoutconcentraties en een toegenomen galzout pool. De verhoogde expressie van abst en de verlaagde expressie van (-/-) muizen zijn waarschijnlijk uitingen van Ntcp in de lever van de Mdr2 152

Physiological functions of biliary lipid secretion

compensatoire aanpassingen van het galzouttransport als reactie op de vorming van lipiden-vrije gal. De toegenomen eiwit levels van abst bij de galgang proliferatie lijkt geassocieerd met ‘cholehepatic shunting’ van (-/-) galzouten, wat leidt tot een hogere choleretische activiteit in Mdr2 muizen. 4. Afwezigheid van gallipiden is geassocieerd met een veranderde kinetiek van (-/-) vetabsorptie. De chylomicronen vorming is sterk vertraagd in de Mdr2 muizen, terwijl de totale vetabsorptie onveranderd is. Cholesterol absorptie, daarentegen, is wel verlaagd is deze muizen. Blijkbaar liggen andere mechanismen ten grondslag aan de absorptie van vetzuren en van cholesterol. De kennis is van belang in de ontwikkeling van cholesterol-verlagende therapieën in de mens, gebaseerd op specifieke blokkering van cholesterolabsorptie uit de darm. De vergrootte galzout pool (zie hierboven) (-/-) draagt mogelijk bij aan de efficiënte vetabsorptie in Mdr2 muizen. Gal vormt de “fysiologische verbinding” tussen lever en darm en beïnvloedt op beide niveaus de regulering van plasma lipoproteinen concentraties en dus het risico op hart- en vaatziekten.

153

Samenvatting

154

Physiological functions of biliary lipid secretion

ZUSAMMENFASSUNG Die Leber spielt beim Erhalt der Cholesterol-Homöostase eine zentrale Rolle. 1. Die Leber ist an der Regulation der Cholesterol-Konzentration im Blut über die Aufnahme und Sekretion cholesterolhaltiger Lipoproteine und die Synthese von Proteinen beteiligt, die am Lipoproteinstoffwechsel teilnehmen. 2. Die Leber kann Cholesterol in relativ großen Mengen synthetisieren: es wird mehr Cholesterol neu synthetisiert als über die Nahrung aufgenommen. 3. Die Leber ist als einziges Organ in der Lage, überschüssiges Cholesterol aus dem Körper zu entfernen, nämlich durch Sekretion in die Galle (biliäre Sekretion). Cholesterol wird entweder als freies Cholesterol ausgeschieden oder zuvor in Gallensalze konvertiert: In beiden Fällen endet es schließlich i m Stuhl. Frühere Studien unseres Laboratoriums haben gezeigt, daß die Galle und die Gallenbildung wichtige andere Funktionen beim Erhalt der CholesterolHomöostase haben. Außer Cholesterol und Gallensalzen enthält die Galle noch eine hohe Konzentrationen an Phospholipiden. Die Menge an Phospholipiden und Cholesterol, die über die Galle in den Darm gelangt, ist bedeutend größer als die, die mit der Nahrung zugeführt wird. Fast die gesamten biliären Phospholipide und ungefähr 60 Prozent des biliären Cholesterols wird im Darm reabsorbiert. Biliäre Phospholipide erfüllen eine Reihe wichtiger Funktionen im Körper. In der Galle bilden Phospholipide, Cholesterol und Gallensalze sogenannte „mixed micelles“, wodurch die Zellen, die die Gallengänge auskleiden, gegen die detergierende Wirkung der Gallensalze geschützt werden. Außerdem wird vorgeschlagen, daß biliäre Phospholipide eine spezifische Funktion bei der Lipidabsorption im Darm erfüllen. Weil die Sekretion von Lipiden durch die Galle eng mit der der Gallensalze verknüpft ist, war es extrem schwierig, die spezifischen Funktionen der Lipide unabhängig von denen der Gallensalze zu untersuchen. Aktuelle Erkenntnisse über den Prozeß der Gallenbildung und die daran beteiligten Transportproteine der Leber machten es möglich, diese Fragestellung näher zu untersuchen. Das Mdr2 Genprodukt, mdr2 P-Glykoprotein, arbeitet als Phospholipid-Translokator, indem es gallenspezifische Phospholipide (nämlich Phosphatidylcholin) von der inneren an die äußere Seite der kanalikulären Membran transportiert. Dieser Schritt ist essentiell für die Sekretion der Phospholipide in die Galle. 1993 wurden am niederländischen Krebsforschungsinstitut in Amsterdam durch homologe Rekombination Mäuse entwickelt, denen (-/-) mdr P-Glykoprotein fehlt (Mdr2 ). Diese zeigen ein komplettes Fehlen von Phospholipiden in der Galle; und da die Cholesterol-Sekretion eng hiermit verbunden ist, ist diese ebenfalls erniedrigt (-98%). Die Gallensalzsekretion ist bei (-/-) diesen Mäusen hingegen normal. Die Mdr2 -Mäuse machten es möglich, 155

Zusammenfassung

spezifisch die pathophysiologische Rolle des Fehlens biliärer Lipide zu studieren. Die in dieser Dissertation beschriebenen Untersuchungen beschäftigen sich mit der physiologischen Rolle der biliären Lipide bei der Regulation der CholesterolKonzentration im Blut und des Gallensalz-Stoffwechsels, sowie bei der Aufnahme von Fett im Darm. Kapitel 1 gibt einen Überblick über den Cholesterol- und Gallensalzstoffwechsel der Leber und den Stoffwechsel von Plasmalipoproteinen. Aktuelle Erkenntnisse über die Gallenbildung und biliäre Lipidsekretion werden im Detail beschrieben, außerdem wird die Fragestellung dieser Untersuchungen erläutert. Kapitel 2 beschäftigt sich mit den Effekten des Fehlens biliärer Lipidsekretion auf (-/den Lipoproteinstoffwechsel in Plasma und Leber. Dabei wurden zwischen Mdr2 ) - und Kontrollmäusen keine Unterschiede in Bezug auf den Gehalt der Leber an Cholesterol(-ester), Phospholipiden oder Triglyzeriden gefunden. Plasma HDL(-/-) Cholesterol und Apolipoprotein A-I waren in den Mdr2 -Mäusen deutlich verringert, während Apolipoprotein B in den VLDL- und LDL-Fraktionen erhöht waren. Die Aktivität der HMG-CoA-Reduktase, des Schlüsselenzyms bei der Bio(-/-) synthese von Cholesterol, war erhöht. Die Cholesterol-Absorption bei Mdr2 Mäusen war um ungefähr 50 Prozent reduziert, der Verlust an neutralen Sterolen in den Stuhl war ungefähr vierfach erhöht. Diese letzte Beobachtung impliziert, daß die Cholesterol-Biosynthese des Körpers insgesamt erhöht ist, ein Phänomen, bei dem der Intestinaltrakt eine wichtige Rolle spielt. Um zu untersuchen, ob diese Befunde durch die Ernährung (teilweise) kompensiert werden können, wurden Phospholipide und Cholesterol der Nahrung dieser Mäuse zugesetzt. Dieses hatte keinen Effekt auf die Plasma(-/-) Konzentrationen von Triglyzeriden und Cholesterol in den Mdr2 -Mäusen (Kapitel 3). Es scheint so, als ob die biliäre Sekretion dieser Lipide eine spezifische Funktion hätte, die durch die bloße Gegenwart dieser Lipide im Darm nicht ersetzt werden kann. Addition von Cholesterol zur Nahrung schien zu einem „cholestatischen“ Erscheinungsbild bei den knock-out Mäusen zu führen, mit erhöhten Konzentrationen von Gallensalzen und Bilirubin im Plasma, insbesondere bei (-/-) weiblichen Mdr2 -Mäusen. Trotz dieser spürbar erhöhten Konzentrationen wurden keine Veränderungen im Gallenfluß, der Gallensalz- und Bilirubinsekretion (-/-) bei den Cholesterol-supplementierten Mdr2 -Mäusen gefunden, hingegen war die Expression von Proteinen, die Gallensalze in die Leber transportieren, verringert. Die Leber spielt eine zentrale Rolle sowohl bei der Sekretion von Cholesterol in die Galle als auch in den Blutkreislauf. Cholesterol wird in sogenannte VLDL-Partikel verpackt, die dann in das Blut sekretiert werden. Der hepatobiliäre Lipid-Flux wird als wichtiger Regulator der VLDL-Sekretion vermutet. VLDL-Partikel liefern während des Fastens energiereiche Substrate an periphere Gewebe. Neben Cholesterol(estern) enthalten diese Partikel Triglyzeride und stellen die Vorstufen 156

Physiological functions of biliary lipid secretion

für die atherogenen HDL-Partikel dar. Mehrere Faktoren (zum Beispiel Insulin, Cholesterol-Synthese, Phospholipid-Synthese) sind an der Regulation der VLDL(-/-) Sekretion beteiligt. Das Fehlen der Lipidsekretion in die Galle bei Mdr2 -Mäusen führt zu einer veränderten VLDL-Sekretion (Kapitel 4). Die aus dem Plasma von (-/-) Mdr2 -Mäusen isolierten VLDL-Partikel sind größer und enthalten mehr Triglyzeride als die von Kontrollmäusen. Unter Gleichgewichtsbedingungen waren (-/-) die Triglyzerid- und Apolipoprotein B-Konzentrationen in Mdr2 -Mäusen und Kontrollmäusen vergleichbar, was darauf hindeutet, daß Triglyzeride rasch aus dem Plasma entfernt werden. Gallensalze spielen eine wichtige Rolle in der Regulation des CholesterolStoffwechsels. Nach der Sekretion über die Galle werden Gallensalze effizient i m Darm reabsorbiert und zur Leber zurücktransportiert. Diese sogenannte enterohepatische Zirkulation hängt von spezifischen Transportproteinen ab, die für die Aufnahme in die Leber (Natrium-abhängiges Taurocholat-co-transportierendes Protein, Ntcp), die Sekretion in die Galle (Gallensalz-Export-Pumpe, Bsep), und die Reabsorption im Darm verantwortlich sind (apikaler Natrium-abhängiger (-/Gallensalztransporter, Abst). Die Gallensalzkonzentration im Plasma ist bei Mdr2 ) -Mäusen auch bei einer cholesterolarmen Ernährung erhöht. Die (-/-) natriumabhängige Aufnahme und die Menge an Ntcp-Protein sind in Mdr2 Mäusen im Vergleich zu Kontrollmäusen verringert (Kapitel 5). Dagegen wurden unter Gleichgewichtsbedingungen keine Unterschiede in den mRNAKonzentrationen zwischen diesen Gruppen beobachtet, was auf eine posttranskriptionale Regulation hinweist. Das Fehlen der biliären Lipidsekretion, das zu einer Proliferation der Gallengänge (-/-) in Mdr2 -Mäusen führt, ist mit einer erhöhten Proteinexpression des apikalen Natrium-abhängigen Gallensalztransporters (Abst) sowohl in der Leber als auch im Darm assoziiert (Kapitel 6). Die Expression von Abst war in der Leber auf die Zellen beschränkt, die die Gallengänge begrenzen, die Cholangiozyten. Die erhöhte Expression von Abst war mit einem um 70 Prozent erhöhten GesamtGallensalzpool verbunden. Es wurden keine Veränderungen in der Größe des Pools oder der Umsatz- und Syntheserate des primären, relativ hydrophoben Gallensalzes Cholat beobachtet. Dies weist darauf hin, daß durch effizientere enterohepatische Zirkulation verstärkt hydrophile Gallensalze in der Galle der (-/-) Mdr2 -Mäuse vorhanden sind. Die letzten Kapitel dieser Dissertation beschäftigen sich mit den Effekten des Fehlens biliärer Lipidsekretion auf die Fett- und Cholesterolabsorption im Darm. (-/-) Die Bildung und Sekretion von Chylomikronen war in den Mdr2 -Mäusen i m Vergleich zu Kontrollmäusen gestört (Kapitel 7). Nach der Infusion von Rattengalle (-/-) in den Darm von Mdr2 -Mäusen konnte die Chylomikronenbildung teilweise wiederhergestellt werden. Die Resultate zeigen, daß Fett in die Enterozyten gelangt, wo es sich anzuhäufen scheint. Interessanterweise war die Fettabsorption 157

Zusammenfassung (-/-) insgesamt, gemessen über 72 Stunden, in den Mdr2 -Mäusen nicht gestört. (-/-) Mdr2 -Mäuse könnten die gestörte Chylomikronenbildung dadurch kompensieren, daß sie einen längeren Abschnitt des Darmes während einer längeren Zeitdauer für den Absorptionsprozeß nutzen: Fett akkumulierte vorwiegend in den distalen Abschnitten des Darms. Alternativ könnte auch ein direkter Transport von Fettsäuren über die vena portae zur Leber stattfinden. Das Fehlen von biliärer Lipidsekretion führte zum verzögerten Auftreten von Linolensäure im Plasma, aber wiederum war die Absorption von Linolensäure (-/-) insgesamt in den Mdr2 -Mäusen im Vergleich zu Kontrollen nicht verändert (Kapitel 8). Der Linolensäurestatus in der Leber und im Blut unterschied sich (-/-) zwischen Mdr2 -Mäusen und Kontrollmäusen nicht. Die Ergebnisse der Kapitel 7 und 8 zeigen deutlich, daß die biliäre Lipidsekretion für die Kinetik der Chylomikronenbildung wichtig, für die Fettabsorption insgesamt hingegen von geringerer Bedeutung ist. In der aktuellen Literatur ist beschrieben, daß das Cholesterol aus der Galle i m Darm die Absorption von Cholesterol aus der Nahrung reguliert. SR-B1, der Rezeptor für HDL, wurde im Darm von Kaninchen nachgewiesen; es wurde vermutet, daß er eine Rolle in der Absorption von Cholesterol im Darm spielt. SRB1 wurde in der Apikalmembran von Enterozyten der Maus und der Ratte nachgewiesen, und zwar mehr in proximalen als distalen Bereichen des Darms (Kapitel 9). In Gallengang-ligierten Tieren, unter den Bedingungen des Fehlens von Galle im Darm und der Cholestase, war das SR-B1-Protein fast nicht vorhanden. In Gallen-abgeleiteten Ratten, denen ebenso die Galle im Darm fehlte, aber ohne (-/-) eine Cholestase, und in Mdr2 -Mäusen war die SR-B1-Proteinmenge im Darm erniedrigt. Diese Studien zeigen, daß biliäre Lipide wichtig für die SR-B1Expression im Darm sind. Die genaue Rolle von SR-B1 bei der Cholesterolabsorption im Darm muß jedoch noch geklärt werden.

Die Ergebnisse der Studien, die in dieser Dissertation beschrieben sind, zeigen, daß der hepatobiliäre Flux von Cholesterol (und Phospholipiden) in den Darm für die Regulation der Cholesterol-Homöostase eine wichtige Rolle spielt, die weit über die lang bekannte Funktion des Entfernens überschüssigen Cholesterols aus dem Körper hinausgeht. 1. Das Fehlen von biliärer Lipidsekretion ist mit einer erhöhten Cholesterolexkretion im Stuhl verbunden. Das ist insofern paradox, als die aus der Galle stammende Menge an Cholesterol die aus der Nahrung u m mindestens den Faktor 2 übersteigt. Ratten mit einer permanenten Gallenfistel zeigen ebenfalls eine deutlich erhöhte Cholesterolexkretion im Stuhl. Die intestinale Biosynthese von Cholesterol ist wahrscheinlich durch die fehlende Zufuhr von biliären Lipiden verstärkt, worauf auch der Befund hindeutet, daß die mRNA-Niveaus für HMG-CoA-Reduktase in Gallen-abgeleiteten Ratten erhöht 158

Physiological functions of biliary lipid secretion

sind (Kapitel 9). Kinetische Studien zeigen, daß sich Veränderungen in der intestinalen Cholesterolsynthese nicht zwangsläufig in der Kinetik von Cholesterol im Plasma widerspiegeln (Kapitel 3). (-/-) 2. Die Konzentration von HDL-Cholesterol im Plasma ist in Mdr2 -Mäusen stark vermindert. Niedrige HDL-Level beim Menschen sind mit einem erhöhten Risiko für kardiovaskuläre Erkrankungen assoziiert. Die gestörte Chylomikronensekretion könnte teilweise die niedrigen HDL-Level erklären, da die Chylomikronen das Oberflächenmaterial für die HDL-Bildung bereitstellen. Andere Effekte, wie zum Beispiel Änderungen in der HDL-Kinetik, könnten ebenso dazu beitragen. Die Sekretion von VLDL und Apolipoprotein B durch die Leber ist in vivo erhöht, was zu den hohen ApoB-Konzentrationen beiträgt, die in (-/-) den VLDL- und LDL-Fraktionen der Mdr2 -Mäuse gefunden wurden. Sowohl erhöhte VLDL- als auch LDL-Level sind beim Menschen mit einem erhöhten Risiko für kardiovaskuläre Krankheiten verbunden. 3. Das Fehlen biliärer Lipidsekretion führt zur Proliferation der Gallengänge, verstärkter Expression von Abst in Leber und Darm und verringerter Expression (-/-) von Ntcp in der Leber von Mdr2 -Mäusen. Es ist assoziiert mit erhöhten Gallensalzkonzentrationen im Plasma und einem vergrößerten Pool an Gallensalzen. Sowohl die erhöhte Abst-Expression als auch die erniedrigte Ntcp-Expression stellen vermutlich kompensatorische Funktionen als Reaktion auf die Bildung Lipid-freier Galle dar. 4. Das Fehlen biliärer Lipide ist mit Veränderungen in der Kinetik der (-/-) Fettabsorption verbunden. Die Bildung von Chylomikronen ist bei Mdr2 Mäusen deutlich beeinträchtigt, hingegen ist die Fettabsorption insgesamt normal. Die Cholesterol-Absorption ist in diesen Mäusen stark vermindert, was auf separate Mechanismen für diese beiden Absorptionsprozesse hindeutet. Diese Erkenntnis ist für die Entwicklung Cholesterol-erniedrigender Therapien, die auf der selektiven Blockade der intestinalen Cholesterol-Absorption beruhen, von Bedeutung. Der größere Gallensalzpool (siehe oben) in den (-/-) Mdr2 -Mäusen mag zur effizienten Fettabsorption beitragen. Die Galle bildet die physiologische Verbindung zwischen der Leber und dem Darm, sie ist ein wichtiger Faktor in diesen Organen, der die Konzentrationen der Lipoproteine im Plasma und damit das Risiko kardiovaskulärer Erkrankungen kontrolliert.

159

Zusammenfassung

160

DANKWOORD

bedankt!

Dankwoord

162

Physiological functions of biliary lipid secretion

Ze zeggen wel eens dat Zeeuwen zuinig zijn in dit geval moet ik dat ook wel toegeven want in dit korte dankwoord kan ik nooit iedereen genoeg bedanken. Natuurlijk heb ik het werk wat in dit proefschrift beschreven wordt niet alleen gedaan en heb dan ook hulp gehad van velen. Als eerste Folkert, dankzij jou heb ik het Hoge Noorden beter mogen leren kennen. Jouw werklust en inzet hebben mij verschillende malen gestimuleerd om toch vooral verder te gaan. Hopelijk hebben de vele correcties in de verschillende manuscripten hun vruchten afgeworpen. Ik zal ook nooit de eerste bieravond vergeten. Ik ben dan ook zeer dankbaar dat jij mijn promotor kon zijn. Hopelijk blijkt de verbinding Leiden-Groningen kort en kunnen we blijven samenwerken, bedankt voor alles. Bert, onze eerste ontmoeting bij mijn sollicitatie ligt nog vers in mijn geheugen. Volgens mij was jij er wel uit en begon jij ook je spullen te pakken toen jullie klaar waren met mijn sollicitatie gesprek. Hopelijk heb ik die eerste indruk waar kunnen maken. Jouw nuchtere kijk op de hele wetenschap werkt zeer ontspannend maar tevens stimulerend. Als referent heb je de “vervelende” taak om een vraag te verzinnen voor mijn verdediging. Maar, Henkjan, ik denk dat dat voor jou geen enkel probleem is. De “harde” aanpak van jou is duidelijk en geeft altijd discussie, maar is af en toe behoorlijk vervelend! Roel, jij ook bedankt voor de prima samenwerking de afgelopen vier jaar en zoals je zelf al zei: “Er zijn geen vreemde dingen voorgevallen”. Leden van de beoordelingscommissie: Pieter, Ronald en Louis, bedankt dat jullie mijn manuscript snel en doeltreffend hebben beoordeeld. Pieter, als hoofd van de afdeling Kindergeneeskunde heb je meerdere keren mee kunnen ‘genieten’ van het werk in dit proefschrift. Ronald, bedankt voor de kritische noten tijdens het MDR-overleg in Amsterdam en voor de gezellige discussies tijdens congressen e.d.. Louis, gezien dat jij mijn nieuwe baas bent gaan we hopelijk een zeer vruchtbare tijd tegemoet. Jammer dat je niet op de promotie aanwezig kan zijn. Rick, jou moet ik natuurlijk twee keer bedanken. Ten eerste voor alle excellente ondersteuning bij de dierexperimenten. De goede gesprekken over vrouwen, vrouwen en bieravonden tijdens de verschillende experimenten en koffiepauzes hielpen de trieste huisvesting vergeten. Het blijkt wel dat ik geen weddenschappen over muziek moet afsluiten met jou: het kost mij steeds weer een fles wijn. Verder natuurlijk bedankt dat je mij mentaal wilt steunen tijdens de laatste beproeving. Hierbij wil ik Renze, Vincent, Henk W., Henk E., Anke en Juul bedanken voor al hun analytische ondersteuning, goede werksfeer, gezellige koffiepauzes en alle kritische opmerkingen. Vincent, dankzij jou zijn die kilo’s er toch mooi af, nu het buikje nog! Gert, ja, het is begonnen met het organiseren van de Lauwersloop ’96. We hebben gezellig getraind, zowel lopen als fietsen. Het fietsen is voor jou verleden tijd en het 163

Dankwoord

hardlopen is nu jou goal, zeker nu je zo’n adonis geworden bent, succes met die halve (en hele?) marathon(s) en bedankt Alle collega’s (analisten, postdocs, staf, stagiar(e)s en studenten) van de e laboratoria op de 2 verdieping (CMC 4 en 5) bedankt voor de zeer plezierige samenwerking de afgelopen vier jaar. De mensen van het lab LHGV: Gert, Herman, en Leid, het lab CKCL, Albert e.a., bedankt voor de ondersteuning. Deanna, jij zit alweer in de US of A, maar wij hebben veel lol gehad samen. Jouw naïeve en tevens verleidelijke lach was altijd goed voor een gezellige sfeer. Nu kun je mij terugpakken, bedankt en we houden contact. Slimme rakker (Robert), bedankt voor de gezellige en rake opmerkingen heen en weer, de vele interessante discussies, ondanks dat je een dokter bent. Hopelijk schop jij het zover als ....? De weddenschap staat nog wel hè?. Torsten (bedankt voor de Duitse samenvatting), Coen, Baukje, Christian, Arjen, Renate, Tineke (je staat dus gewoon in de rij), Lorraine, Anniek, de AIO/OIO’s van MDL, Guido, Johan, Jenny, Jaqueline, Marieke, maar ook de ex-AIO’s Nynke, Mini en Thera en postdocs Han en Olaf bedankt voor de gezellige koffiepauzes, feestjes en de verschillende lulpraatjes af en toe. Natuurlijk mag hier een dank aan iedereen die gezorgd heeft voor het slagen van de beruchte Belgische Bieravonden niet ontbreken. Niets is zo goed als de eerste keer!! De mensen op het centraal dierenlab: Wiebe, Bert, Hans, Jan, Lucas en Harm, maar ook de rest worden bedankt voor de samenwerking, jullie kunnen de resultaten zien in dit proefschrift. Bert H., bedankt voor jouw bijdrage aan de perfecte lay-out van figuren en voorkant. Zonder jou zag dit geheel er waarschijnlijk een stukje anders uit. Wilma van Opstalt, bedankt dat ik één van jouw kunstwerken mocht gebruiken voor de voorkant. De collega’s in het AMC, SLIC-lab: Roel, jouw Amsterdamse accent en humor zijn zeer aanstekelijk en muizen halen was altijd weer een leuk uitstapje. Hopelijk kunnen we nu nog eens goed feest vieren in Groningen, bedankt. Marleen, dankzij jou had ik een slaapplaats als ik weer eens een cursus had in Amsterdam e.o., de nuchterheid van René, het is en blijft een Grunninger, was altijd goed voor leuke discussies. Kaatje, ja wat zal ik zeggen, gezellig en hopelijk is de afstand Amsterdam-Groningen niet te ver. Voor de fase Groningen is er veel voorafgegaan. Wat precies is wel na te lezen in mijn CV. Ik wil dan ook een paar mensen bedanken voor de aanloop naar dit promotiewerk. MLO/HLO: Fred, Wim, J.W. en de rest; Berlin: Ulla, Ingeborg, Horst, Manfred, Joachim und alle anderen vielen Dank für die gute Zeit. Hoffentlich sehen wir einander schnell wieder; Nijmegen: de afdeling Toxicologie met name Jenny Copius Peereboom-Stegeman (Berliner Bär), verder alle (ex)medestudenten (BMGW en G) waarvan Sabine en Aloys in het bijzonder. Aloys, het klikte aardig vanaf het begin in Nijmegen en het was ook een groot toeval dat onzo bazen 164

Physiological functions of biliary lipid secretion

goede vrienden waren. Mede ‘beroepsmatig’ in Groningen en was zeer gezellig en heeft leuke wilt steunen in de laatste loodjes jou niet al te lang meer.

hierdoor zagen wij elkaar nog wel eens op congressen. De wintersport met z’n tweeën foto’s opgeleverd. Verder bedankt dat ook jij mij tot het gewilde doctoraat.. Hopelijk duurt dat van

Enna, de laatste loodjes zijn het zwaarst, dat bleek ook wel uit het feit dat ik de afgelopen zes maanden weinig thuis was: werk of mountainbike. De nieuwe uitdaging is Leiden, bedankt voor je liefde en steun. Mijn broer(tje) René, ja het is voor de derde keer dat ik een afstudeerfeestje heb, ach je wilt wel eens wat zullen we maar zeggen. De gezamenlijke interesse in w(h)iskey, is altijd reden om weer eens een ander flesje te proberen. Als laatste mijn ouders, zonder hen zou er überhaupt niets te vieren zijn. Zij hebben gelukkig volgehouden dat ik meer in mijn mars had, dan was getest (zie stelling). Zij hebben mij altijd gesteund (niet alleen financieel) en nooit moeilijk gedaan dat ik van Oost Souburg via Berlijn, Lelystad, Nijmegen, Berlijn, Groningen en Tolbert nu in Leiden terecht ben gekomen. Bedankt voor alle steun en begrip gedurende deze gehele studiereis. Als waardering draag ik dit boekje ook op aan jullie. Iedereen bedankt voor de afgelopen 4.25 jaar Groningen en "het kon minder"! Zo, nu is het tijd voor een feestje met .....Belgisch Bier!!!!!!!

Groningen, maart 2000

165

Dankwoord

166

CURRICULUM VITAE Pieter (Peter) Jacobus Voshol werd geboren op 14 februari 1969 te Vlissingen. Na het behalen van zijn MAVO diploma in 1985 aan de Stedelijke Scholengemeenschap Middelburg te Middelburg ging hij naar de Zeeuwse Academie voor Chemie en Gezondheidszorg te Goes voor een MLO opleiding. Na drie succesvole jaren MLO stapte hij over naar het HLO aan de Hogeschool Zeeland te Vlissingen. Na het behalen van het HLO diploma in 1992 begon hij aan verkort programma van de studie Gezondheidswetenschappen (tegenwoordig Biomedische Gezondheidswetenschappen) aan de Katholieke Universiteit Nijmegen te Nijmegen met als richting Toxicologie. In het kader van het docteraal examen deed hij zijn onderzoekstraining bij Zentralstelle zur Erfassung und Bewertung von Ersatz- und Ergänzungsmethoden zum Tierversuch (ZEBET), Bundes Institute für gesundheidslichen Verbraucherschutz und Veterinärmedizin (BgVV) te Berlijn (prof. dr. H Spielmann) en behaalde zijn doctoraal in 1995. Van januari 1996 tot april 2000 was hij werkzaam als onderzoeker in opleiding (OIO) in dienst van de Nederlandse Organisatie voor Wetenschappelijk Onderzoek (NWO, project nr. 902-23-097) bij de afdeling Kindergeneeskunde van het Academisch Ziekenhuis Groningen binnen het Centrum voor Lever-, Darm- en Stofwisselingsziekten van het Groningen University Institute for Drug Exploration (GUIDE). Het onderzoek werd gedaan onderleiding van dr. F. Kuipers (Kindergeneeskunde, AZG, Groningen) en dr. A.K. Groen (Afdeling Maag-, Leveren Darmziekten, AMC, Amsterdam). De resultaten van dit onderzoek staan beschreven in dit proefschrift. Tijdens deze periode behaalde hij tevens de Postdoctorale Opleiding Toxicologie, Universiteit Wageningen. Vanaf 1 april 2000 is hij, in kader van een door de Nederlandse Organisatie voor Wetenschappelijk Onderzoek (NWO) gesubsidieerd onderzoek, werkzaam als Postdoc bij het Leids Universitair Medisch Centrum (prof. dr. J.A. Romijn) en TNO-Preventie en Gezondheid (prof. dr. L.M. Havekes), om onderzoek te verrichten naar insuline resistentie bij non-insuline dependent diabetes mellitus (NIDDM of type II diabetes).

Publication list Voshol PJ, R Havinga, H Wolters, R Ottenhoff, HMG Princen, RPJ Oude Elferink, AK Groen and F Kuipers. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-Glycoprotein-deficient mice. Gastroenterology 1998; 114: 1024-1034. Koopen NR, H Wolters, PJ Voshol, B Stieger, RJ Vonk, PJ Meier, F Kuipers and B Hagenbuch. Decreased Na+-dependent taurocholate uptake and low expression + of sinusoidal Na -taurocholate cotransporting protein (Ntcp) in liver of mdr2 Pglycoprotein -deficient mice. Journal of Hepatology, 1999; 30: 14-21. Voshol PJ, NR Koopen, R Havinga, H Wolters, RPJ Oude Elferink, B Hagenbuch, AK Groen and F Kuipers. Elevated plasma bile salt levels without cholestasis in + mdr2 P-glycoprotein-deficient mice due to impaired Na -taurocholate transporting protein (ntcp) function. In: Proceedings of the Falk Symposium No. 108; Bile Acids 167

and Cholestasis, edited by G Paumgartner, A Stiehl, W Gerok, D Keppler and U Leuschner, 1999, Kluwer Academic Publishers, Dordrecht, The Netherlands. Minich DM, PJ Voshol, R Havinga, F Stellaard, F Kuipers, RJ Vonk and HJ Verkade. Biliary phospholipid secretion is not required for intestinal absorption and plasma status of linoleic acid in mice. Biochimica et Biophysica Acta, 1999; 1441: 14-22. Voshol PJ, DM Minich, R Havinga, RPJ Oude Elferink, HJ Verkade, AK Groen and F Kuipers. Postprandial chylomicron formation and fat absorption in multidrug resistance gene-2 P-glycoprotein-deficient mice. Gastroenterology, 2000; 118: 173-182. Mensenkamp AR, MC Jong, H van Goor, MJA van Luyn, V Bloks, R Havinga, PJ Voshol, MH Hofker, K Willems van Dijk, LM Havekes and F Kuipers. Apolipoprotein E participates in the regulation of very low density lipoprotein-triglyceride secretion by the liver. The Journal of Biological Chemistry, 1999, 274(50): 35711-35718. Voshol PJ, I Pohl, J Heuer, H Spielmann. Die Anwendung der Durchflußzytometrie für die in vitro-Bestimmung embryotoxischer Substanzen in der in vitro-Kultivierung muriner embryonaler Stammzellen. In: Ersatz- und Ergänzungsmethoden zu Tierversuchen. Forschung ohne Tierversuche 1996. Edited by H Schöffl, H Spielmann, HA Tritthart, K Cußler, AF Goetschel, FP Gruber, ChA Reinhardt, Springer-Verlag, Wien, Austria, 104-109.

168