Development of a novel recombinant encapsidated RNA particle: Evaluation as an internal control for diagnostic RT-PCR

Available online at www.sciencedirect.com

Journal of Virological Methods 146 (2007) 218–225

Development of a novel recombinant encapsidated RNA particle: Evaluation as an internal control for diagnostic RT-PCR Donald P. King a,∗ , Nick Montague b , Katja Ebert a , Scott M. Reid a , Juliet P. Dukes a , Lysann Sch¨adlich b,1 , Graham J. Belsham a,2 , George P. Lomonossoff b b

a Institute for Animal Health, Ash Road, Pirbright, Surrey GU24 0NF, United Kingdom Department of Biological Chemistry, John Innes Centre, Colney Lane, Norwich NR4 7UH, United Kingdom

Received 17 May 2007; received in revised form 27 June 2007; accepted 4 July 2007 Available online 28 August 2007

Abstract This report describes the generation of novel encapsidated RNA particles and their evaluation as in-tube internal controls in diagnostic real-time reverse-transcription PCR (rRT-PCR) assays for the detection of RNA viruses. A cassette containing sequences of 2 diagnostic primer sets for foot-and-mouth disease virus (FMDV) and a set for swine vesicular disease virus (SVDV) was engineered into a full-length cDNA clone containing the RNA-2 segment of Cowpea Mosaic Virus (CPMV). After co-inoculation with a plasmid that expressed CPMV RNA-1, recombinant virus particles were rescued from cowpea plants (Vigna unguiculata). RNA contained in these particles was amplified in diagnostic rRT-PCR assays used for detection of FMDV and SVDV. Amplification of these internal controls was used to confirm that rRT-PCR inhibitors were absent from clinical samples, thereby verifying negative assay results. The recombinant CPMVs did not reduce the analytical sensitivity of the rRT-PCRs when amplification of the insert was performed in the same tube as the diagnostic target. This system provides an attractive solution to the production of internal controls for rRT-PCR assays since CPMV grows to high yields in plants, the particles are thermostable, RNase resistant and simple purification of RNA-2 containing capsids yields a preparation which is non-infectious. © 2007 Elsevier B.V. All rights reserved. Keywords: RNA; Internal control; Real-time RT-PCR; Capsid

1. Introduction Rapid and accurate laboratory diagnosis is an important aspect of the effective control of exotic livestock diseases such as foot-and-mouth disease (FMD) and swine vesicular disease (SVD). Real-time reverse-transcription PCR (rRT-PCR) assays have become routine front-line diagnostics tools for the detection of these viruses in clinical samples (Callahan et al., 2002; Reid et al., 2002, 2004). Guidelines for the validation and quality control of diagnostic PCR tests recommend that internal controls are included in the assay to verify negative results (Belak and Thoren, 2001; Anon., 2006). These controls confirm that sub∗

Corresponding author. Tel.: +44 1483 231131; fax: +44 1483 231142. E-mail address: [email protected] (D.P. King). 1 Present address: Deutsches Krebsforschungszentrum, Im Neuenheimer Feld 280, 69120 Heidelberg, Germany. 2 Present address: National Veterinary Institute, Technical University of Denmark, Lindholm, DK-4771 Kalvehave, Denmark. 0166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2007.07.002

stances that are inhibitory to the enzymatic RT-PCR steps are absent from the test samples (Ballagi-Pordany and Belak, 1996). One solution to monitor the presence of these inhibitors in the samples is to generate artificial RNA constructs by in vitro transcription (Heath et al., 2003; Westcott et al., 2003; Hoffmann et al., 2006). Unfortunately these “naked” RNA transcripts are unstable and prone to degradation by cellular RNases. Furthermore, since viral genomes are typically encapsidated or reside in intra-cellular compartments, RNA transcripts that do not require a lysis step to release nucleic acid template only provide limited validation of the RNA extraction process of an assay. The development of control RNA molecules which are encapsidated in particles is one strategy that can be deployed to replicate more closely the conditions encountered by the RNA template of wild-type virus within clinical samples. Cowpea Mosaic Virus (CPMV) is a non-enveloped RNA plant virus classified in the family Comoviridae within the proposed new order Picornavirales. CPMV shares some similarities with the genome organisation and capsid structure of

D.P. King et al. / Journal of Virological Methods 146 (2007) 218–225

picornaviruses such as FMDV and SVDV. However, CPMV has a bipartite genome: each of the single-stranded positive sense genomic segments are packaged separately into mature icosahedral viral capsids and each encodes a polyprotein. Since RNA-2 is shorter than RNA-1 (3.5 kb in comparison to 5.9 kb, respectively), there is potentially space in this segment to insert additional foreign RNA sequences without affecting encapsidation. This property has been exploited previously to develop RNA-2 into a vector for the efficient expression of heterologous proteins (Gopinath et al., 2000; Mechtcheriakova et al., 2006; Monger et al., 2006) and translatable sequences in excess of 1 kb have been successfully incorporated (Monger et al., 2006). Furthermore, preliminary experiments with a recombinant CPMV RNA-2 containing a 0.5 kb fragment from the 5 untranslated region (5 UTR) of FMDV showed that it was possible to incorporate untranslated sequences downstream of the RNA-2-encoded polyprotein while retaining virus viability (Sch¨adlich, L., Belsham, G.J. and Lomonossoff, G.P., unpublished results). The inserted FMDV RNA sequence could be detected using an automated diagnostic rRT-PCR (Reid et al., 2003) targeting this region. This work represented the first example of using CPMV as a carrier of non-translated sequences and therefore paved the way for the subsequent development of artificial RNA controls. The aim of the current study was to generate an encapsidated particle suitable for use as an in-tube internal control in diagnostic rRT-PCR assays for FMDV and SVDV. 2. Materials and methods 2.1. Generation of cassette containing primer sequences A schematic of the cassette containing the sequences of 3 diagnostic rRT-PCR assay primer pairs for FMDV (2 separate assays (Callahan et al., 2002; Reid et al., 2002)) and SVDV (Reid et al., 2004) flanking a probe sequence from the human beta-actin gene is shown in Fig. 1. For this study, two separate lengths of cDNA (64 and 295 bp designated EMS and EML, respectively) were generated. The rationale for the design of the larger construct was that amplification of this target by PCR should be kinetically less favourable, thereby reducing the potential of this template to compete with the viral target. These constructs were engineered sequentially by PCR using plasmid template (pASFVm (King et al., 2003)) containing the human beta-actin gene fragment. The initial round of PCR used a common for-

219

Fig. 1. Design of the artificial cassette containing primers (1F/1R: FMDV [5 UTR], 2F/2R: FMDV [3D] and 3F/3R: SVDV) for 3 diagnostic rRT-PCR assays flanking a unique sequence targeted by a fluorogenic probe. A schematic of the PCR products generated is shown. The construct was engineered into cDNA corresponding to the 3 end of the RNA-2 segment of CPMV immediately downstream of the polyprotein STOP codon (denoted by *, last 2 amino acid residues are also shown). After post-translational cleavage by proteinases encoded by RNA-1, 4 protein products are generated from CPMV RNA-2: a 58 kDA protein which is probably involved in replication, large [L] and small [S] coat proteins and a 48 kDa movement protein [MP].

ward primer (Round1-F: Table 1) and separate reverse primers (Round1-R-EMS and Round1-R-EML) for the separate EMS and EML cassettes. After clean-up (Qiaquick gel extraction kit, Qiagen, Crawley, UK), subsequent rounds of PCR used primers Round2-F and Round2-R (second round) and Round3-F and Round3-R (third round). This final round of PCR added cleavage sites for PstI and StuI to the 5 and 3 ends of the constructs, respectively (Fig. 1). These PCR products were subsequently ligated into pGEM-T easy (Promega, Southampton, UK) and used to transform DH5␣ (Invitrogen, Paisley, UK). Plasmid DNA were purified using a QIAprep spin minikit (Qiagen, Crawley, UK) and the presence of inserts of the appropriate size were confirmed by restriction enzyme digestion and sequencing (CEQ 8000, Beckman, High Wycombe, UK). 2.2. Transfer of cassettes into Agrobacterium vector (pBinP-NS-1) The artificial cassettes were excised from pGEM-T easy plasmid DNA with PstI and StuI and ligated into similarly digested pCP-CVW (Gopinath et al., 2000). This plasmid is derived from

Table 1 Sequences of oligo-nucleotide primers used for generation of recombinant CPMV and corresponding in vitro transcript Oligo name

Sequence (5 –3 )

Round1-F Round1-R-EMS Round1-R-EML Round2-F Round2-R Round3-F Round3-R IVT-F IVT-R

CGAGAAACCTAGTACCACCATGAATCACCCACACTGTGCCCATCTACG CAGATCCCGAGTGTCCCGTGTTAAGGTCTAGGCGCAGGGTGGCATG CAGATCCCGAGTGTCCCGTGTTACAGCGGAACCGCTCATTGCCAATGG ACTGGGTTTTACAAACCTGTGACGAGAAACCTAGTACCACCATGAA GCGAGTCCTGCCACGGACAGATCCCGAGTGTCGCGTGTTA TTTCTGCAGGGTAACACTTTAAGGTGACACTGATACTGGTACACTGGGTTTTACAAACCTGTGA AAAAGGCCTCGGTGACTCATCGACCTGATCGCGAGTCCTGCCACGGA CACCTTAAGGTGACACTGGTACTGGTACTCACCCACACTGTGCCCATCTACG CAGATCCCGAGTGTCCCGTGTTAAGGTCTAGGCGCAGGGTGGCATG

220

D.P. King et al. / Journal of Virological Methods 146 (2007) 218–225

Fig. 2. Panel A: the cloning strategy used to prepare the recombinant CPMV particles containing the artificial cassette. The identity of the parent plasmid is indicated in the centre of the vectors. Larger EML inserts contained additional sequence downstream of the fluorogenic probe site introduced during the first round PCR step of the construction process (position denoted by EML triangle). Panel B: the agarose-gel shows results of PCR analysis for 4 pGEM-T easy clones (EMS-11 and EMS-12 containing the 64 bp insert and EML-31 and EML-32 containing the 295 bp insert) using the 3 separate diagnostic primer sets (1F/1R, 2F/2R and 3F/3R: see Fig. 1). These amplicons were also detected using a fluorogenic TaqMan® probe targeting the middle of the construct (: see panel A) data not shown.

pUC9 and contains unique PstI and StuI restriction sites between the coding region and 3 UTR of CPMV RNA-2 (Fig. 2). After transformation of DH5␣, plasmids were purified (QIAprep spin minikit, Qiagen, Crawley, UK) and subjected to a further round of restriction enzyme digestion by EcoRI and BamHI. The fragments of approximately 2 kb were subsequently ligated into the pBINPLUS-based vector, pBinP-NS-1 (Liu et al., 2005) and were transformed into DH5␣ to give plasmids pBinP-EMS-11 and pBinP-EML-31. The presence of the desired inserts was verified using PCR and confirmed by sequence analysis (CEQ 8000, Beckman, High Wycombe, UK). 2.3. CPMV propagation and purification of recombinant particles Infections with modified CPMV were initiated using the technique of “agro-infiltration” as described by Liu and Lomonossoff (2002). In this method, separate suspensions of Agrobacterium tumefaciens containing RNA-1- and RNA-2based plasmids are co-infiltrated under the lower epidermis of cowpea plants (Vigna unguiculata). To achieve this, A. tumefaciens strain LBA4404 was transformed with plasmids pBinP-EMS-11 and pBinP-EML-31 by electroporation (Nagel et al., 1990). Cowpea plants were co-inoculated with bacteria containing the appropriate RNA-2-based plasmid in the presence of pBinPS1NT (containing a full-length cDNA copy of CPMV RNA-1: described in Liu et al. (2005)). For passaging, virus in the sap of agroinoculated leaves was first concentrated by precipitation with polyethylene glycol before applying the extract to further healthy cowpea plants (Mechtcheriakova et al., 2006). Virus particles (termed CPMV-EMS-11 or CPMV-EML31) were purified as described by van Kammen and de Jager

(1978) and, where required, the components containing RNA1 and RNA-2 were separated by centrifugation on Nycodenz (Nycomed, Oslo, Norway) gradients as previously described (Taylor et al., 1999). The RNA within the virus particles was characterised as previously described (Monger et al., 2006). 2.4. Use of recombinant CPMV in diagnostic rRT-PCR assays Preliminary experiments were performed to select the optimal concentration of the recombinant CPMV particles suitable for inclusion in the diagnostic rRT-PCRs. Dilutions of the CPMV material were prepared in a 10% bovine epithelium suspension and placed in TRIzol buffer (Invitrogen, Paisley, UK) prior to extraction of nucleic acid using an automated robot (MagNA PURE LC, Roche) with 500 ␮l of sample, as previously described (Reid et al., 2003). Total nucleic acid samples (eluted in 50 ␮l) were subsequently tested by rRT-PCR: briefly, cDNA was synthesised (MultiScribe reverse transcriptase, Applied Biosystems, Warrington, UK) using 6 ␮l of RNA in a total reaction volume of 15 ␮l (Reid et al., 2003) after which PCR reactions were performed using 3 previously reported diagnostic primer sets (Callahan et al., 2002; Reid et al., 2002, 2004). In addition to the FAM-TAMRA labelled probe used to detect the viral target, a second probe: 5 Yakima Yellow-CAT GCC ACC CTG CGC CTA GAC CT-3 Black-hole Quencher1 (Eurogentec, Southampton, UK) was included to detect the unique marker site (fragment of beta-actin gene) flanked by the primers present in the recombinant CPMV particles. PCR was performed in a 96-well format (MX4000, Stratagene, Amsterdam, The Netherlands) using amplification conditions and master mixes as previously reported (King et al., 2006). The

D.P. King et al. / Journal of Virological Methods 146 (2007) 218–225

HEX channel on the MX4000 machine was used to collect Yakima Yellow fluorescence data to monitor the amplification of the construct contained within the CPMV particles. CT (cycle threshold) values were assigned as previously described (Reid et al., 2002). In order to assess whether adding the recombinant CPMV influenced the analytical sensitivity of the diagnostic assays, experiments were performed using a titration series of FMDV. A 10-fold dilution series of a 10% suspension of epithelial tissue obtained from cattle inoculated with the reference FMDV isolate O1 Manisa (TUR 8/69) was prepared using an uninfected suspension of epithelium prepared from bovine tongue as diluent. After preparing the dilutions, samples were split into three parts: in two parts a constant concentration of either recombinant CPMV was added (giving similar rRT-PCR CT values); CPMV EMS-11 (to a final concentration of 20 ng/ml) or CPMV-EML31 (160 ng/ml), respectively, while in the final dilution series this volume was compensated by adding nuclease-free water. Samples were placed into TRIzol buffer after which total nucleic acid extraction and rRT-PCR was performed on these samples as described above. The performance of the diagnostic rRT-PCR assay including recombinant CPMV EMS-11 (20 ng/ml final concentration in sample) was compared to a parallel assay without the addition of the control. Thirty clinical samples comprising epithelium samples collected from suspect cases of FMDV (and three negative epithelium controls) were tested using a FMDV-specific rRT-PCR assay (Reid et al., 2003). The CPMV EMS-11 was added to these samples prior to nucleic acid extraction from TRIzol buffer (see above).

2.5. Stability of recombinant CPMV particles The stability of CPMV-EMS-11 over a 33-day period was investigated. Fifty-two aliquots were prepared containing 20 ng/ml of CPMV-EMS-11 (diluted in a 10% suspension of bovine epithelium). These were stored under room temperature conditions (range 20–26 ◦ C) and at 37 ◦ C for set periods of time, after which duplicate aliquots (at each time point) were placed into TRIzol storage buffer. At the end of the experiment, these samples were tested by rRT-PCR for all three diagnostic targets (as described in Section 2.4). Additional experiments were also performed to assess the sensitivity of the recombinant CPMV particles to RNase A treatment. CPMV-EMS-11 (200 ng/ml) diluted in nuclease-free water was incubated with 20 ␮g/ml RNase A (Ambion, Warrington, UK) for 90 min at 37 ◦ C. After treatment, material was placed into TRIzol reagent and RNA was extracted and tested by rRTPCR as described above. Results were compared with those obtained from an in vitro transcribed RNA (T7 Megascript kit, Ambion, Warrington, UK) generated from a pGEM-T easy plasmid. This plasmid (pFMDV-5 UTR) contained the sequences of the FMDV primers (5 UTR set (Reid et al., 2002)) and the actin gene insert. It was generated by PCR with primers IVTF and IVT-R (Table 1) using pASFVm (King et al., 2003) as template.

221

3. Results 3.1. Recovery of recombinant CPMV particles from cowpea plants Sequencing of the pGEM-T easy and pBINPLUS-based plasmids demonstrated that the EMS-11 and EML-31 cassettes contained the expected sequences. Cowpea plants inoculated with pBinP-EMS-11 or pBinP-EML-31 in the presence of pBinPS1NT (containing full-length RNA-1) did not develop any apparent symptoms. However, when a sap extract enriched for virus particles was used to inoculate further healthy cowpea plants, these developed chlorotic lesions on their inoculated leaves which were less severe and took longer to develop than those observed with wild-type CPMV. The upper, systemic leaves also developed symptoms but, once again, more slowly than those which developed after inoculation with wild-type virus. To bulk up the amount of material available, a second passage was performed using more plants. This resulted in symptoms developing which were similar to those observed from the first passage. Virus was extracted separately from the inoculated leaves and the systemically infected leaves. The yields from the inoculated leaves were 200 and 180 ␮g virus particles per gram fresh weight for CPMV-EMS-11 or CPMV-EML-31, respectively, while the corresponding yields from systemically infected leaves were 20 and 8 ␮g virus particles per gram fresh weight. The yield of EMS and EML particles from inoculated leaves is approximately 50% of that found with leaves inoculated with wild-type CPMV. However, the yield from systemic leaves is less than 10% of the equivalent yield from a wild-type infection. Sequence analysis of the RT-PCR products generated using RNA extracted from virus particles purified from the inoculated leaves of the second passage cowpea plants revealed that the inserted cassettes were intact in both CPMV-EMS11 and CPMV-EML-31. Similar analysis of particles extracted from systemically infected leaves showed that while the insert in CPMV-EMS-11 was intact, that from CPMV-EML-31 had undergone deletion. These deletions varied from leaf to leaf and were up to the size of the entire insert (data not shown). In light of these findings, virus extracted from the inoculated leaves from the second passage plants was used for all subsequent experiments. 3.2. Detection of recombinant CPMV by rRT-PCR Initial experiments using decimal titration series of CPMVEMS-11 and CPMV-EML-31 were performed to select appropriate working concentrations of the recombinant particles giving CT values of 30–35 for subsequent assays (data not shown). In these experiments, it was necessary to modify the cycling conditions for the larger PCR product generated with CPMV-EML-31 to include a 30 s chain extension step at 72 ◦ C since initial experiments generated poor signal with the original two-step programme (see Section 2.4). Control experiments were also performed removing the reverse-transcriptase (RT) from the RT incubation step. These reactions failed to gener-

222

D.P. King et al. / Journal of Virological Methods 146 (2007) 218–225

Fig. 3. Effect of recombinant CPMV on the sensitivity of the rRT-PCR for FMDV (targeting 5 UTR). A titration series of the FMDV reference strain O1 Manisa was assayed with () and without (䊉) the presence of recombinant CPMV-EMS-11 (A and C) or CPMV-EML-31 (B and D). Plots show the results for FMDV-specific assay (A and B) and recombinant CPMV-specific assay (C and D). Points shown represent mean CT ± range of duplicate determinations. No CT was detected in the Yakima Yellow channel in the absence of the recombinant CPMV particles.

ate a CT value, confirming that the signal obtained from the recombinant CPMV was RNA-derived. 3.3. Effect of CPMV particles on the sensitivity of the diagnostic rRT-PCR assay The effect of recombinant CPMV-EMS-11 and CPMV-EML31 (using a modified cycling programme, see above) upon the analytical sensitivity of the rRT-PCR for FMDV (targeting 5 UTR) is shown in Fig. 3. For both particles (used at 20 and 160 ng/ml for EMS and EML, respectively), no reduction of the sensitivity of a titration series of the reference FMDV isolate O1 Manisa was observed. CT values for the CPMV insert (detected with the Yakima Yellow probe) were consistent over the dilution series tested. Similar data for the performance of both CPMV controls was also obtained using a further rRT-PCR targeting 3D (RNA polymerase) of FMDV ((Callahan et al., 2002): data not shown). A panel of 30 clinical samples was tested by rRT-PCR targeting the 5 UTR: the CT values of reactions with and without the CPMV-EMS-11 control were compared in parallel (Fig. 4). For the 21 positive samples (where CT values were generated), there was no significant difference between the results obtained from the rRT-PCR assays with and without the addition of the recombinant CPMV (Student’s paired t-test: p = 0.21). For these 21 samples, mean ± S.D. CT values for the FAM channel were 25.98 ± 5.56 and 25.59 ± 5.85 with and without recombinant CPMV, respectively. In all these clinical samples CPMV-EMS11 insert was detected by rRT-PCR with mean CT value of

Fig. 4. Effect of recombinant CPMV-EMS-11 upon the detection of FMDV in clinical samples. A panel of 30 clinical samples was tested in parallel by rRTPCR (targeting the 5 UTR) with and without the addition of recombinant CPMV. The lines link paired results for individual samples. The dashed line (- - -) shows the CT cut-off (previously outlined in Reid et al., 2002) used to define positive samples.

D.P. King et al. / Journal of Virological Methods 146 (2007) 218–225

223

3.5. Testing of fractionated middle component CPMV-EMS-11 particles

Fig. 5. Stability of recombinant CPMV-EMS-11 particles held at room temperature (range 20–26 ◦ C). rRT-PCR CT values shown (± range of independent duplicates) are for the recombinant particles using the 3 primer sets (: FMDV 5 UTR; 䊉: FMDV 3D and : SVDV).

28.98 ± 2.69 (S.D.). Similar results for these samples were also generated using the rRT-PCR targeting FMDV 3D (data not shown). In addition, limited testing of 2 clinical samples obtained from SVDV infected animals produced CT values of 27.57 and 32.59 compared with 27.55 and 34.25 for reactions with and without CPMV-EMS-11, respectively. 3.4. Stability of recombinant CPMV particles The long-term stability of CPMV-EMS-11 particles held at room temperature for 33 days is shown in Fig. 5. Results for all 3 rRT-PCR assays indicated that there was no significant degradation of the encapsidated RNA since CT values were unchanged over this time period. Similar data was also obtained for incubation of the particles at 37 ◦ C (data not shown). CPMV-EMS-11 particles were also resistant to RNase A digestion (Fig. 6). Treatment of the CPMV particles resulted in a relatively modest reduction in signal generated (29.66 ± 0.23 for the control compared with 33.25 ± 1.05 after RNase treatment [mean CT values ± S.D.]). In contrast, RNase treatment had a dramatic effect on the comparable in vitro transcript: 18.23 ± 0.51 for the control which was reduced to 37.25 ± 0.94 after RNase treatment.

Fig. 6. Sensitivity of CPMV particles () and in vitro transcripts ( ) to RNase A treatment. Points shown represent mean CT ± standard derivation of 3 independent RNase A treatment experiments.

To reduce or eliminate the infectivity of the CPMV preparation, RNA-2 containing CPMV-EMS-11 middle component particles were purified by two rounds of centrifugation on Nycodenz gradients. As expected, these purified particles were unable to generate lesions after inoculation on to half-leaves of the local lesion host Phaseolous vulgaris (var. Pinto). By contrast, inoculation with the same concentration (2 ␮g/ml) of unfractionated CPMV-EMS-11 or wild-type CPMV yielded an average of 92 ± 19 and 111 ± 31 lesions/half-leaf. Thus, the infectivity of the isolated RNA-2-containing CPMV-EMS-11 particles was no more than 1% of the unfractionated material. Although these particles lack infectivity in plants, this material (at 38 ng/ml final concentration in a 10% epithelial suspension) was still detectable by rRT-PCR using the 3 primer sets generating CT values (for Yakima Yellow channel) of 34.50 ± 0.81, 35.05 ± 0.70 and 35.31 ± 0.77 (S.D.) for the FMDV 5 UTR, FMDV 3D and SVDV assays, respectively (n = 4 determinations for each assay). 4. Discussion In this study, encapsidated RNA particles were engineered and recovered from plants. These particles contained sequences (as RNA) corresponding to the primer binding sites of 2 diagnostic rRT-PCR assays for FMDV, and an assay used for the laboratory diagnosis of SVDV. The probe site targeted by the diagnostic assay for the virus was removed and replaced by an unrelated sequence (in this case a fragment from the human beta-actin gene) which was flanked by the primer sequences. Amplification of the internal control was detected in the rRTPCRs using a universal probe which targeted this actin sequence and was distinguished from the virus-specific assay by the use of 2-colour fluorogenic probes. These particles were evaluated for use as in-tube internal controls for the rRT-PCR assays by monitoring the presence of substances that are inhibitory to the rRT-PCR, thereby validating negative assay results. Encapsidation by CPMV of the RNA protects the template from degradation. In addition to increased stability, the requirement for extraction of the template RNA from within the CPMV capsid provides a quality control for the RNA extraction step of the assay. Two separate cassettes of different sizes (64 and 295 nt) were produced. The initial rationale for the design of the larger construct (CPMV-EML) was that amplification of this target by PCR should be kinetically less favourable. Therefore, it was considered that the potential of this template to compete with the viral target in the assays should be lower. Unfortunately results from evaluation experiments showed that the larger CPMV-EML-31 was unsuitable for use in the assays since modification of the cycling programme was required to generate robust signal in the rRT-PCR. However, successful recovery of this insert from the inoculated leaves of the second passage plants indicates that relatively large constructs can be engineered into the RNA-2 of CPMV. This is consistent with previous findings with translat-

224

D.P. King et al. / Journal of Virological Methods 146 (2007) 218–225

able constructs (Gopinath et al., 2000; Mechtcheriakova et al., 2006; Monger et al., 2006) and the initial results using a 500 bp fragment of FMDV 5 UTR cDNA (see Section 1). The particles are also suitable for conventional (agarose-gel based) RT-PCR assays where amplification of internal control (of larger size) could be distinguished by gel electrophoresis. Particles containing the smaller construct (CPMV-EMS-11) were evaluated for use in the diagnostic rRT-PCR assays using clinical samples obtained from field cases of FMD and SVD. Using previously optimised assay conditions (Callahan et al., 2002; Reid et al., 2002, 2004), the construct contained within these particles was reliably detected and did not detrimentally affect the analytical sensitivity of the assays to detect FMDV or SVDV in the clinical samples. The RNA within the CPMV particles were shown to be extremely stable at both room temperature and 37 ◦ C in the presence of bovine tongue tissue homogenate representative of a sample milieu that might be received in the laboratory. Furthermore, these particles had considerably greater resistance to RNAse A digestion in comparison with in vitro transcripts containing the same primer and probe recognition sequences. In the United Kingdom, no specific licence is required to handle CPMV in a laboratory environment. To cause an infection, CPMV needs to be mechanically inoculated on to susceptible plants either through deliberate use of an abrasive or through their natural vectors, leaf-feeding beetles. Neither the plants nor the vectors are likely to be present in a diagnostic laboratory and the virus can not be transmitted through aerosols. As an extra precaution, this paper describes the purification of CPMV RNA-2-containing capsids by centrifugation on Nycodenz gradients which exploit the difference in density between the RNA-1- and RNA-2-containing particles. Preparations of RNA-2-containing particles are non-infectious, since RNA-2 is completely dependent for its replication on the simultaneous presence of RNA-1. Indeed, this study shows that RNA-2containing particles purified by two rounds of centrifugation have no detectable infectivity by the standard local lesion assay. Since these separated RNA-2-containing particles are noninfectious, they are probably more suited to routine diagnostic assays than unfractionated virus. Therefore, risk to the environment of these recombinant CPMVs (particularly RNA-2 purified fraction) is low. However, local GMO risk assessment and good laboratory practice should be employed before considering the use of these controls in diagnostic assays. An alternative approach to CPMV has been developed previously for use in routine assays using the bacteriophage MS2 to protect RNA targets (Pasloske et al., 1998). In addition to validating negative results, these internal controls have been used to monitor the sensitivity of the diagnostic assay (Beld et al., 2004). Further to their use as internal controls for rRTPCR assays (Beld et al., 2004; Das et al., 2006), these particles have also been used as surrogate viruses and standards for interlaboratory proficiency testing (Hietala and Crossley, 2006). The RNA packaged within these so-called “armored” RNA particles was found to be highly resistant to RNase digestion, and the RNA could be extracted from the coat protein by conventional methods. Therefore, both CPMV and MS2 particles

possess similar advantages over in vitro transcribed RNA. MS2 phage particles can be obtained from commercially sources (http://www.asuragen.com/), although their high price is currently prohibitive for most custom diagnostic applications. In common with the internal controls based on bacteriophage MS2, the CPMV particles do not provide information relating to the quality of the RNA template present in the sample material. Therefore, even in the event of a positive signal with the internal control it is still possible that a false negative result may arise if the RNA template of the sample encompassing the virus is severely degraded. For exotic viruses such as FMDV, which is endemic in areas of Asia and Africa distant from centralised laboratories, the quality of the sample when received for testing can be a particular concern. Assays are currently under evaluation utilising control rRT-PCR reactions run in parallel to detect “house keeping” genes that confirm the integrity of host RNA template in the clinical material. Together with internal controls, these approaches can be used to provide confidence in the results generated by diagnostic rRT-PCR assays. In summary, an encapsidated particle with structural similarities to mammalian picornaviruses (such as FMDV, SVDV and various human viruses such as rhinoviruses, poliovirus and coxsackie viruses) has been developed with the goal of improving quality control of diagnostic rRT-PCR assays. This particle has been shown to be a useful tool to validate the results generated by diagnostic rRT-PCRs and can play an important role in the quality control of these assays. The technology described in this report is appropriate for other RNA viruses including those that infect humans, particularly non-enveloped picornaviruses and related viruses. Acknowledgements This work was funded by DEFRA project SE1121, EU project LAB-ON-SITE (SSPE-CT-2004-513 645) and the BBSRC. References Anon., 2006. Validation and quality control of polymerase chain reaction methods used for the diagnosis of infectious diseases. In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. OIE, Paris (Chapter I.1.4). Ballagi-Pordany, A., Belak, S., 1996. The use of mimics as internal standards to avoid false negatives in diagnostic PCR. Mol. Cell. Probes 10, 159–164. Belak, S., Thoren, P., 2001. Molecular diagnosis of animal diseases: some experiences over the past decade. Expert Rev. Mol. Diagn. 1, 434–443. Beld, M., Minnaar, R., Weel, J., Sol, C., Damen, M., van der Avoort, H., Wertheim-van Dillen, P., van Breda, A., Boom, R., 2004. Highly sensitive assay for detection of enterovirus in clinical specimens by reverse transcription-PCR with an armored RNA internal control. J. Clin. Microbiol. 42, 3059–3064. Callahan, J.D., Brown, F., Osorio, F.A., Sur, J.H., Kramer, E., Long, G.W., Lubroth, J., Ellis, S.J., Shoulars, K.S., Gaffney, K.L., Rock, D.L., Nelson, W.M., 2002. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. J. Am. Vet. Med. Assoc. 220, 1636–1642. Das, A., Spackman, E., Senne, D., Pedersen, J., Suarez, D.L., 2006. Development of an internal positive control for rapid diagnosis of avian influenza virus infections by real-time reverse transcription-PCR with lyophilized reagents. J. Clin. Microbiol. 44, 3065–3073.

D.P. King et al. / Journal of Virological Methods 146 (2007) 218–225 Gopinath, K., Wellink, J., Porta, C., Taylor, K.M., Lomonossoff, G.P., van Kammen, A., 2000. Engineering cowpea mosaic virus RNA-2 into a vector to express heterologous proteins in plants. Virology 267, 159–173. Heath, G.S., King, D.P., Turner, J.L.E., Wakeley, P.R., Banks, M., 2003. Use of an internal standard in a TaqMan® nested reverse transcription-polymerase chain reaction for the detection of bovine viral diarrhoea virus. Vet. Microbiol. 96, 357–366. Hietala, S.K., Crossley, B.M., 2006. Armored RNA as virus surrogate in a realtime reverse transcriptase PCR assay proficiency panel. J. Clin. Microbiol. 44, 67–70. Hoffmann, B., Depner, K., Schirrmeier, H., Beer, M., 2006. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses. J. Virol. Methods 136, 200– 209. King, D.P., Reid, S.M., Hutchings, G.H., Grierson, S.S., Wilkinson, P.J., Dixon, L.K., Bastos, A.D.S., Drew, T.W., 2003. Development of a TaqMan® PCR with internal amplification control for the detection of African swine fever virus. J. Virol. Methods 107, 53–61. King, D.P., Ferris, N.P., Shaw, A.E., Reid, S.M., Hutchings, G.H., Giuffe, A.C., Robida, J.M., Callahan, J.D., Nelson, W.M., Beckham, T.R., 2006. Detection of foot-and-mouth disease virus: comparative diagnostic sensitivity of two independent real-time RT-PCR assays. J. Vet. Diagn. Invest. 18, 92– 96. Liu, L., Ca˜nizares, M.C., Monger, W., Perrin, Y., Tsakiris, E., Porta, C., Shariat, N., Nicholson, L., Lomonossoff, G.P., 2005. Cowpea mosaic virus-based systems for the production of antigens and antibodies in plants. Vaccine 23, 1788–1792. Liu, L., Lomonossoff, G.P., 2002. Agroinfection as a rapid method for propagating cowpea mosaic virus-based constructs. J. Virol. Methods 105, 343– 348. Mechtcheriakova, I.A., Eldarov, M.A., Nicholson, L., Shanks, M., Skryabin, K.G., Lomonossoff, G.P., 2006. The use of viral vectors to produce hepatitis B virus core particles in plants. J. Virol. Methods 131, 10– 15.

225

Monger, W., Alamillo, J.M., Sola, I., Perrin, Y., Bestagno, M., Burrone, O.R., Sabella, P., Plana-Duran, J., Enjuanes, L., Garcia, J.A., Lomonossoff, G.P., 2006. An antibody derivative expressed from viral vectors passively immunizes pigs against transmissible gastroenteritis virus when supplied orally in crude plant extracts. Plant Biotechnol. J. 4, 623–631. Nagel, R., Elliot, A., Masel, A., Birch, R.G., Manners, J.M., 1990. Electroporation of binary Ti plasmid vector into Agrobacterium tumefaciens and Agrobacterium rhizogenes. FEMS Microbiol. Lett. 67, 325–328. Pasloske, B.L., Walkerpeach, C.R., Obermoeller, R.D., Winkler, M., DuBois, D.B., 1998. Armored RNA technology for production of ribonucleaseresistant viral RNA controls and standards. J. Clin. Microbiol. 36, 3590–3594. Reid, S.M., Ferris, N.P., Hutchings, G.H., Zhang, Z., Belsham, G.J., Alexandersen, S., 2002. Detection of all seven serotypes of foot-and-mouth disease virus by real-time, fluorogenic reverse transcription polymerase chain reaction assay. J. Virol. Methods 105, 67–80. Reid, S.M., Grierson, S.S., Ferris, N.P., Hutchings, G.H., Alexandersen, S., 2003. Evaluation of automated RT-PCR to accelerate the laboratory diagnosis of foot-and-mouth disease virus. J. Virol. Methods 107, 129–139. Reid, S.M., Ferris, N.P., Hutchings, G.H., King, D.P., Alexandersen, S., 2004. Evaluation of real-time reverse transcription polymerase chain reaction assays for the detection of swine vesicular disease virus. J. Virol. Methods 116, 169–176. Taylor, K.M., Spall, V.E., Butler, P.J.G., Lomonossoff, G.P., 1999. The cleavable carboxyl terminus of the small coat protein of cowpea mosaic virus is involved in RNA encapsidation. Virology 255, 129–137. van Kammen, A., de Jager, C.P., 1978. Cowpea mosaic virus. CMI/AAB Descriptions of Plant Viruses No. 197. Westcott, D.G., King, D.P., Drew, T.W., Nowotny, N., Kindermann, J., Hannant, D., Bel´ak, S., Paton, D.J., 2003. Use of an internal standard in a closed onetube RT-PCR for the detection of equine arteritis virus RNA with fluorescent probes. Vet. Res. 34, 165–176.