Denaturinggradientgel electrophoresisto diagnosemultipleendocrine neoplasiatype 2

Clinical Chemistry 598-603

42:4

(1996)

Denaturing gradient gel electrophoresis to diagnose multiple endocrine neoplasia type 2 ROBERT

D.

BLANK,l,2,3*

A.

CHARLES

SKLAR,4

and

MELISSA

L.

MARTIN2

Multiple endocrine neoplasia type 2 (MEN 2) is an autosoma! dominant cancer syndrome caused by mutations in the RET protooncogene. Others have already demonstrated the value of genetic testing in known MEN 2 kindreds. Previ-

In the MEN 2A syndrome, pheochromocytomas and hyperparathyroidism also develop in -50% and 20% of affected individuals, respectively. In the MEN 2B syndrome, MCT and pheochromocytomas develop in patients who have a characteristic

ously described approaches to DNA-level diagnosis, particularly of index cases, are tedious. We developed appropriate denaturing gradient gel electrophoresis (DGGE) conditions for analysis of exons 10, 11, and 16 of this gene, where many of the pathogenic mutations map. We screened 16 members of a three-generation MEN 2 kindred by DGGE and found five affected but still asymptomatic patients, ranging in age from 5 to 67 years. We used DGGE to localize the pathogenic mutations and screen at-risk individuals in several other kindreds. DGGE-which requires no radioactive, fluorescent, or chemiluminescent labeling-is ideally suited to the diagnosis of MEN 2 because of the syndrome’s dominant genetics and the rarity of clinically silent variants in the RET gene.

body habitus and multiple ganglioneuromata of both the enteric nervous system and mixed peripheral nerves [2, 3].

INDEXING

Hirschsprung

TERMS:

disease

neurocristopathy #{149} mutational

thyroid

.

neoplasms

Genetic tests for MEN 2 have recently been developed to simplify the screening of individuals from affected kindreds whose mutation is known. Most of these feature the use of altered restriction sites to allow the detection of specific pathogenic mutations in the RET protooncogene [4-7]. This approach, while extremely useful when a restriction site is altered, is limited by the fact that some pathogenic mutations do not result in such an alteration [4]. Moreover, assessing new patients for the presence of pathogenic RET mutations requires other means. Investigation of these individuals is a time-consuming and labor-intensive task. In this study, we report the development of denaturing gradient gel electrophoretic (DGGE) assays for exons 10, 11, and 16 of the RET gene and demonstrate the utility of this method in diagnosing individuals in MEN 2 kindreds. Using DGGE, we localized the RET mutations in the index case of a new MEN 2B kindred and in a previously uncharacterized kindred with familial MCT. We were also able to provide rapid

.

analysis

Multiple endocrine neoplasia type 2 (MEN 2) is a group of autosomal dominant disorders that include familial medullary carcinoma of the thyroid (MCT), MEN 2A, and MEN 2B.5 MEN 2 is characterized by hyperplasia of the calcitoninsecreting C cells of the thyroid [1]. These hyperplastic C cells frequently undergo malignant transformation to MCT in affected individuals. In familial MCT, no other tumors develop.

diagnosis of five asymptomatic members of a family with MEN 2A. We anticipate that DGGE methodology will greatly facilitate the identification of familial disease among new index cases of MCT.

Matenals and Methods DNA extraction. Peripheral

Division of Endocrinology, Departments of Medicine and ‘ Pediatrics, Memorial Sloan-Kettering Cancer Center, 1275 York Ave., New York. NY 10021. 2 Division of Endocrinology, Depamnent of Medicine, New York Hospital,

525 E. 68 St., New York, NY 10021. ‘Rockefeller University, ‘Mdress correspondence

Box 305, 1230 York Ave., New York, NY 10021. to this author, at Rockefeller University address. Fax

and SSCP, January

single-strand

(5 mL) from each patient

was

PCR amplfication.PCR reactions were performed in 50-.tL volumes in a Perkin-Elmer (Norwalk, CT) 480 thermal cycler. All reactions were cycled (94 #{176}C for I mm, Tannealing for 1 mill, 72 #{176}C for 1 mm) for 35 cycles, followed by a 10-mm incubation at 72 #{176}C. PCR primers, annealing temperatures, magnesium

212-327-7420, e-mail rdblank’@mail.med.cornell.edu. ‘Nonstandard abbreviations: MEN 2, multiple endocrine neoplasia type 2; MCT, medullary carcinoma of the thyroid; DGGE, denaturing gradient gel electrophoresis; TBE, Tris-borate-EDTA; elonal polymorphism. Received November 7, 1995; accepted

blood

collected in EDTA-containing tubes, and the DNA was purified with the QIAGEN (Chatsworth, CA) blood extraction kit as recommended by the manufacturer. DNA was resuspended in Tris-EDTA buffer (10 mmol/L Tris, pH 8.0, 1 mmol/L EDTA) at a concentration of 50-200 mg/L and stored at 4 #{176}C.

conforma-

15, 1996.

598

Clinical Chemistry

Table 1. Primers Primers

Exon

10

GCGCCCCAGGAGGCTGAGTG

42, No. 4, 1996

599

and PCR conditions. t.,,

#{176}C

mmol/L

Reference

65

1.5

8

60

1.0

8

60

1.5

This study

65

1.5

9

60

1.0

10

CGTGGTGGTCCCGGCCGCC Clamp-CGTGGTGGTCCCGGCCGCC 11

CCTCTGCGGTGCCAAGCCTC ClampaCCTCTGCGGTGCCAAGCCTC CACCGGAAGAGGAGTAGCTG Double clamp GAGAAGAGGACAGCGGCTGC

13

CTCTCTGTCTGAACTtGGGC TCACCCTGCAGCAGGCCTtA

16

AGGGATAGGGCCTGGGCTC Clamp-AGGGATAGGGCCTGGGCTFC

Clamp Double clamp

TAACCTCCACCCCAAGAGAG CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCG CCGCGCCCCGCCCGCCCCGCGCGCGCCGCCCGCCGCGCCCCGCGCCCGTC

11

FinaI 6 bases of clamp omitted for this primer. 5Sond step of two-step, heminested PCR for exon 11.

concentrations, and product lengths are listed in Table 1. Amplification reactions were carried out in 50 .tL of 10 mmol/L Tris (pH 8.3 at room temperature) containing 50 mmol/L KG!, 0.1 g/L gelatin, 0.2 mmol/L of each dNTP, and 50 ng of DNA. PCR products were purified from agarose gels with the QIAEX (QIAGEN) gel extraction kit as recommended by the manufacturer. Exon 11 products for DGGE were prepared in two rounds of PCR: The first round used the clamped forward and unclamped reverse primer designed by Donis-Keller et a!. [8]. Purified product from this amplification was reamplified by using the double-clamp primer and an internal reverse primer that lies 5’ to a neutral polymorphism in this exon. Restriction digests. Restriction from New England Biolabs Mannheim (Indianapolis, IN). 20-pt volumes of the buffers Digests included 100-500 ng 0.5-2 U of enzyme. Incubations for BstUl, which was incubated

endonucleases were purchased (Beverly, MA) or Boehringer Digestions were carried out in supplied by the manufacturers. of purified PCR product and were for 2-16 h at 37 #{176}C except at 60 #{176}C.

DNA sequencing. Direct sequencing

of PCR products was carried out with the Taquence (US Biochemicals, Cleveland, OH) kit and use of 32P as recommended by the manufacturer. Electrophoresis of sequencing ladders was carried out in 8% polyacrylamide gels containing 7 mol/L urea with 1 x TBE buffer (89 mmol/L Tris, 89 mmol/L boric acid, and 2 mmol/L EDTA, pH 8.3 at 25 #{176}G) at a constant power of 70 W.

DGGE. Gels were 8% polyacrylamide (acrylamide:bisacrylamide 19:1 by wt.) in 0.5x TBE and were used within 3 h of casting. DGGE was performed in a Bio-Rad (Hercules, CA) Miniprotean apparatus at 45 V for 3-5 h. The 100% denaturant was 7 mollL urea + 10 mol/L (40% by vol) formamide. Intermediate denaturants were prepared by diluting 100% de-

naturant with 8% acrylamide in 0.5x TBE. In all experiments, we used 1.5-mm spacers, which resulted in a gel volume of -9 mL. Gradients were prepared bottom-up by gravity flow in a 20-mL gradient maker with 5 mL of each acrylamide solution. Details of the conditions used for each exon of RET are summarized in Results. Samples were heated to 95 #{176}C for 5 mm and allowed to cool to room temperature for 15 mm before loading. Samples were visualized by staining in ethidium bromide and using ultraviolet transillumination. Results We undertook DNA-level analysis of the RET gene in members of known MEN 2 kindreds and in patients in whom the existence of familial disease was uncertain. Because -90-95% [12] of the mutations causing MEN 2 had previously been found in exons 10, 11, 13, and 16 of the RET gene [8, 10, 13-15], we limited our analysis to these four exons. Full discussion of the molecular and clinical features of MEN 2 in this patient population will be presented elsewhere. After extracting DNA from the peripheral blood from each patient and at-risk individual, we carried out PCR amplification and direct sequencing of the PCR products for each kindred’s index case and for each sporadic patient. Both strands of the PCR products were sequenced. As we developed the DGGE assays, we used these assays as the initial screen for their respective exons. The presence and the absence of mutations were confirmed by restriction digestion. Additional members of known kindreds were screened by DGGE or restriction digestion. We confirmed RET genotypes for all individuals by repeating the genotyping with complementary methods. DEVELOPMENT

OF DGGE

ASSAYS

FOR

RET GENE

Because of the substantial effort required the RET gene by direct sequencing, we reliable method with which we could rapidly. DGGE, which detects differences

MUTATIONS

to seek mutations in sought to develop a find mutations more in the melting behav-

Blank et a!.: DGGE

600

to diagnose

multiple

endocrine

neoplasia

type 2

Fig. 1. DGGE assays and 16.

for RET exons 10, 11,

Lanes are numbered from left to right. (A) Exon 10: 20-60% gradient run at 60 C. Lane 1, C620F; lane2, wild type; lane 3, C620R. (B) Exon 11: 0-50% gradient run at 68 #{176}C. Lane 1, C634Y; lane 2. wild type; lane 3, C634R. (C) Exon 16: 0-50% gradient run at 60 ‘C. Lane 1, M918T; lane 2. wild type.

ior of PCR

products

as they

migrate

through

a gradient

result in four products: wild-type and mutant homoduplexes, and two heteroduplexes (wild-type coding strand and mutant coding strand). In particular, the heteroduplexes will have nonhomologous “bubbles” present at the site of the mutation. The bubbles in the heteroduplexes result in their having a lower melting temperature than the homoduplexes. Consequently, an affected individual will display two to four bands on DGGE, one for each DNA species. In contrast, normal subjects will display only a single band, as their PCR products contain only wild-type homoduplex DNA. This difference in pattern is dramatic and evident. Thus far, we have found appropriate DGGE conditions for the detection of mutations in exons 10, 11, and 16, as shown in Fig. 1. We used the primer program [17] to estimate the melting behavior annealing

Discussion

of

formamide and urea in a polyacrylamide gel matrix [16], appeared to be an appropriate technique for this use [11]. Because affected individuals are heterozygotes, amplification of the mutated exon of the RET gene, denaturation, and annealing will

of each PCR product by processively calculating the temperature of 20-hp windows. This analysis revealed

MOLECULAR

PATHOLOGY

OF THE

RET GENE

The evidence is compelling that mutations of the RET protooncogene cause MEN 2. Genetic studies had demonstrated that the autosomal dominant locus causing MEN 2 was closely linked to RET on chromosome lOq [18-20]. A limited set of germline mutations in RET have been found in -95% of MEN 2 kindreds, and several of these mutations have been found in sporadic MCTs. Documentation of new RET mutations and de novo MEN 2 [21-23] also provides compelling evidence establishing RET mutation as the molecular lesion underlying MEN 2. Most cases of MEN 2A and familial MTC are caused by substitution of cysteine by another amino acid at one of five sites near the transmembrane segment of the affected protein [8, 15, 24, 25]. MEN 2B kindreds and one kindred with familial MTC carry germline missense mutations at two sites within RETs kinase domain [10, 13, 14, 20, 26]. Mutations at these seven sites account for nearly all MEN 2 cases [12, 27]. RET mutations also cause an autosomal dominant form of Hirschsprung disease, in which a segment of bowel lacks innervation; this presents clinically as intestinal obstruction in infancy. Mutations in Hirschsprung disease span the entire RET

that residue 634 is contained within an unusually high meltingpoint region of the RET gene. This fact required that we use a 61/62-base GG clamp and a higher gel temperature to detect mutations at this site. We used a two-step to incorporate this “double” GC clamp. APPLICATION

We

OF DGGE

used the exon

TO

amplification

A THREE-GENERATION

10 DGGE

assay to test

protocol

KINDRED

16 members

of a

family carrying the C620R mutation, as shown in Fig. 2. Five of the individuals diagnosed with MEN 2 in this family were asymptomatic on presentation; that is, they were first diagnosed on the basis of the DGGE results. These results were in perfect concordance with those obtained by BstUI digestion (data not shown), which cleaves mutant but not wild-type exon 10. One of these five asymptomatic individuals was in fact an obligate affected individual, her son being clinically affected with Hirschsprung disease and MCT. Exclusion of disease is also important. Excluded individuals need not undergo further assessment for the development of any MEN

2-associated

developing

MEN

tumors, 2.

and their progeny

are not at risk of

Fig. 2.

Pedigree

of family with C620R.

The arrow indicates the index case. Filling of symbols is as follows: upper left = medullary carcinoma of the thyroid, upper right = pheochromocytorna, lower left = hyperparathyroidism, and lower right = Hirschsprung disease. Note that affected status is defined by clinical presentation at the time of genetic testing. not by the results of biochemical testing, so newly diagnosed cases are shown by open symbols.

Clinical Chemistiy

gene and include nonsense, frameshift, and deletion mutations Rarely, Hirschsprung disease and MEN 2A are both present in a single kindred. These families have been found to carry mutations characteristic of MEN 2A [31].

[9, 28-30].

CLINICAL

FEATURES

OF MEN

2 AND

SCREENING

ISSUES

The tumors classified as MEN 2 may occur either as components of the syndrome or as sporadic neoplasms-and the clinician must be able to distinguish between these. Various features, including pathological findings and age of onset, help to distinguish familial from sporadic disease but are far from absolute criteria for doing so [32-36]. The increase of stimulated calcitonin concentrations [37] is limited by age-dependent sensitivity [34] and the occurrence of C cell hyperplasia in individuals for reasons unrelated to MEN 2 [5, 38, 39]. Genetic methods overcome most limitations of the combined use of clinical and biochemical methods for diagnosing MEN 2. In the case of members of known MEN 2 kindreds, one must determine only whether the pathogenic mutation is present in the at-risk individual. A search for pathogenic mutations need be performed only once for each kindred. Thus far, -95% of families with MEN 2 have had one of several characteristic mutations in exon 10, 11, 13, or 16 of the RET gene. Availability of an improved assay for these mutations would simplify genetic diagnosis of the familial disease. We have achieved this by establishing the conditions for DGGE of exons 10, 11, and 16. DGGE

COMPARED

DIAGNOSIS

OF

WITH MEN

OTHER

APPROACHES

TO

GENETIC

2

DGGE

is ideally suited for diagnosis of MEN 2 for several reasons. First, very few neutral polymorphisms are known in these exons [40, 41]. Second, the dominant genetics of the syndrome means that virtually all affected individuals are heterozygotes, which allows formation of heteroduplexes on PCR amplification of DNA from affected individuals. The heteroduplexes have early melting nonhomologous bubbles that are readily apparent on DGGE. The presence of these heteroduplexes greatly simplifies the distinction of affected individuals, who display multiple bands on DGGE, from normal subjects, who display a single band on DGGE. Moreover, DGGE does not require the use of fluorescent, chemiluminescent, or radioactive labeling for performance of the assay. These features, together with the technical ease of performing an established assay, make this an attractive method for use in clinical settings. The sensitivity of DGGE in detecting single-base substitutions is -95% when performed with GC-clamping and PCR products 90% of MEN 2 cases. DGGE is particularly well suited to the diagnosis of this syndrome because of the dominant genetics involved and low prevalence of neutral polymorphism, and because of the sensitivity and ease of performance and interpretation of the assay. These tnethods allow detection of most currently known pathogenic mutations in a simple, rapid assay without the use of radioactive, fluorescent, or chemiluminescent labels. They are suitable for both investigating members of known kindreds and seeking pathogenic mutations in new index cases.

Blank et a!.: DGGE

602

We thank

the patients

who participated

to diagnose

multiple

in this study and their

physicians. Special thanks go to Julianne Imperato-McGinley, Murray Brennan, Jeffrey Friedman, and John Hall. This work was supported in part by the Feer-Crawer Fund, Memorial Sloan-Kettering Cancer Center. R.D.B. was supported by NIH NRSA award F32-HG00084.

17.

18.

References 1. Wolfe Hi, Melvin KEW, Cervi-SkinnerSJ, Al Saadi AA, Juliar iF, Jackson CE, et al. C-cell hyperplasia preceding medullary thyroid

19.

carcinoma. N EngI J Med 1973:289:437-41. 2. Carney IA, Go VLW, Sizemore GW, Hayles AB. Alimentary-tract ganglioneuromatosis: a major component of the syndrome of multiple endocrine neoplasia, type 2b. N EngI i Med 1976;295:

20.

1287-91.

3. Camey JA, Hayles AB. Alimentary tract manifestations of multiple endocrine neoplasia, type 2b. Mayo Clin Proc 1977;52:543-8. 4. Chi DO, Toshima K, Donis-Keller H, Wells SA Jr. Predictive testing for multiple endocrine neoplasia type 2A (MEN 2A) based on the detection of mutations in the RET protooncogene. Surgery 1994; 116:124-33. 5. McMahon R, Mulligan LM, Healey CS, Payne Si, Ponder M, Ferguson-Smith

6.

7.

8.

9.

MA, et al. Direct,

non-radioactive

11. 12.

13.

14.

22.

detection of 2A families. Hum

mutations in multiple endocrine neoplasia type Mol Genet 1994;3:643-6. Wells SAJ, Chi DO. Toshima K. Dehner LP, Coffin CM, Dowton SB, et al. Predictive DNA testing and prophylactic thyroidectomy in patients at risk for multiple endocrine neoplasia type 2A. Ann Surg 1994:220:237-50. Xue F, Yu H, Maurer LH, Memoli VA, Nutile-McMenemy N, Schuster MK, et al. Germline RET mutations in MEN 2A and FMTC and their detection by simple DNA diagnostic tests. Hum Mol Genet 1994; 3:635-8. Donis-Keller H, Dou S, Chi 0, Carlson KM, Toshima K, Lairmore TC, et al. Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. Hum Mol Genet 1993:2:851-6. Romeo G, Ronchetto P, Luo Y, Barone V, Sen M, Cecchenini I, et al. Point mutations affecting the tyrosine kinase domain of the RET proto-oncogene in Hirschsprung’s disease. Nature 1994;367: 377-8.

10.

21.

Hofstra RMW, Landsvater RM, Ceccherini I, Stulp RP, Stelwagen T, Luo Y, et al. A mutation in the RET proto-oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullary thyroid carcinoma. Nature 1994;367:375-6. Grompe M. The rapid detection of unknown mutations in nucleic acids [Reviewl. Nature Genet 1993;5:111-7. Ledger GA, Khosala 5, Lindor NM, Thibodeau SN, Gharib H. Genetic testing in the diagnosis and management of multiple endocrine neoplasia type II. Ann Intern Med 1995;122:118-24. Carlson KM, Dou 5, Chi 0, Scavarda N, Toshima K, Jackson CE, et al. Single missense mutation in the tyrosine kinase catalytic domain of the RET protooncogene is associated with multiple endocrine neoplasia type 2B. Proc Nati Acad Sci U S A 1994;91: 1579-83. Eng C, Smith DP, Mulligan LM, Healey CS, Zvelebil Mi, Stonehouse Ti, et al. A novel point mutation in the tyrosine kinase domain of the RET proto-oncogene in sporadic medullary thyroid carcinoma and in a family with FMTC. Oncogene 1995:10:509-

23.

24.

25.

27. 28.

29.

30.

31.

32.

Mulligan LM, Kwok JBJ, Healey CS, Elsdon Mi, Eng C, Gardner E, et al. Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature 1993;363:458-60. 16. Sheffield VC, Cox OR, Lerman LS, Myers RM. Attachment of a

33.

34.

neoplasia

type 2

40-base-pair G+C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc NatI Acad Sci U S A 1989;86:232-6. Lincoln SE, Daly MJ, Lander ES. Primer: a computer program for automatically selecting PCR primers (version 0.5). Cambridge, MA: Whitehead Institute for Biomedical Research, 1991. Lairmore IC, Howe iR, Korte JA, Dilley WG, #{194}me L, Aine E, et al. Familial medullary thyroid carcinoma and multiple endocrine neoplasia type 28 map to the same region of chromosome 10 as multiple endocrine neoplasia type 2A. Genomics 1991;9:181-92. Mole SE, Mulligan LM, Healey CS, Ponder BAJ, Tunnacliffe A. Localisation of the gene for multiple endocrine neoplasia type 2A to a 480 kb region in chromosome band lOqll.2. Hum Mol Genet 1993;2:247-52. Norum RA, Lafreniere RG, O’Neal LW, Nikolai TF, Delaney iP, Sisson iC, et al. Linkage of the multiple endocrine neoplasia type 2B gene (MEN2B) to chromosome 10 markers linked to MEN2A. Genomics 1990:8:313-7. Eng C, Smith DP, Mulligan LM, Nagai MA, Healey CS, Ponder MA, et al. Point mutation within the tyrosine kinase domain of the RET proto-oncogene in multiple endocrine neoplasia type 2B and related sporadic tumours. Hum Mol Genet 1994:3:237-41. Mulligan LM, Eng C, Healey CS, Ponder MA, Feldman GL, Li P, et al. A de novo mutation of the RET proto-oncogene in a patient with MEN 2A. Hum Mol Genet 1994:3:1007-8. Zedenius i, Wallin G, Hamberger B, Nordenskjold M, Weber G, Larsson C. Somatic and MEN 2A de novo mutations identified in the RET proto-oncogene by screening of sporadic MTCs. Hum Mol Genet 1994;3:1259-62. Schuffenecker I, Billaud M, Calender A, Chambe B, Ginet N, Calmettes C, et al. RET proto-oncogene mutations in French MEN 2A and FMTC families. Hum Mol Genet 1994;3:1939-43. Takiguchi-Shirahama 5, Koyama K, Miyauchi A, Waksugi T, Oishi 5, Takami H, et al. Germline mutations of the RET proto-oncogene in eight Japanese patients with multiple endocrine neoplasia type 2A (MEN2A).

26.

13.

15.

endocrine

Hum

Genet

1995:95:187-90.

Rossel M, Schuffenecker I, Schlumberger M, Bonnardel C, Modigliani E, Gardet P, et al. Detection of a germline mutation at codon 918 of the RET proto-oncogene in French MEN 2B families. Hum Genet 1995:95:403-6. van Heyningen V. One gene-four syndromes [Reviewl. Nature 1994:367:319-20. Attie T, Pelet A, Sarda P, Eng C, Edery P, Mulligan LM, et al. A 7 bp deletion of the RET proto-oncogene in familial Hirschsprung’s disease. Hum Mol Genet 1994:3:1439-40. Edery P, Lyonnet S, Mulligan LM, Pelet A, Dow E, Abel L, et al. Mutations of the RET proto-oncogene in Hirschsprung’s disease. Nature 1994;367:378-80. Luo Y, Cecchenini I, Pasini B, Matera I, Bicocchi MP, Barone V, et al. Close linkage with the RET proto-oncogene and boundaries of deletion mutations in autosomal dominant Hirschsprung disease. Hum Mol Genet 1993:2:1803-8. Mulligan LM, Eng C, Attie I, Lyonnet 5, Marsh Di, Hyland Vi, et al. Diverse phenotypes associated with exon 10 mutations of the RET proto-oncogene. Hum Mol Genet 1994;3:2163-7. Bergholm U, Adami H-0, Bergstrom R, Akerstrom G, Group SMS. Clinical characteristics in sporadic and familial medullary thyroid carcinoma: a nationwide study of 249 patients in Sweden from 1959 through 1981. Cancer 1989;63:1196-204. Block MA, iackson CE, Greenawald KA, Yott JB, Tashjian AH in. Clinical characteristics distinguishing hereditary from sporadic medullary thyroid carcinoma. Arch Sung 1980;115:142-8. Easton OF, Ponder MA, Cummings T, Gagel RF, Hansen HH,

Clinical Chemirtiy

35.

36.

37.

38.

Reichlin 5, et al. The clinical and screening age-at-onset distribution for the MEN-2 syndrome. Am i Hum Genet 1989:44:208-15. Neumann HPH, Berger DP, Sigmund G, Blum U, Schmidt 0, Parmer Ri, et al. Pheochromocytomas, multiple endocrine neoplasia type 2, and von Hippel-Lindau disease. N EngI i Med 1993; 329:1531-8. Ponder BAJ, Coffey R, Gagel RF, Semple P, Ponder MA, Pembney ME, et al. Risk estimation and screening in families of patients with medullany thyroid carcinoma. Lancet 1988;i:397-400. Wells SA in, Baylmn SB, Linehan WM, Farrell RE, Cox EB, Cooper CW. Provocative agents and the diagnosis of medullary carcinoma of the thyroid gland. Ann Sung 1978;188:139-41. Kempter B, Ritter MM. Unexpected high calcitonin concentrations

42, No. 4, 1996

603

after pentagastnin stimulation [Tech Brief]. Clin Chem 1991:37: 473- 4. 39. Landsvaten RM, Rombouts AGM, te Meerman Gi, iansen Schillhorn-van Veen iM, Berends MJH, Geerdink RA, et al. The clinical implications of a positive calcitonin test for C-cell hyperplasia in genetically unaffected members of an MEN2A kindred. Am i Hum Genet 1993:52:335-42. 40. Bugatho MJM, Cote Gi, Khorana 5, Schultz PN, Gagel RF. Identification of a polymorphism in exon 11 of the RET proto-oncogene. Hum Mol Genet 1994;3:2263. 41. Ceccherini I, Hofstra R, Luo Y, Stulp RP, Barone V, Stelwagen I, et al. DNA polymorphisms and conditions for SSCP analysis of the 20 exons of the ret proto-oncogene. Oncogene 1994;9:3025-9.