Cu/Zn superoxide dismutase and ascorbate peroxidase enhance in vitro shoot multiplication in transgenic plum

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/236041602

Cu/Zn superoxide dismutase and ascorbate peroxidase enhance in vitro shoot multiplication in transgenic plum ARTICLE in JOURNAL OF PLANT PHYSIOLOGY · FEBRUARY 2013 Impact Factor: 2.56 · DOI: 10.1016/j.jplph.2012.12.016 · Source: PubMed

CITATIONS

READS

10

58

10 AUTHORS, INCLUDING: Pedro Díaz-Vivancos

Tayeb Koussa

Spanish National Research Council

Université Chouaib Doukkali

65 PUBLICATIONS 1,060 CITATIONS

23 PUBLICATIONS 52 CITATIONS

SEE PROFILE

SEE PROFILE

Lorenzo Burgos

Jose Antonio Hernandez

Spanish National Research Council

Spanish National Research Council

136 PUBLICATIONS 1,924 CITATIONS

109 PUBLICATIONS 5,221 CITATIONS

SEE PROFILE

All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and read them immediately.

SEE PROFILE

Available from: Jose Antonio Hernandez Retrieved on: 09 February 2016

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/authorsrights

Author's personal copy Journal of Plant Physiology 170 (2013) 625–632

Contents lists available at SciVerse ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph

Biochemistry

Cu/Zn superoxide dismutase and ascorbate peroxidase enhance in vitro shoot multiplication in transgenic plum Mohamed Faize a , Lydia Faize b , Cesar Petri b , Gregorio Barba-Espin b , Pedro Diaz-Vivancos b , María José Clemente-Moreno a,b , Tayeb Koussa a , Lalla Aicha Rifai a , Lorenzo Burgos b , José Antonio Hernandez b,∗ a b

Laboratory of Plant Biotechnology, Ecology and Ecosystem Valorization, Faculty of Sciences, University Chouaib Doukkali, 24000 El Jadida, Morocco Group of Fruit Tree Biotechnology, Department of Plant Breeding, CEBAS-CSIC, PO Box 164, 30100 Murcia, Spain

a r t i c l e

i n f o

Article history: Received 2 October 2012 Received in revised form 10 December 2012 Accepted 14 December 2012 Available online 26 February 2013 Keywords: Cytosolic superoxide dismutase Cytosolic ascorbate peroxidase H2 O2 In vitro shoot multiplication Prunus

a b s t r a c t In this study we examined the role of antioxidant metabolism in in vitro shoot multiplication. We generated transgenic plum plantlets overexpressing the cytsod and cytapx genes in cytosol under the control of the constitutive promoter CaMV35S. Three transgenic lines with up-regulated sod at transcriptional levels that showed silenced cytapx expression displayed an elevated in vitro multiplication rate. By contrast, a transgenic line harboring several copies of cytapx and with elevated APX enzymatic activity did not show any improvement in plant vigor, measured as the number of axillary shoots and shoot length. All of the lines with elevated micropropagation ability exhibited intensive H2 O2 accumulation, monitored by 3,3 diaminobenzidine (DAB) staining as well as by colorimetric analysis, providing direct in vitro evidence of the role of H2 O2 and antioxidant genes in in vitro shoot multiplication. © 2013 Elsevier GmbH. All rights reserved.

Introduction Reactive oxygen species (ROS), such as hydrogen peroxide (H2 O2 ) and superoxide radicals (O2 .− ), are detrimental by-products of biological redox reactions under stressful conditions such as drought (Badawi et al., 2004; Faize et al., 2011), salinity (BarbaEspín et al., 2011a) and pathogen attack (Tertivanidis et al., 2004; Van Breusegem and Dat, 2006). Indeed, they can damage and denature important cellular components such as enzymes, membranes and DNA (Halliwell and Gutteridge, 2000). To cope with toxicity of ROS, plants have developed efficient anti-oxidant mechanisms, by partially suppressing ROS production, or by their scavenging. Different non-enzymatic (ascorbate, glutathione, ␣tocopherol and carotenoids) and enzymatic defenses including superoxide dismutase (SOD), the ascorbate-glutathione (ASC-GSH) cycle enzymes, catalase (CAT) and peroxidases (POX) are involved

Abbreviations: ASC-GSH cycle, ascorbate-glutathione cycle; APX, ascorbate peroxidase; DAB, 33 -diaminobenzidine; H2 O2 , hydrogen peroxide; O2 .− , superoxide radical; SOD, superoxide dismutase. ∗ Corresponding author at: Centro de Edafología y Biología Aplicada del Segura (CEBAS) CSIC, Group of Fruit Biotechnology (Dept. Fruit Breeding), P.O. Box 164, E-30100 Murcia, Spain. Tel.: +34 968 366319; fax: +34 968 396213. E-mail address: [email protected] (J.A. Hernandez). 0176-1617/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.jplph.2012.12.016

in the scavenging of ROS in plant cells (Noctor and Foyer, 1998; Asada, 1999). SODs are metaloenzymes located in various cell compartments that catalyze the dismutation of O2 .− to O2 and H2 O2 (Fridovich, 1975). Ascorbate peroxidases (APXs), the main enzymes of the ASC-GSH cycle, are one of the most important key enzymes that scavenge potentially harmful H2 O2 in different subcellular compartments (chloroplasts, mitochondria, peroxisomes, cytosol and apoplastic space) (Jiménez et al., 1997; Noctor and Foyer, 1998; Asada, 1999; Díaz-Vivancos et al., 2006). Although ROS seem to be toxic cellular metabolites, it has become evident that ROS play a dual role in plants. When present in high concentrations, ROS can kill plant cells, while in low concentrations they may signal the induction of stress-related genes. Hydrogen peroxide has recently attracted much attention; it can function as a signaling molecule that mediates responses to various environmental stresses in plants and it is involved in the modulation of the expression of various genes, including those encoding antioxidant enzymes (Neill et al., 2002; Van Breusegem and Dat, 2006). Moreover, it is seems to play a signal role in growth, differentiation and organogenesis (Sauer et al., 2001; Tian et al., 2003), and also during embryogenesis and seed germination (Cui et al., 1999; Luo et al., 2001; Ikeda-Iwai et al., 2003; Barba-Espín et al., 2010, 2011b). H2 O2 also plays an important role in micropropagation, and it is widely used as a chemical sterilizer to establish an axenic

Author's personal copy 626

M. Faize et al. / Journal of Plant Physiology 170 (2013) 625–632

culture and to avoid contamination of plant material during successive stages of in vitro culture techniques (Snow, 1985). Curvetto et al. (2006) reported that exogenous addition of H2 O2 into the culture media of Lilium longiflorum decreased contamination but also resulted in better in vitro performance, such as high bulb biomass and size, which is likely not solely due to the antimicrobial effects of H2 O2 . Recently, an increase in the offshoot number in Crocus sativus explants by cytokinins was correlated with the stimulation of H2 O2 -metabolizing enzymes such as POX and APX (Díaz-Vivancos et al., 2011). In parallel, an increase in SOD (an H2 O2 -producer enzyme) was observed. All of these data suggest that H2 O2 plays an important role in plant micropropagation. The aim of this work was to investigate the potential effect of cytosolic sod and apx transgenes on growth and in vitro shoot multiplication of plum plantlets. The impact of these transgenes on the endogenous H2 O2 content and its relationship with multiplication was also studied. Materials and methods Plant material, plasmid constructions and transformation The Agrobacterium tumefaciens strain EHA105, carrying the binary vector pBinARS-SOD or pCGN1578-APX, was used for inoculation of mature seed hypocotyl slices. Constructions described in Faize et al. (2011) harbored in their T-DNA, neomycin phosphotransferase (nptII) for aminoglycoside selection and cytosolic Cu/Zn sod (cytsod) from Spinacia oleracea, or cytosolic apx1 (cytapx) cDNA from Pisum sativum. Cytsod and cytapx transgenes are under the control of the duplicated CaMV35S promoter plus TEV enhancer and Nos terminator. The T-DNA region was introduced into hypocotyl discs of plum (Prunus domestica cv. Claudia verde) according to Petri et al. (2008). The endocarp was removed with a nutcracker, and the seeds were surface-sterilized for 30 min using 1% sodium hypochlorite solution containing 0.02% of Tween-20 and rinsed three times with sterile distilled water. Disinfected seeds were soaked in sterile distilled water overnight at room temperature and the seed coats were removed with a scalpel. The radicle and the epicotyl were discarded, and the hypocotyl was sliced into several cross sections (less than 1 mm), which were used for co-transformation. Two strains of A. tumefaciens harboring pBinARS-SOD or pCGN1578-APX grown in LB medium (OD600 = 0.5) were centrifuged at 5000 g for 10 min and resuspended in bacterial resuspension medium consisting of Murashige and Skoog (MS) salts (Murashige and Skoog, 1962), 2% (w/v) sucrose and 100 ␮M acetosyringone. They were then incubated at 25 ◦ C under agitation for 5 h and mixed before inoculation. After 2 days of slice co-culture on shoot regenerating medium (SRM: ¾ MS based medium with 7.5 ␮M thidiazuron (TDZ), 0.25 ␮M indole butyric acid (IBA) containing 600 mg L−1 Timentin, the hypocotyl slices were transferred to SRM selective medium containing 600 mg L−1 Timentin and 80 mg L−1 kanamycin for 8 weeks. Regenerated shoots were transferred to the shoot growing medium (SGM), in which TDZ was replaced by 1 ␮M 6benzylaminopurine (BAP). In vitro characterization of transgenic lines for vigor and in vitro micropropagation Plum shoots were maintained by sub-culturing at 4 week intervals on a shoot multiplication medium (SMM), at 23 ◦ C under cool white fluorescent tubes (55 ␮mol m−2 s−1 ), with a 16-h photoperiod. The SMM consisted of QL macronutrients (Quoirin and Lepoivre, 1977) and DKW micronutrients, vitamins and organic compounds (Driver and Kuniyuki, 1984), 3% sucrose and 0.7% agar

(HispanLab, S.A.). The medium was supplemented with 3.1 ␮M BAP and 0.2 ␮M indole-3-butyric acid (IBA). The length of shoots was determined at the end of the 4 week culture cycle under the conditions described above. To examine the effect of cold on transgenic lines, they were transferred to 4 ◦ C for seven months, and then returned to the growth chamber for 1 week, and the shoot length was determined. To examine the effects of cytsod and cytapx on micropropagation, the number of axillary shoots was recorded directly from shoots growing in SMM medium at the end of their subculture. The number of new growing buds was also assessed from 1 cm-nodal segments cultivated in a Petri dish containing QL macronutrients, DKW micronutrients, 3% sucrose and 0.7% agar, supplemented with BA and IBA. Southern blot analysis of transgenic plants Genomic DNA was isolated from 50 mg of plum leaves according to the procedure of Doyle and Doyle (1990). The genomic DNA was subjected, first, to PCR with specific primers encoding nptII (forward 5 -GATTGAACAAGATGGATTGC3 and reverse 5 -CCAAGCTCTTCAGCAATATC-3 ), followed by duplex PCR using specific primers encoding cytSOD (forward 5 -AAAGGCTGTGGTTGTTCTAA-3 and reverse 5 GTCTTGCTGAGTTCATGTCC) and specific primers encoding cytAPX (forward 5 -CTGCTGGTACTTTTGATTCC-3 and reverse 5 -GAGAGCTTAAGATGTCTTCA-3 ). In both simplex and duplex PCR, amplification was performed using the following conditions: 95 ◦ C for 5 min, 35 cycles of 95 ◦ C for 45 s, 54 ◦ C for 45 s and 72 ◦ C for 1 min, and one cycle of final extension at 72 ◦ C for 10 min. Finally, PCR products (696 bp for nptII, 484 bp for cytsod and 601 bp for cytapx) were separated on 1.2% agarose gels and visualized by ethidium bromide staining. 20 ␮g of genomic XhoI-digested DNA samples were separated on 1% (w/v) agarose gels and transferred to positively-charged nylon membranes by capillary blotting. The PCR nptII, cytsod and cytapx-fragments, amplified using the primers described above, were labeled with digoxigenin (DIG) using the PCR DIG Probe Synthesis Kit (Roche GmbH, Mannheim, Germany). Pre-hybridization and hybridization of filters to labeled probes were performed at 42 ◦ C. Blots were then washed twice at 23 ◦ C in 2X SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.1% (w/v) sodium dodecyl sulphate (SDS) for 15 min, and twice at 65 ◦ C in 0.5× SSC, 0.1% SDS for 15 min. Hybridizing bands were visualized with anti-DIG antibody-alkaline phosphatase and CDP-Star (Roche) on X-ray films. Gene expression analysis by qRT-PCR of transgenic plants Leaves isolated from in vitro transgenic lines as well as from a non-transformed lines were snap-frozen in liquid nitrogen and stored at −80 ◦ C until use. RNA was extracted from each set using RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The RNA samples were digested with DNase I by using the DNA-free Kit (Ambion, Austin, TX, USA) and quantified using a spectrophotometer Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, USA). cDNA was synthesized using RETROscript cDNA Synthesis Kit following the given instructions. The expression levels of cytsod, cytapx transgenes and a ˇ-actin gene, used as a reference, were determined by real-time RT-PCR using the GeneAmp 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA) in different lines. cDNA was first synthesized as described above and PCR was carried out on cDNA in triplicates in 96-well plates using the SYBR Green Master Kit (Applied Biosystems). Primers for ˇ-actin gene (forward 5 -TGCCTGCCATGTATGTTGCCATCC3 and reverse 5 -AACAGCAAGGTCAGACGAAGGAT-3 ); cytsod

Author's personal copy M. Faize et al. / Journal of Plant Physiology 170 (2013) 625–632

627

(forward 5 -CTTTGCCCAGGAAGGAGATG-3 and reverse 5 TGTGTCACCAAGGGCATGAA) and specific primers for cytapx gene (forward 5 -GCATGGCACTCTGCTGGTACT-3 and reverse 5 -CGTTGTTAGCACCATGAGCAA-3 ) were designed using the sequence detection system software to amplify an amplicon of 100 bp for cytsod and cytapx and 75 bp for ␤-actin. Each set of primers was mixed at final concentration of 300 nM with 2 ␮l cDNA and 1× SYBR Green. After denaturation at 95 ◦ C for 10 min, amplification occurred in a two-step procedure: 15 s of denaturation and 1 min of annealing and extension at 60 ◦ C for 40 cycles. These conditions were used for both target and reference genes, and the absence of primer-dimers were checked in controls lacking templates. Transcript levels were calculated using relative standard curves for both target and reference genes, which were made after running serial dilutions of specifically purified cDNA of the two genes as described in the user bulletin 2, ABIPRISM 7700. Enzyme extraction and assays of transgenic plants To analyze enzymatic activities, plum shoots were homogenized with a mortar and pestle in 2 mL of ice-cold 50 mM Tris-acetate buffer pH 6.0, containing 0.1 mM EDTA, 2% (w/v) PVP, 2% (w/v) PVPP and 0.2% (v/v) Triton X-100. For APX activity, 20 mM ascorbate was added. The homogenate was centrifuged at 14,000 × g for 20 min and the supernatant fraction was filtered through Sephadex G-25 NAP columns equilibrated with 50 mM Tris-acetate buffer pH 6.0, containing 2 mM ascorbate for APX activity. APX and SOD activities were assayed as described in DíazVivancos et al. (2006, 2008). All measurements were carried out in three replicates. To study the pattern of native SOD isoenzymes, non-denaturing polyacrylamide gel electrophoresis (PAGE) was performed on 10% acrylamide gels, using a Bio-Rad Mini-protean III dual slab cell. 40 or 60 ␮g of protein per lane were used in native gels. Staining of SOD activity was performed in the presence or the absence of H2 O2 or KCN (Hernández et al., 1999). Histochemical and quantitative analyses of H2 O2 The histochemical detection of H2 O2 in plum plantlets was performed using endogenous peroxidase-dependent in situ histochemical staining, in which whole explants were submerged in 0.1 mg mL−1 3,3 -diaminobenzidine (DAB) in 50 mM Tris-acetate buffer (pH 5.0) (Clemente-Moreno et al., 2012) and incubated at 25 ◦ C, in the dark, for 2 h. Controls were performed in the presence of 10 mM ascorbic acid. The plantlets were then rinsed in 80% (v/v) ethanol during 5 min at 60 ◦ C and photographed using a camera with an 18× optical zoom (Panasonic, mod DMC-FZ18). For H2 O2 analyses, plum plantlets (0.5 g) were homogenized with 2 mL of Tris-acetate buffer (50 mM), pH 5.0, in the presence of 5 mM KCN (Cheeseman, 2006). The measurement of H2 O2 was based on the peroxide-mediated oxidation of Fe2+ , followed by the reaction of Fe3+ with xylenol orange (Bellicampi et al., 2000). Results Recovery, molecular and biochemical characterization of transgenic lines The percentage of plum slices showing regeneration in the medium SRM supplemented with kanamycin averaged 39% and was higher than those transformed with puroindoline B, a transgene, which is not involved in the antioxidative metabolism (data not shown). Southern blot analysis using nptII, sod and apx as probes was carried out on several transgenic lines in order to check the integration

Fig. 1. Southern blot analysis of transgenic plum lines and non-transformed control using (A) nptII, (B) sod or (C) apx probes. 10 ␮g of DNA was digested using XhoI, separated by agarose gel electrophoresis and subjected to southern blot analysis. CV: non-transformed control “Claudia Verde”, Letters and numbers: different transgenic lines and C+: positive control (plasmid pBinARS-SOD or pCGN1578-APX). Data of a typical experiment is presented.

of the transgenes. The results from 5 selected transgenic lines showed a pattern of T-DNA integration ranging from 1 to 4 copies for nptII (Fig. 1A) and from 1 to 3 copies for sod (Fig. 1B) to 1 to 4 copies for apx (Fig. 1C). For this transgene, one copy was also detected in the non-transformed control corresponding to the endogenous apx gene. This was confirmed when using nptII as a probe; an additional copy was detected in all transformed lines except in the non-transformed control. Expression of ctysod and cytapx was confirmed by qRT-PCR (Fig. 2). The results showed different transcriptional levels of cytsod and cytapx in the analyzed transgenic lines when compared to the non-transformed control. For sod (Fig. 2A), transcript levels were very high (1.95 ng/␮g of actin) in line C5-5, which showed the maximum number of copies of sod (3 copies), while in lines with 1 copy of sod, the transcript levels varied from 0.33 ng to 0.71 ng/␮g of actin (Lines C6-4, C6-6 and F1-2), but still remained significantly different from the non-transformed control (Fig. 2A). In line J8-1, in which no sod copy was detected by Southern blot analysis, the mRNA level of sod was very low and similar to that recorded from non-transformed control (around 0.002 ng/␮g of actin) (Fig. 2A). Line J8-1, harboring 4 copies of apx, showed very high apx transcript levels (70 ng/␮g actin). However, the transcripts levels were much lower in the other transgenic lines studied (from 0.1 to 1 ng/␮g actin, Fig. 2B). Expression of ctysod and cytapx was also

Author's personal copy 628

M. Faize et al. / Journal of Plant Physiology 170 (2013) 625–632

SOD transcripts (ng/µg actin)

2.5

A

2 1.5 1 0.5 0 CV

C5-5

C6-4

C6-6

F1-2

J8-1

APX transcripts (ng/µg actin)

Line

80 70

B

60 50 40 30 20

more new buds than the non-transformed control or the line J8-1 (Fig. 5C). The effects of cytsod and cytapx on growth were investigated in plum lines grown in vitro at 23 ◦ C (normal conditions) and at 4 ◦ C (Fig. 5D). Under normal conditions, only one transgenic line (C6-4) showed enhanced vigor, measured as shoot length, when compared to the non-transformed control. We wanted to test how long our transgenic lines could resist the cold stress and we found that the 7th month was the maximum for non-transformed lines (because they started to die), although our best transgenic lines still survived after 2 years of cold exposure. When the transgenic lines were incubated at 4 ◦ C for 7 months and then shifted to the growth room for 1 week, vigor was significantly enhanced in all transgenic lines whose APX activities were down regulated (C55, C6-4, C6-6 and F1-2), whereas line J8-1, displaying the highest APX activity, did not show significant differences in relation to the non-transformed plantlets (Fig. 5D). These data indicate that down regulation of APX activity stimulates micropropagation under normal conditions and enhances growth under stressful conditions such as lower temperatures.

10 0 CV

C5-5

C6-4

C6-6

F1-2

J8-1

Line

Fig. 2. Determination of transcript abundance of (A) ctysod and (B) cytapx by qRTPCR in transgenic lines and non-transformed control of plum probes. Data were normalized to the endogenous control actin and are means and SE from 6 replicates from two independent biological experiments.

confirmed by analyses of their corresponding enzymatic activities (Figs. 3 and 4). The identification of the SOD isoenzymes was carried out using native PAGE. Three isoenzymes were detected in the non-transformed control, whereas in lines showing sod integration (Lines C5-5, C6-4, C6-6 and F1-2), two additional bands with SOD activity were detected (Fig. 3A). All of these bands were sensitive to H2 O2 and KCN, and they were accordingly identified as Cu, Zn-SOD isoenzymes (Fig. 3B and C). These data indicated that the cytsod transgene is functional in the transformed lines. The enzymatic analyses of the different plum lines showed no important differences in SOD activity in lines C5.5, F1.2 and J8.1 in relation to the non-transformed controls. However, lines C6.4 and C6.6 displayed SOD activity about 2-fold lower than that in the non-transformed controls (Fig. 3D). For APX activity, the transgenic plum lines showed a dramatic decrease, especially lines C6-4, C6-6 and F1-2. Only line J8-1 showed a significant increase (Fig. 4). Effect of cytsod and cytapx on shoot micropropagation and vigor The effect of cytsod and cytapx on in vitro micropropagation was investigated by determining the number of axillary shoots after 4 weeks of subculture on SMM medium. When compared to the non-transformed plants, the number of axillary shoots present in transgenic lines was enhanced (Fig. 5A). All of the transgenic lines harboring cytsod and whose APX activity was down regulated exhibited an elevated number of axillary shoots, which were at least doubled for the lines C6-4, C6-6 and F1-2, and 1.5 times higher in the line C5-5 in relation to non-transformed controls. However, line J8-1, which expressed only APX activity, did not show significant differences compared to the non-transformed controls (Fig. 5A). As an example, the elevated ability for in vitro multiplication of the transgenic line F1-2 is illustrated in Fig. 5B. The number of new growing buds was also recorded from 1 cmnodal segments (Fig. 5C) and an increase was observed for four lines (C5-5, C6-4, C6-6 and F1-2). Indeed, these lines showed 1.5 times

H2 O2 detection in transgenic lines To test whether the inhibition of the APX activity could result in increased concentrations of endogenous H2 O2 , we performed a histochemical staining with DAB (Fig. 6A). The results showed that, in non-transformed controls, a weak and a non-specific brownish staining was detected (Fig. 6A). In the transgenic line C5-5, DABstaining became visible in the internodes areas, whereas in lines C6-4, C6-6 and F1-2, this coloration was very intense. However, line J8-1 did not show a remarkable difference in relation to the non-transformed control (Fig. 6A). H2 O2 was also quantified in leaves from transgenic shoots (Fig. 6B). Lines C5-5 and J8-1 exhibited lower H2 O2 concentrations than the non-transformed control, whereas lines C6-4, C6-6 and F1-2 exhibited significantly higher concentrations than the control plantlets. These results are consistent with those from DAB staining only for the three more regenerating lines C6-4, C6-6 and F1-2 (Fig. 6). Interestingly, line C5-5, despite the visible DAB staining, did not show H2 O2 accumulation (Fig. 6), probably due to fact that this line had much more APX activity than lines C6-4, C6-6 and F1-2 (Fig. 4). Discussion This paper provided molecular evidence of the positive involvement of H2 O2 in enhancement of in vitro shoot multiplication. Using transgenic plum plantlets overexpressing cytsod and showing lower APX activity, we demonstrated that most show an increased ability for shoot multiplication, while no improvement was observed with the transgenic line overexpressing cytapx. It is interesting to note that sod transformed plum plantlets exhibited at least one copy of cytsod, as well as elevated transcriptional levels of mRNA encoding this gene, indicating that this transgene is constitutively and functionally expressed. Two new SOD isoenzymes were detected in transgenic plums, demonstrating that the introduced SOD affected the pattern of endogenous SOD isoenzymes. These results are consistent with those described previously by Sen Gupta et al. (1993), who reported that additional new SOD isoenzymes were expressed in transgenic tobacco plants in addition to introduced pea SOD. All of the SOD isoenzymes found in plum shoots were sensitive to both KCN and H2 O2 , strongly suggesting that they are CuZn-SOD. These results are surprising, since CuZn-SODs can be located in cell organelles that have active H2 O2 generation, such as chloroplasts, peroxisomes and mitochondria.

Author's personal copy M. Faize et al. / Journal of Plant Physiology 170 (2013) 625–632

629

Fig. 3. (A) SOD isoenzyme pattern determined by native PAGE in transgenic and nontransformed plum plants. Arrows showed additional SOD isoenzymes. Gels were incubated in the presence of (B) KCN or (C) H2 O2 . (D) Effect of transformation on SOD activity. Data for SOD activity are means and SE from 3 different experiments. Data of a typical experiment is presented.

This observation was evident mainly in lines C6-4, C6-6 and F1-2, because they accumulated more H2 O2 . The presence of only CuZnSOD isoenzymes has been also reported in other woody plants, such as Quercus robur L. (Sehmer et al., 1995). Most of the transgenic lines with elevated in vitro shoot multiplication ability harbored the endogenous cytapx, but their APX activity was very low, especially in lines C6-4, C6-6 and F1-2. It is important to note the positive correlation between gene expression for cytapx and APX activity in these lines. This down regulation of APX activity might be explained by transgene silencing due the homology between endogenous apx and that we used for transformation. Although we did not sequence the apx gene from plum, a

blast of the cytapx from pea revealed that it is conserved within several fruit species, including Prunus persica, and showed 79% of identity (NCBI, accession number DW358555). It is worth noting the strong correlation between the enzymatic APX activity of these transgenic lines and the expression levels of their corresponding mRNA. The transgenic line J8-1, harboring 4 copies of the cytapx, showed high APX activity, the same shoot multiplication rate as the non-transformed control, and lower H2 O2 accumulation that correlated with a weak DAB staining. However, the lines with higher in vitro shoot multiplication showed low APX activity. Thus, these lines accumulated higher H2 O2 levels than non-transformed plantlets. These findings suggest that the in vitro

Author's personal copy

nmol x min-1 x mg-1 prot

630

M. Faize et al. / Journal of Plant Physiology 170 (2013) 625–632

600 500 400 300 200 100 0

CV

C5.5

C6.4

C6.6

F1.2

J8.1

Plum line Fig. 4. Effect of transformation on APX activity in transgenic lines and nontransformed plum. Data are means and SE from 3 different experiments.

shoot multiplication could be affected by the modulation of H2 O2 levels, providing the first molecular evidence of its involvement in micropropagation of woody plants. Although H2 O2 is widely used to establish axenic cultures and to avoid contamination of plant material during in vitro culture (Snow, 1985), it has been reported that its exogenous addition into the culture media resulted in better in vitro performance such as high bulb biomass and size in Lilium longiflorum (Curvetto et al., 2006). In our transgenic lines of plum, elevated levels of H2 O2 were associated with higher micropropagation performance, but also with the highest vigor even when they were grown in the cold chamber. This result may indicate a positive effect of this transgene under cold stress situations.

Several studies have underlined the possible role of H2 O2 in several in vitro processes such as organogenesis, embryogenesis, morphogenesis and regeneration. In gladiolus, enhancement of shoot organogenesis was correlated with a decrease in the activity of H2 O2 scavenging enzymes such as CAT and POX, and with an increase in SOD activity (Datta Gupta and Datta, 2003). In strawberry shoots, organogenesis was stimulated by exogenous H2 O2 application and was decreased by SOD inhibitors such as NN -diethylthiocarbonate. In addition, strawberry calli with higher regeneration efficacy had an elevated H2 O2 concentration when compared with calli exhibiting low regeneration efficacy (Tian et al., 2004). The involvement of SOD in plant morphogenesis is supported by results from Papadakis and Roubelakis-Angelakis (2002) who observed that cytosolic Cu/Zn-SOD (an H2 O2 -producer enzyme) was induced in regenerating tobacco protoplasts but never in the recalcitrant grapevine protoplasts. However, under our experimental conditions, the observed increase in H2 O2 contents seems to be due to the lower APX activity rather than an increase in SOD activity, although changes in other H2 O2 -metabolizing enzymes (such as peroxidases or catalase) cannot be ruled out. In a recent work, we reported that treatments of peach plants with low concentrations of benzothiadiazole, a salicylic acid analog, or L-2-oxothiazolidine-4-carboxylic acid, an artificial precursor of cysteine, improved plant growth, and this response was correlated with greater increases in endogenous H2 O2 contents (Clemente-Moreno et al., 2012). H2 O2 is also involved in other physiological processes such as seed germination. The exogenous application of H2 O2 can improve the germination of both dormant and non-dormant seeds (Barba-Espín et al., 2010; Bahin et al., 2011). In addition, we have observed that the positive

Fig. 5. (A) Effect of plum transformation on in vitro shoot multiplication. The number of axillary shoots was recorded 4 weeks after their subcultures in growth chamber under normal conditions (23 ◦ C), (B) Development of new buds from internodal segments. (C) Image showing axillary shoots from non-transformed plants (left) and transgenic shoot F1-2 (right). (D) Effect of plum transformation on growth under normal or under cold conditions. Shoots were sub-cultivated in the growth chamber at 23 ◦ C for 4 weeks or stored for 7 months at 4 ◦ C then shifted to growth chamber for 1 week. Data are means and SE from 20 replicates. The experiment was repeated thrice for A–C, and twice for D. Data of a typical experiment is presented.

Author's personal copy M. Faize et al. / Journal of Plant Physiology 170 (2013) 625–632

631

Fig. 6. Effect of plum transformation on H2 O2 content. (A) Detection of H2 O2 accumulation in DAB-stained plum plantlets. (B) Endogenous H2 O2 contents in leaves from plum plantlets. Data are means and SE from 4 different experiments.

effect of H2 O2 in seed germination correlated with the induction of PsMAPK2, and a possible role of H2 O2 in stimulating the ABA catabolism has been suggested (Barba-Espín et al., 2010; 2011b). Similarly, transgenic expression of genes encoding for glucose oxidase or oxalate oxidase (H2 O2 -producer enzymes), may be deployed to improve tolerance to chilling, high light or herbicide stress (Maruthasalam et al., 2010; Wan et al., 2009). In addition, the higher tolerance of transgenic lines against these stress situations was found to be associated, at least in part, with elevated levels of total antioxidant content, and SOD, catalase, APX and glutathione reductase activities (Maruthasalam et al., 2010; Wan et al., 2009). Taken together, our results showed the possible involvement of H2 O2 in the micropropagation process of plum plants. Furthermore, it will be interesting to test whether these lines will also exhibit a modified ability for regeneration.

Acknowledgements This work was supported by the grant from CICYT BFU200907443 of the Spanish Ministry of Science and Innovation. G.B.E. thanks the CSIC for his JAE-pre research fellowship. P.D.V. thanks the CSIC and the Spanish Ministry of Economy and Competitiveness for his Ramón & Cajal contract.

References Asada K. The water–water cycle in chloroplasts: scavenging of active oxygen and dissipation of excess photons. Ann Rev Plant Mol Biol 1999;50:601–39. Badawi GH, Kawano N, Yamauchi Y, Shimada E, Sasaki R, Kubo A, et al. Overexpression of ascorbate peroxidase in tobacco chloroplasts enhances the tolerance to salt stress and water deficit. Phys Plant 2004;121:231–8. Bahin E, Bailly C, Sotta B, Kranner I, Corbineau F, Leymarie J. Cosstalk between reactive oxygen species and hormonal signalling pathway regulates grain dormancy in barley. Plant Cell Environ 2011;34:980–93. Barba-Espín G, Diaz-Vivancos P, Clemente-Moreno MJ, Albacete A, Faize L, Faize M, et al. Interaction between hydrogen peroxide and plant hormones during germination and the early growth of pea seedlings. Plant Cell Environ 2010;33: 981–94. Barba-Espín G, Clemente-Moreno MJ, Álvarez S, García-Legaz MF, Hernández JA, Díaz-Vivancos P. Salicylic acid negatively affects the response to salt stress in pea plants. Plant Biol 2011a;13:909–17. Barba-Espín G, Diaz-Vivancos P, Job D, Belghazi M, Job C, Hernández JA. Understanding the role of H2 O2 during pea seed germination: a combined proteomic and hormone profiling approach. Plant Cell Environ 2011b;34: 1907–19. Bellicampi D, Dipierro N, Salvi G, Cervone F, De Lorenzo G. Extracellular H2 O2 induced by oligogalacturonides is not involved in the inhibition of the auxin-regulated roIB gene expression in tobacco leaf explants. Plant Physiol 2000;122:1379–85. Cheeseman JM. Hydrogen peroxide concentrations in leaves under natural conditions. J Exp Bot 2006;57:2435–44. Clemente-Moreno MJ, Diaz-Vivancos P, Piqueras A, Hernández JA. Plant growth stimulation in Prunus species plantlets by BTH or OTC treatments under in vitro conditions. J Plant Physiol 2012;169:1074–83. Cui K, Xing G, Liu X, Xing G, Wang Y. Effect of hydrogen peroxide on somatic embryogenesis of Lycium barbarum. Plant Sci 1999;146:6–16.

Author's personal copy 632

M. Faize et al. / Journal of Plant Physiology 170 (2013) 625–632

Curvetto N, Marinangeli P, Mockel G. Hydrogen peroxide in micropropagation of Lilium A comparison with a traditional methodology. Biocell 2006;30: 497–500. Díaz-Vivancos P, Rubio M, Mesonero V, Periago PM, Ros Barceló A, Martínez Gómez P, et al. The apoplastic antioxidant system in Prunus: response to plum pox virus. J Exp Bot 2006;57:3813–24. Díaz-Vivancos P, Clemente-Moreno MJ, Rubio M, Olmos E, García JA, MartínezGómez P, et al. Alteration in the chloroplastic metabolism leads to ROS accumulation in pea plants in response to plum pox virus. J Exp Bot 2008;59:2147–60. Díaz-Vivancos P, Majourhat K, Fernández JA, Hernández JA, Piqueras A. Study of the antioxidant enzymatic system during shoot development from cultured intercalar meristems of saffron. Plant Growth Regul 2011;65:119–26. Doyle JJ, Doyle JL. Isolation of DNA from fresh tissue. Focus 1990;12:13–5. Driver JA, Kuniyuki AH. In vitro propagation of Paradox walnut rootstock. Hortiscience 1984;19:507–9. Datta Gupta S, Datta S. Antioxidant enzyme activities during in vitro morphogenesis of Gladiolus and the effect of application of antioxidants on plant regeneration. Biol Plant 2003;47:179–83. Faize M, Burgos L, Faize L, Piqueras A, Nicolas E, Barba-Espin G, et al. Involvement of cytosolic ascorbate peroxidase and Cu/Zn-superoxide dismutase for improved tolerance against drought stress. J Exp Bot 2011;62:2599–613. Fridovich I. Superoxide dismutases. Ann Rev Biochem 1975;44:147–9. Halliwell B, Gutteridge JMC. Free Radicals in Biology and Medicine. London: Oxford University Press; 2000. Hernández JA, Campillo A, Jiménez A, Alarcón JJ, Sevilla F. Response of antioxidant systems and leaf water relations to NaCl stress in pea plants. New Phytol 1999;141:241–51. Ikeda-Iwai M, Umehara M, Satoh S, Kamada H. Stress-induced somatic embryogenesis in vegetative tissues of Arabidopsis thaliana. Plant J 2003;34: 107–14. Jiménez A, Hernández JA, del Río LA, Sevilla F. Evidence for the presence of the ascorbate-glutathione cycle in mitochondria and peroxisomes of pea (Pisum sativum L.) leaves. Plant Physiol 1997;114:275–84. Luo JP, Jiang TJ, Pan LJ. Enhanced somatic embryogenesis by salicylic acid of Astragalus adsurgens Pall: relationship with H2 O2 production and H2 O2 -metabolizing enzyme activities. Plant Sci 2001;161:125–32. Maruthasalam S, Liu YL, Sun CM, Chen PY, Yu CW, Lee PF, et al. Constitutive expression of a fungal glucose oxidase gene in transgenic tobacco confers chilling tolerance through the activation of antioxidative defence system. Plant Cell Rep 2010;103:5–104, 8.

Murashige T, Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 1962;15:473–97. Noctor G, Foyer CH. Ascorbate and glutathione: keeping active oxygen under control. Ann Rev Plant Physiol Plant Mol Biol 1998;49:249–79. Neill S, Desikan R, Hancock J. Hydrogen peroxide signalling. Curr Opin Plant Biol 2002;5:388–95. Papadakis AK, Roubelakis-Angelakis KA. Oxidative stress could be responsible for the recalcitrance of plant protoplasts. Plant Physiol Biochem 2002;40: 549–59. Petri C, Webb K, Hily JM, Dardick C, Scorza R. High transformation efficiency in plum (Prunus domestica L.): a new tool for functional genomics studies in Prunus spp. Mol Breed 2008;22:581–91. Quoirin M, Lepoivre P. Etude de milieux adaptes aux cultures in vitro de Prunus. Acta Hortic 1977;78:437–42. Sauer H, Wartenberg M, Hescheler J. Reactive oxygen species as intracellular messengers during cell growth and differentiation. Cell Physiol Biochem 2001;11:173–86. Sehmer L, Alaoui-Sosse B, Dizengremel P. Effect of salt stress on growth and on the detoxifying pathway of pedunculate oak seedlings (Querqus robur L.). J Plant Physiol 1995;147:144–51. Sen Gupta A, Heinen JL, Holaday AS, Burke JJ, Allen RD. Increased resistance in transgenic plants that overexpress chloroplastic Cu/Zn superoxide dismutase. Proc Natl Acad Sci USA 1993;90:1629–33. Snow R. Improvements in methods for the germination of orchid seeds. Am Orchid Soc Bull 1985;54:178–81. Tertivanidis K, Goudoula K, Vasilikiotis K, Hassiotou E, Perl-Treves R. Superoxide dismutase transgenes in sugarbeets confer resistance to oxidative agents and the fungus C. beticola. Trans Res 2004;13:225–33. Tian M, Gu Q, Zhu M. The involvement of hydrogen peroxide and antioxidant enzymes in the process of shoot organogenesis of strawberry callus. Plant Sci 2003;165:701–7. Tian M, Han N, Bian HW, Zhu M. The possible relationship between the regeneration capacity and reactive oxygen species in the strawberry calli. Acta Hortic Sinica 2004;31:372–4. Van Breusegem F, Dat JF. Reactive oxygen species in plant cell death. Plant Physiol 2006;141:384–90. Wan X, Tan J, Lu S, Lin C, Hu Y, Guo Z. Increased tolerance to oxidative stress in transgenic tobacco expressing a wheat oxalate oxidase gene via induction of antioxidant enzymes is mediated by H2 O2 . Physiol Plant 2009;136: 30–44.