Congenital Transcobalamin II Deficiency Due to Errors in RNA Editing

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

Qian et al.

Congenital Transcobalamin II Deficiency Due to Errors in RNA Editing Submitted 12/20/01; revised 01/14/02 (Communicated by E. Beutler, M.D., 01/15/02)

Lian Qian,1 Edward V. Quadros,1 Annette Regec,1 Jacqueline Zittoun,2 and Sheldon P. Rothenberg1 ABSTRACT: Transcobalamin II (TCII) is a plasma protein essential for the transport and cellular uptake of vitamin B12 (B12; cobalamin, Cbl). Congenital deficiency of functional TCII is an autosomal recessive genetic disorder that results in clinical B12 deficiency usually within several months following birth. In this report, we describe the molecular basis for TCII deficiency in two patients who developed a megaloblastic anemia in early infancy. The serum of both patients contained immunoreactive TCII that did not bind [57Co]Cbl. The fibroblasts from each patient secreted a similarly nonfunctional TCII, yet full-length TCII transcripts were identified by Northern blot. Overlapping cDNA fragments were generated by reverse transcription–polymerase chain reaction and several mutations were identified in the coding region of the cDNA, one of which was common to both patients. However, amplification of the corresponding regions of the gene from genomic DNA failed to identify these mutations. These findings were confirmed by replicate analyses and support the proposal that a variance in RNA editing is the likely mechanism for the mutations that resulted in the expression of a nonfunctional TCII protein in these patients. © 2002 Elsevier Science (USA)

INTRODUCTION

primarily by the vascular endothelium (8) for normal Cbl homeostasis. Congenital deficiency of TCII, first described in two siblings in 1971 (9), presents in early infancy with megaloblastic anemia, failure to thrive and, not infrequently, neurologic complications (10). Several phenotypic variants of congenital TCII disorders have been reported that include a TCII protein that binds Cbl but the TCII-Cbl complex does not bind to the receptor on the cell surface (11), and an immunoreactive TCII protein that does not bind Cbl (12). The cloning of the cDNA (13) and the gene for TCII (14, 15) has provided the molecular tools to identify the TCII gene defect(s) in these patients. Previous genetic studies of patients with congenital TCII deficiency have either not identified any gross abnormality of the coding region of the TCII gene (16) or identified major and minor

Transcobalamin II (TCII), a vitamin B123 (cobalamin, Cbl; B12) binding protein in the plasma is required for the transport and cellular uptake of Cbl (1). TCII binds the absorbed Cbl in the distal ileum for distribution to the tissues (2) where the TCII-Cbl binds to specific cell membrane receptors that internalize the complex by receptor mediated endocytosis (3). The TCII protein is degraded in the lysosome (4) releasing the Cbl which is converted to methyl-Cbl and 5⬘-deoxyadenosyl Cbl (5) that serve as cofactors for the Cbl dependent enzymes, methionine synthase and methylmalonyl-CoA mutase (6), respectively. Because TCII is not recycled and has a relatively short plasma half-life (⬃60 –90 min) (7), the concentration of plasma TCII has to be maintained by constitutive expression of the protein

Correspondence and reprint requests to: Sheldon P. Rothenberg, SUNY–Downstate Medical Center, Division of Hematology/Oncology, 450 Clarkson Avenue, Box 20, Brooklyn, NY 11203. Fax: (718) 270-1578. E-mail: [email protected]. 1 Department of Medicine, Division of Hematology/Oncology, SUNY–Downstate Medical Center, Brooklyn, New York 11203. 2 Lab Central d’Hematologie, Hospital Henri Mondor, Creteil Cedex, France. 3 Vitamin B12 refers to the dietary nutrient. Cobalamin refers to the in vivo chemical forms of the vitamin that provide the cofactor functions as methyl-Cbl and 5⬘-deoxyadenosyl-Cbl. 1079-9796/02 $35.00 © 2002 Elsevier Science (USA)

All rights reserved.

134

Qian et al.

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

nucleotide deletions (17). In another report describing three patients lacking the TCII protein and transcript, no deletions, rearrangements or mutations that alter a restriction site in the gene were identified (18). In this report, we describe the molecular studies to characterize the genetic basis for congenital TCII deficiency in two patients who express a full length TCII mRNA that encodes a 43-kDa immunoreactive TCII protein that does not bind Cbl. The cDNA generated by reverse transcriptionpolymerase chain reaction (RT-PCR) with the RNA from the patients’ fibroblasts contains mutations that are lacking in the PCR amplified coding regions of the gene. These findings suggest that the genetic disorder may be a consequence of a variance in RNA editing as reported for a number of genetic disorders (19, 20).

tory studies indicated severe pancytopenia with macrocytic red cells and a bone marrow aspiration showed megaloblastic hematopoiesis. The serum Cbl and folate concentrations were normal but the unsaturated Cbl binding capacity was low. Treatment with vitamin B12 induced a complete hematologic remission. At age 14, and despite continuous treatment with vitamin B12, the patient still had a neurological disorder characterized by seizures, impaired vision, abnormal evoked visual potentials and cerebellar disturbances. A sample of the patient’s serum and skin fibroblasts were forwarded to our laboratory for additional studies. MATERIALS AND METHODS The unsaturated Cbl binding capacity of TCII (i.e., apo-TCII) and immunoreactive TCII in the serum and fibroblast culture medium, were measured as previously described (22). The synthesis of [35S]methionine labeled nascent TCII was determined as follows: Confluent fibroblast cultures in 25-cm2 flasks were initially depleted of endogenous methionine by incubating the cells for 2 h at 37°C in methionine-free Dulbecco’s minimal essential medium (DMEM) lacking fetal calf serum (FCS). [35S]Methionine (250 ␮Ci) was then added to each flask and the incubation continued for another 2 h after which an equal volume of complete DMEM containing 20% FCS was added and the incubation continued for an additional 72 h. To identify [35S]-labeled TCII, 1 ml of the medium was sequentially treated with 20 ␮l of a 10% suspension of protein Amembranes (Calbiochem) to diminish nonspecific binding, and then with 10 ␮l of polyclonal rabbit antiserum to human TCII adsorbed to 20 ␮l of the protein A membranes. The protein-A membrane pellet was washed twice with phosphate-buffered saline (PBS) and the bound protein extracted with SDS–PAGE buffer. The proteins were separated by electrophoresis in a 10% polyacrylamide gel and the 35S-labeled proteins visualized by autoradiography.

CASE HISTORIES Patient D A 14-month-old male infant of Algerian descent was referred for evaluation of aplastic anemia. He is the 14th child of consanguineous parents and his two sisters died at 4 and 5 months of age without a recorded diagnosis. The patient was treated with both folic acid and vitamin B12 although plasma and red cell folate, and plasma Cbl were normal. His peripheral blood and bone marrow became normal but he relapsed when this therapy was discontinued. A second course of treatment induced another remission. A dU suppression test (21) 2 weeks after the vitamins were discontinued established that vitamin B12 deficiency was the cause of the disorder, and studies of the unsaturated Cbl binding proteins in the serum established the absence of functional TCII. A sample of the patient’s serum and skin fibroblasts were forwarded to our laboratory for additional studies. Patient C

RNA Preparation and Northern Blot Analysis A 5-month-old girl, the first child of nonconsanguineous parents, was hospitalized because of pallor, failure to thrive and diarrhea. Labora-

Total cellular RNA from cultures of peripheral skin fibroblasts was prepared by the guani135

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

dinium isothiocyanate/CsCl isopycnic isolation method (23). Poly(A)⫹ RNA was prepared from the total cellular RNA using the Biomag mRNA purification kit (PerSeptive Biosystems, Inc.). The RNA was separated by electrophoresis in a 1% agarose gel containing formaldehyde and then capillary blotted onto a Nytran membrane. The membrane was stained with methylene blue to confirm equivalent sample loading and the transfer of the RNA to the membrane, as well as to mark the migration of 18S rRNA, 28S rRNA and RNA molecular weight markers. The membrane was incubated with a 32P-labeled 300 bp HindIII fragment of the cDNA that contains the 5⬘ untranslated and coding region corresponding to exon 1 and part of exon 2, in a solution containing 10% dextran sulfate and 50% formamide for 12 to 18 h at 42°C and then washed with 0.1⫻ SSPE/0.1% SDS at 50 – 60°C and the hybridized band was visualized by autoradiography. A 32Plabeled glyceraldehyde phosphate dehydrogenase (GAPDH) probe was used to normalize the loading of RNA.

Qian et al.

thermocycler settings: denaturation for 0.8 min at 94°C; annealing for 0.8 min at 55°C; extension for 3 min at 72°C. The product of each amplification was purified by electrophoresis in a 1% agarose gel in TAE buffer and then cloned into the pCR-Script SK(⫹) Vector (Stratagene). Plasmid DNA from each of the cDNA clones was prepared and the nucleotide sequence determined by the method of Sanger et al. (24). RESULTS Apo-TCII could not be identified in the serum of either patient by the binding of [57Co]Cbl (Fig. 1A). However, the TCII protein could be quantified in the serum of both patients by radioimmunoassay using a polyclonal antiserum to human TCII (22) (Fig. 1B) and the values though low, were within two standard deviations of the normal value of 31 ⫾ 8 ng in our laboratory. The culture medium of the fibroblasts from patient C and patient D contained 0.3 ng/ml and 0.86 ng/ml of immunoreactive TCII, respectively, that did not bind [57Co]Cbl (Fig. 1C). These values are higher compared to the control fibroblasts. Additional evidence for TCII synthesis was obtained by [35S]methionine labeling of nascent proteins in the fibroblast cultures. As shown in Fig. 2A, a radiolabeled protein having the same 43-kDa molecular weight as TCII was identified in the culture medium by SDS–PAGE of the proteins extracted from the protein A membrane pellet. In addition to the 43-kDa immunoreactive 35 S-TCII, lower molecular weight 35S-labeled fragments were detected from both patients suggesting that the nascent TCII is unstable. Full-length TCII transcripts were also identified by Northern blot of total RNA from the fibroblasts of both patients (Fig. 3). However, the TCII mRNA was lower in patient D and higher in patient C than observed for the mRNA from normal fibroblasts. Because sufficient full-length cDNA could not be amplified by RT-PCR for sequencing, the cDNA was generated as three separate overlapping fragments using three sets of primers as shown in Fig. 4A. The amplified products were separated by electrophoresis in a 1% agarose gel

RT-PCR Amplification and Nucleotide Sequencing of the cDNA Generated The RT-reaction was performed using the BRL SuperScript II kit. Briefly, 0.5 ␮g of oligo(dT) was mixed with 1 ␮g of poly(A)⫹ RNA or 5–10 ␮g total RNA in 14 ␮g of diethylprocarbonate (DEPC)-treated water, heated to 70°C for 10 min, and then incubated on ice for 1 min. The tube was briefly centrifuged and the following components were added: 1 ␮L 10⫻ synthesis buffer, 1 ␮L 10 mM dNTPs, 2 ␮L 0.1 M dithiothreitol (DTT), and 1 ␮L SuperScript II reverse transcriptase (200 U/␮L). The mixture was incubated for 10 min at room temperature and then at 42°C for 1 h. The reaction was terminated by heating the mixture at 70°C for 15 min. PCR was performed in 25 ␮L of a mixture that contained 1 ␮L of template cDNA from the RT reaction and Vent DNA polymerase (New England Biolabs). The complete cDNA sequence was amplified as three overlapping segments using TCII cDNA-specific primers (Table 1). PCR was performed for 30 cycles with the following 136

Qian et al.

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

FIG. 2. SDS–PAGE of [35S]methionine labeled TCII protein immunoprecipitated with anti-human TCII antiserum. Lane 1, patient C; lane 2, patient D; lane 3, normal control.

replicate analyses of three different fibroblast DNA preparations from the patients as well as genomic DNA from normal fibroblast controls. Mutations were identified in the RT-PCR generated cDNA for both patients and these are summarized in Fig. 5. Patient C exhibits compound heterozygosity with mutations in exons one and

FIG. 1. The measurement of TCII in serum and fibroblast culture medium. (A) Apo TCII in the serum as determined by the binding of [57Co]B12. (B) Total immunoreactive TCII protein in the serum. (C) Immunoreactive protein in the 72-h medium from the fibroblasts culture.

(Fig. 4B), extracted and sequenced directly, and subcloned into the PCR Script plasmid for sequencing. The corresponding exonic regions in the TCII gene were amplified from genomic DNA by PCR using primers to the introns flanking each exon (Table 1) and the fragments sequenced directly, and after subcloning the products into the PCR Script plasmid. The nucleotide sequence of the cDNA generated by RT-PCR, was confirmed by two or more replicate analyses of the mRNA from the patients and normal fibroblast controls. The nucleotide sequence of the corresponding regions generated from genomic DNA by PCR was similarly confirmed by

FIG. 3. Northern blot of mRNA isolated from skin fibroblasts. Lane 1, patient C; lane 2, patient D; lane 3, control fibroblasts. (A) Audioradiogram of the TCII mRNA. (B) Hybridization with the GAPDH probe for normalization of the RNA in each lane. 137

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

Qian et al.

FIG. 4. RT-PCR generated cDNA from the patients’ fibroblast mRNA. (A) Diagrammatic representation of the strategy used for amplification of the coding region of TCII mRNA using three sets of primers to generate overlapping fragments. The nucleotide numbers at the 5⬘ and 3⬘ ends of each fragment correspond to the nucleotide positions in the cDNA. (B) Agarose gel electrophoresis of the PCR-amplified products stained with ethidium bromide.

two in both alleles (Fig. 5). The mutations in exon one changed Cys (TGT) 21 to Tyr (TAT) in one allele, and Leu (CTG) 11 to Val (GTG) in the other allele. There are two mutations in exon 2 for both alleles; His (CAC) 49 to Tyr (TAC) and Leu (CTA) 85 to Gln (CAA) in one allele, and Asp (GAC) 27 to Asn (AAC) and Gly (GGG) 86 to Glu (GAG) in the other allele. Patient D is homozygous for the mutations in exons 2 and 4 (Fig. 5); in exon 2, Leu (CTA) 85 to Gln (CAA), and in exon 4, Gly (GGC) 158 to Cys (TGC). The mutation in exon 2 was identical to the exon 2 mutation in patient C. These mutations identified in the RT-PCR

generated cDNA products were not present in the corresponding exons amplified from the patients’ genomic DNA. Similar analysis of the mRNA and genomic DNA from the fibroblast controls showed the normal sequence for these regions of the TCII gene (14). DISCUSSION There have been more than 30 patients with congenital TCII deficiency reported (for review, see Ref. 25) but there have been few molecular studies to characterize the genetic basis of the disorder. The most common phenotype is the ab-

TABLE 1 TCII-Specific Primers Used for the Amplification of cDNA and Genomic DNA Sense primer

Antisense primer

Product amplified

I. cDNA amplification A. CGATTCTTGCTCACTGCTCAC C. TCTCACAGCTCAAATGGTTCCTGG E. AACAGCATGTCTCAAGGCGAGG

B. ATTTGAGCTGTGAGACCAGCCTG D. CAGATCAATGTAGGTCTTGTGG F. GAAGATGCTTGGCTCTCTGC

nt ⫺34 to nt 375 nt 383 to nt 891 nt 792 to nt 1468

II. Genomic amplification A. CCGGGCTTCTTTAAGCAGGAACG (5⬘ flanking DNA) C. CTCTGGAGAAGGCCCTGGTAACGTC (intron 1) E. GACACACAGTGAGACCTCAGCACGTATG (intron 3)

B. CACAGAAAGGCTCAGTATGCGCTG (intron 1) D. CACAAAGTGGTGACAGGCCCAAACTAG (intron 2) F. AATTCGTCCCTAAAGGACTTGATTCGG (intron 4)

138

Exon 1 Exon 2 Exon 4

Qian et al.

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

FIG. 5. A schematic representation of the exonic position of the mutations identified in the TCII transcript from patient C and patient D. Patient C is a compound heterozygote. Patient D is homozygous for the mutations. Nt, indicates the nucleotide numbers in the coding sequence of the gene; AA indicates the encoded amino acid; intronic sequences are in lowercase letters.

sence of TCII as determined by the binding of radio-labeled Cbl or by immunoassay for the protein. Two other variant phenotypes include an immunoreactive TCII that does not bind Cbl (12), and a patient who synthesizes TCII that binds Cbl but the complex apparently does bind to the membrane receptor for TCII-Cbl (11). Since most of the Cbl in the circulation is carried on transcobalamin I (haptocorrin), these infants usually have a normal serum Cbl concentration despite intracellular deficiency of the vitamin. The two patients with congenital deficiency of TCII described in this report have the phenotype that synthesizes immunoreactive TCII that does not bind Cbl. In both patients the TCII gene encodes a full length transcript and the cells secrete TCII which, by radio-labeling with [35S]methionine, has a molecular weight of ⬃43,000. This protein may be unstable because smaller fragments were identified in the immuno-precipitate of the culture medium. The multiple single base mutations identified in the cDNA generated by RT-PCR using RNA from the patients’ fibroblasts appear to be responsible for the impaired function of the TCII. Since none of the mutations were identified in the TCII

gene from these patients, the mutations must have occurred posttranscriptionally during the processing of the primary transcript. Replicate RT-PCR and nucleotide sequencing of the cDNA generated confirmed the mutations in both patients. Though errors occur with both reverse transcriptase and DNA polymerase (26), the likelihood that these enzymes would generate in replicate assays the same mutations in exactly the same location by such catalytic infidelity is extremely remote. Accordingly, the mutations identified in the cDNA generated by RT-PCR is likely to be a consequence of some variance in the RNA editing process. RNA editing is a normal molecular mechanism that post-transcriptionally modifies a primary transcript by one or more base insertions or deletions, and by base conversion or substitutions that changes the nucleotide (27, 28). RNA editing is known to occur in plants, single organisms and mammalian tissues and provides for expression of a modified protein that could be limited to a specific tissue (29) and this can generate a greater diversity of the gene product. RNA editing can create reading frames and introduce a stop codon by changing a single nucleotide thereby truncat139

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

ing the expressed protein (30). The editing process can also go awry and change the amino acid sequence such that the function of a protein is compromised, or the stability of the transcript is altered (31). Though the major genetic contribution of RNA editing is to create structural and functional diversity, there are instances whereby RNA editing generates an abnormal protein that results in a functional disorder. For example, RNA editing has altered the function of human ␣-galactosidase (19) a lysosomal enzyme that is essential for glycosphingolipid metabolism and this altered enzyme has been identified in Fabry’s disease. This genetic disorder affects the kidneys, heart and brain as a consequence of microvascular accumulation of globtriaosylceramide in endothelium (32). Sharma et al. (20) have shown that the Wilm’s tumor (WT1) susceptibility gene (WT1) in the rat at nucleotide position 839 is thymidine (T) and the CTC codon encodes leucine. However, the cDNA generated by RT-PCR contains either T or cytosine (C), and the CCC codon encodes proline. This finding was ascribed to post-transcriptional RNA editing in which U839 was converted to C. This group has also observed similar RNA editing of the WT1 gene transcript expressed in the human testis. The functional consequence of this RNA editing is that the WT-1 proline containing protein, which is a zinc finger transcription regulator, is 30% less efficient as a transcription repressor than the leucine containing WT-1 protein. An interesting finding in patient C and patient D is the proximity of the mutations in exons 1 and 2 to the donor splice site of the adjacent introns. For patient C, the TGT3 TAT (C3 Y) substitution in exon 1 is one nucleotide upstream of the intron sequence, gtgagtaa; and in exon 2 the CTA3 CAA(L3 Q) substitution is two nucleotides upstream of the intron sequence, gtattgcc. The identical L3 Q mutation was also observed in patient D who is homozygous for this genetic abnormality. It has been recognized that the nucleotide sequence flanking the exon, or downstream of the exon, can influence the RNA editing process (27). A concern about the validity of these findings

Qian et al.

has been the possibility that additional copies of the TCII gene that lack the mutations could be contributing the normal nucleotide sequences obtained by PCR amplification of exons one, two and four from genomic DNA thus masking the mutations in the TCII gene that is encoding the mutated protein. A pseudogene in which these exons are also normal could similarly mask these mutations. There is, however, compelling evidence that neither of these possibilities are likely. First, in these studies the nucleotide sequence was determined both directly and in multiple subclones of the PCR fragments generated from genomic DNA and this would have revealed different sequences if the genome contained a TCII pseudogene or multiple copies of the TCII gene. In addition, chromosome 22 has been characterized in depth (www.sanger.ac.uk/HGP/chr22/) and studies of the TCII gene locus by the Genome Center for Chromosome 22 at the Children’s Hospital of Philadelphia did not identify multiple copies of the TCII gene or a pseudogene (personal communication, Dr. Beverly Emannuel). In addition, a search of GenBank (www.ncbi.nlm.nih. gov/blast) for the TCII sequence within the human genome, and EST sequences, did not identify any of the mutations found in the two patients. In summary, mutations have been identified in regions corresponding to exons 1 and 2 and exons 2 and 4 in the cDNA amplified by RT-PCR of the transcripts from two patients with congenital TCII deficiency. The corresponding exons amplified from genomic DNA had the normal sequence indicating that the mutations occurred during the editing of the primary transcript. Though RNA editing is a normal mechanism for expanding genetic diversity, mutations that alter the function of the gene product have been reported (19, 20).

ACKNOWLEDGMENTS This work has been supported by a grant from the National Institutes of Health (RO1DK28561). We extend our appreciation to Ms. Bertha Wallace for her assistance in the preparation of the manuscript. 140

Qian et al.

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

REFERENCES 1.

2.

3.

4.

5.

6.

7.

8.

9.

10. 11.

12.

13.

14.

Hall, C. A., and Finkler, A. E. (1966) Function of transcobalamin II: A B-12 binding protein in human plasma. Proc. Soc. Exp. Biol. Med. 123, 55–58. Rothenberg, S. P., Weiss, J. P., and Cotter, R. (1978) Formation of transcobalamin II–vitamin B12 complex by guinea-pig ileal mucosa in organ culture after in vivo incubation with intrinsic factor–vitamin B12. Br. J. Haematol. 40, 401– 414. Takahashi, K., Tavassoli, M., and Jacobsen, D. W. (1980) Receptor binding and internalization of immobilized transcobalamin II by mouse leukaemia cells. Nature 288, 713–715. Mellman, I., Willard, H. F., Youngdahl-Turner, P., and Rosenberg, L. E. (1979) Cobalamin coenzyme synthesis in normal and mutant human fibroblasts. Evidence for a processing enzyme activity deficient in cblC cells. J. Biol. Chem. 254, 11847–11853. Quadros, E. V., Matthews, D. M., Hoffbrand, A. V., and Linnell, J. C. (1976) Synthesis of cobalamin coenzymes by human lymphocytes in vitro and the effect of folates and metabolic inhibitors. Blood 48, 609 – 619. Chanarin, I. (1979) Biochemistry of cobalamins. In Megaloblastic Anemias, pp. 4 –21. Blackwell Scientific, Oxford, UK. Donaldson, R. M., Jr., Brand, M., and Serfilippi, D. (1977) Changes in circulating transcobalamin II after injection of cyanocobalamin. N. Engl. J. Med. 296, 1427–1430. Quadros, E. V., Rothenberg, S. P., and Jaffe, E. A. (1989) Endothelial cells from human umbilical vein secrete functional transcobalamin II. Am. J. Physiol. 256, C296 –C303. Hakami, N., Neiman, P. E., Canellos, G. P., and Lazerson, J. (1971) Neonatal megaloblastic anemia due to inherited transcobalamin II deficiency in two siblings. N. Engl. J. Med. 285, 1163–1170. Hall, C. A. (1992) The neurologic aspects of transcobalamin II deficiency. Br. J. Haematol. 80, 117–120. Haurani, F. I., Hall, C. A., and Rubin, R. (1979) Megaloblastic anemia as a result of an abnormal transcobalamin II (Cardeza). J. Clin. Invest. 64, 1253– 1259. Seligman, P. A., Steiner, L. L., and Allen, R. H. (1980) Studies of a patient with megaloblastic anemia and an abnormal transcobalamin II. N. Engl. J. Med. 303, 1209 –1212. Platica, O., Janeczko, R., Quadros, E. V., Regec, A., Romain, R., and Rothenberg, S. P. (1991) The cDNA sequence and the deduced amino acid sequence of human transcobalamin II show homology with rat intrinsic factor and human transcobalamin I. J. Biol. Chem. 266, 7860 –7863.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27. 28.

141

Regec, A., Quadros, E. V., Platica, O., and Rothenberg, S. P. (1995) The cloning and characterization of the human transcobalamin II gene. Blood 85, 2711– 2719. Li, N., Seetharam, S., and Seetharam, B. (1995) Genomic structure of human transcobalamin II: Comparison to human intrinsic factor and transcobalamin I. Biochem. Biophys. Res. Commun. 208, 756 –764. Li, N., Rosenblatt, D. S., and Seetharam, B. (1994) Nonsense mutations in human transcobalamin II deficiency. Biochem. Biophys. Res. Commun. 204, 1111– 1118. Li, N., Rosenblatt, D. S., Kamen, B. A., Seetharam, S., and Seetharam, B. (1994) Identification of two mutant alleles of transcobalamin II in an affected family. Hum. Mol. Genet. 3, 1835–1840. Li, N., Seetharam, S., Rosenblatt, D. S., and Seetharam, B. (1994) Expression of transcobalamin II mRNA in human tissues and cultured fibroblasts from normal and transcobalamin II-deficient patients. Biochem. J. 301, 585–590. Novo, F. J., Kruszewski, A., MacDermot, K. D., Goldspink, G., and Gorecki, D. C. (1995) Editing of human alpha-galactosidase RNA resulting in a pyrimidine to purine conversion. Nucleic Acids Res. 23, 2636 –2640. Sharma, P. M., Bowman, M., Madden, S. L., Rauscher, F. J., 3rd, and Sukumar, S. (1994) RNA editing in the Wilms’ tumor susceptibility gene, WT1. Genes Dev. 8, 720 –731. Wickramasinghe, S. N., and Matthews, J. H. (1988) Deoxyuridine suppression: Biochemical basis and diagnostic applications. Blood Rev. 2, 168 –177. Rothenberg, S. P., and Quadros, E. V. (1997) Quantitative methods for measurement of transcobalamin II. Methods Enzymol. 281, 261–268. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294 –5299. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467. Fowler, B. (1998) Genetic defects of folate and cobalamin metabolism. Eur. J. Pediatr. 157(Suppl. 2), S60 –S66. Eckert, K. A., and Kunkel, T. A. (1993) Fidelity of DNA synthesis catalyzed by human DNA polymerase alpha and HIV-1 reverse transcriptase: Effect of reaction pH. Nucleic Acids Res. 21, 5212–5220. Niswender, C. M. (1998) Recent advances in mammalian RNA editing. Cell Mol. Life Sci. 54, 946 –964. Seeburg, P. H., Higuchi, M., and Sprengel, R. (1998) RNA editing of brain glutamate receptor channels: Mechanism and physiology. Brain Res. Brain Res. Rev. 26, 217–229.

Blood Cells, Molecules, and Diseases (2002) 28(2) Mar/Apr: 134 –142 doi:10.1006/bcmd.2002.0499, available online at http://www.idealibrary.com on

29.

Davidson, N. O., Anant, S., and MacGinnitie, A. J. (1995) Apolipoprotein B messenger RNA editing: Insights into the molecular regulation of post-transcriptional cytidine deamination. Curr. Opin. Lipidol. 6, 70 –74. 30. Davidson, N. O., and Shelness, G. S. (2000) Apolipoprotein B: mRNA editing, lipoprotein assembly, and presecretory degradation. Annu. Rev. Nutr. 20, 169 –193.

Qian et al.

31.

Chan, L. (1993) RNA editing: Exploring one mode with apolipoprotein B mRNA. Bioessays 15, 33– 41. 32. Eng, C. M., Guffon, N., Wilcox, W. R., Germain, D. P., Lee, P., Waldek, S., Caplan, L., Linthorst, G. E., and Desnick, R. J. (2001) Safety and efficacy of recombinant human alpha galactosidase-A replacement therapy in Fabry’s disease. N. Eng. J. Med. 345, 55– 57.

142