Journal of Immunological Methods 233 Ž2000. 107–118 www.elsevier.nlrlocaterjim
Recombinant Technology
Competitive PCR for quantification of minimal residual disease in acute lymphoblastic leukaemia Charlotte Nyvold a,) , Hans O. Madsen a , Lars P. Ryder a , Jeanette Seyfarth a , Christina A. Engel a , Arne Svejgaard a , Finn Wesenberg c , Kjeld Schmiegelow a
b
Department of Clinical Immunology, The National UniÕersity Hospital, Rigshospitalet, TagensÕej 20, DK-2200 Copenhagen, Denmark b Department of Paediatrics, The National UniÕersity Hospital, Rigshospitalet, Copenhagen, Denmark c Department of Paediatrics, The UniÕersity Hospital, Rikshospitalet, Oslo, Norway Received 9 April 1999; received in revised form 2 July 1999; accepted 26 July 1999
Abstract A very precise and reproducible polymerase chain reaction ŽPCR. method was developed in order to quantify minimal residual disease ŽMRD. in children with acute lymphoblastic leukaemia ŽALL.. A clone-specific competitor was constructed by introducing a restriction site in a PCR product identical to parts of the highly specific rearranged T-cell receptor d ŽTCR-d ., T-cell receptor g ŽTCR-g ., or immunoglobulin heavy chain ŽIgH. genes of the malignant clone. Using primers located externally to the restriction site the competitor and the DNA from the malignant clone will be amplified under identical conditions. After restriction enzyme cleavage, the PCR products originating from the competitor and the malignant clone can be distinguished by size in a gel electrophoresis step and the amount of residual disease can be determined. The method is very sensitive with a detection limit of at least one malignant cell in 10 5 normal cells. This method may be used for treatment stratification based on the early response to antileukaemic therapy. q 2000 Elsevier Science B.V. All rights reserved. Keywords: Quantitative PCR; Competitive PCR; Acute lymphoblastic leukaemia, ALL; Minimal residual disease, MRD
1. Introduction The quantitative evaluation of minimal residual disease ŽMRD. has become a key procedure in many AbbreÕiations: PCR, polymerase chain reaction; MRD, minimal residual disease; ALL, acute lymphoblastic leukaemia; TCR-d, T-cell receptor d; TCR-g, T-cell receptor g; IgH, immunoglobulin heavy chain; NOPHO, Nordic Society of Paediatric Haematology and Oncology ) Corresponding author. Tel.: q45-35457631; fax: q4535398766; e-mail:
[email protected]
protocols for the treatment of childhood acute lymphoblastic leukaemia ŽALL.. The outcome of ALL has improved significantly within the last two decades and the 5-year event-free survival is presently close to 80% in the Nordic countries. These results have been obtained through an intensification of therapy which, unfortunately, is also associated with increased short- and long-term morbidity. The early response to induction therapy as measured by morphologic examination of bone marrow aspirates is related to the subsequent risk of relapse ŽMiller et
0022-1759r00r$ - see front matter q 2000 Elsevier Science B.V. All rights reserved. PII: S 0 0 2 2 - 1 7 5 9 Ž 9 9 . 0 0 1 1 3 - 1
108
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
al., 1989; Gaynon et al., 1990.. More precise quantification of residual leukaemia following induction therapy might Ža. allow more individualised treatment offering good responders less intensive therapy with less sequelae, and Žb. identify patients, who need more intensive treatment or even bone marrow transplantation during first remission in order to achieve cure. Most approaches to the detection and subsequent quantification of MRD have employed detection of clone-specific rearranged DNA sequences, especially the rearranged CDRIII regions of the immunoglobulin heavy chain ŽIgH., the T-cell receptor d ŽTCR-d ., and the T-cell receptor g ŽTCR-g . genes. Like their normal counterparts, the IgH, TCR-d, and TCR-g genes of the malignant cells rearrange during early development. The rearrangements are not linespecific because precursor B cell leukaemias often have T-cell receptor rearrangements and T cell leukaemias have been reported with IgH rearrangements ŽPelicci et al., 1985; Waldmann et al., 1985; Davey et al., 1986; Felix et al., 1987.. More than one gene rearrangement will frequently be present in the same sample ŽForestier et al., 1994.. At diagnosis, such clonally expanded gene rearrangements can usually be detected by PCR amplification using consensus primers covering the junctional regions of the IgH and TCR genes followed by DNA sequencing. This DNA sequence can then be the basis for the design of a clone-specific PCR primer subsequently used in the tracing of the malignant clone during treatment. Several techniques have been applied to quantify MRD, e.g., Southern blotting of PCR products using serial dilution of bone marrow samples as template DNA ŽSeriu et al., 1995a. or techniques based on limiting dilution ŽBrisco et al., 1991; Sykes et al., 1992; Ouspenskaia et al., 1995.. The Southern blotting techniques are, however, not sufficiently precise and quantitative to permit individually targeted therapy and the limiting dilution technique is not convenient for use in a routine setting. The recently developed real time quantitative PCR technology might be a reliable method to quantify MRD, but the sensitivity is not yet as high as a nested PCR ŽPongers-Willemse et al., 1998.. The Nordic Society of Paediatric Haematology and Oncology ŽNOPHO. ALL MRD-95 study, which
includes all children in Iceland, Norway and Denmark diagnosed with ALL, was initiated to explore the clinical applicability of stratifying treatment based on precise quantification of residual leukaemia on treatment days 15 and 29. For this purpose we developed a new quantitative method based on competitive PCR since previously techniques have not been sufficiently precise. Some clinical data from the NOPHO ALL MRD-95 study have previously been published in abstract form ŽSchmiegelow et al., 1998a,b..
2. Patients, materials and methods 2.1. Samples Bone marrow and blood samples were obtained from eight patients with ALL at the time of diagnosis and on days 15 and 29 after the beginning of induction therapy ŽTable 1.. The patients were treated according to the NOPHO ALL 92 protocol. Mononuclear cells from bone marrow and blood were isolated by Ficoll density centrifugation ŽLymphoprep, Pharmacia, Uppsala, Sweden.. DNA was prepared, either from viable cells washed in 0.9% NaCl and cryopreserved in RPMI and DMSO in liquid nitrogen or from freshly isolated mononuclear cells, by NaCl precipitation ŽMiller et al., 1988. or phenol extraction. The DNA concentration and quality were measured by spectrophotometry and the DNA was stored at y208C. 2.2. PCR at diagnosis DNA from samples taken at diagnosis was used as the template for biotin labelled primers covering part of the conserved domains on each sides of the rearrangement site ŽTable 2.. Six PCRs were performed on bone marrow samples at diagnosis, i.e. TCR-g-V1 – 8 J1r2 , TCR-g-V9 J1r2 , TCR-d-V2 D 3 , IgHVFR3 J, IgH-VFR1-C and IgH-VFR1,mix J ŽTable 2.. The PCR was performed in a thermocycler ŽGeneAmp PCR System 9600, Perkin-Elmer, Connecticut, USA or Peltier Thermal Cycler 200, MJ Research, MA, USA. on 0.5 mg genomic DNA in a volume of 50 ml. The reaction mixture contained 1.5 mM MgCl 2 , 0.2 mM of each dNTP, 50 mM KCl, 20 mM Tris–
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
109
Table 1 Clone-specific domains from the eight patients used in this study
HCl ŽpH 8.4., 1.25 unit of DNA Taq Polymerase ŽLife Technologies, MD, USA., 0.28 mg of anti-Taq ŽClontech, CA, USA. and 12.5 pmol of each primer. The PCR conditions were standardised to: 35 cycles of 30 s at 948C, 60 s at 588C, 60 s at 728C, initiated by 2 min of denaturation at 948C and completed by 5 min of extension at 728C. The PCR products were analysed by a 3% agarose gel electrophoresis, followed by UV-visualisation of ethidium-bromidestained DNA.
using the primers V2r4 seq, V3r5 seq, and V8 seq, one for the PCR product TCR-g-V9 J1r2 using the primer V9 seq, one for the PCR product TCR-d-V2 D 3 using the primer V2 seq, one for the PCR product IgH-VFR3 J using the primer Jseq, one for the PCR product IgH-VFR1-C using the primer Jseq, and one for the PCR product IgH-VFR1,mix J using the primer VFR3 seq. The sequencing primers are listed in Table 2.
2.3. DNA sequencing
Consensus primer regions were chosen for TCR-d in the conserved V2 gene, for the TCR-g in a consensus domain with sequence homology shared by the J1 and J2 genes, and for IgH in the sequence domains just downstream of each of the functional J genes ŽTable 3.. Consensus areas for the latter sequences were found by comparison of the human immunoglobulin m-locus ŽRavetch et al., 1981. Žcontaining the six functional IgH J-gene sequences. with DNA sequences of the same region obtained from cloned PCR products from a population of healthy
The DNA sequence specific for the rearranged clone was obtained by direct, solid-phase sequencing of the biotin-labelled PCR products using streptavidin-coated magnetic beads ŽDynal, Skoeyen, Norway.. This method permits detection of a clonal population representing down to 0.1–1% of the total mononuclear cells Žunpublished observations, H.O. Madsen, 1998.. Three different sequencing reactions were performed for the PCR product TCR-g-V1 – 8 J1r2
2.4. Consensus primers for competitiÕe PCR analysis
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
110
Table 2 Consensus primers for PCR and sequencing TCR-g
TCR-d
IgH
V1 – 8 V9 J1r 2 V2r 4 seq V3r 5 seq V8 seq V9 seq V2 D3 V2 seq VFR 3 VFR 1-C J Jseq VH1 -FR1 VH2 -FR1 VH3 -FR1 VFR1,mix VH4 a-FR1 VH4 b-FR1 VH5 -FR1 VH6 -FR1 VFR 3 seq
PCR PCR PCR Seq Seq Seq Seq PCR PCR Seq PCR PCR PCR Seq PCR PCR PCR
C CTGCAGTCAGAAATCTTCCAACTTG GAAAGGAATCTGGCATTCCG AGGATCCCTCTATTACCTTGGAAATG AGCACAAGGAAŽCrG.AACTTGAG GAGGTGGAGCTGGATATTGA GGGAAGAGCCTTAAATTTAT GGTAGCTATGTCCTGTTTCTCTAC CAAGGTGACATTGATATTGC GTTGTCTCCTCCTGAGGCATGGG GAACCTGGCTGTACTTA CTGTCGACACGGCŽCrT.ŽGrC.TGTATTACT AGGTGCAGCTGŽGrC.ŽArT.GŽGrC.AGTCŽGrArT.GG GTGGATCC TGAGGAGACGGTGACC GAGGAGACGGTGACC CCTCAGTGAAGGTCTCCTGCAAGG TCCTGCGCTGGTGAAAGCCACACA GGTCCCTGAGACTCTCCTGTGCA
PCR PCR PCR PCR Seq
TCGGAGACCCTGTCCCTCACCTGCA CGCTGTCTCTGGTTACTCCATCAG GAAAAAGCCCGGGGAGTCTCTGAA CCTGTGCCATCTCCGGGGACAGTG GACACGGCŽCrT.ŽGrC.TGTAT
The primers were designed by Macintyre et al. Ž1990., Yamada et al. Ž1989., Deane and Norton Ž1990., or in our laboratory by H.O. X Madsen. The PCR primers TCR-g-J1r 2 , TCR-d-D3 and IgH-J were all 5 -biotinylated. When IgH-J is used in combination with IgH-V-FR3, X the latter is 5 -biotinylated. Restriction sites are highlighted and in italic.
individuals. The comparison was performed using the GCG package ŽGenetics Computer Group, 1994.. The consensus sequences were reported to GenBank and provided with the accession numbers: AF162697, AF162698, AF162699, AF162700, AF162701, AF162702. 2.5. Creation of a competitor The competitors were created by PCR using genomic patient DNA as template. The DNA was extracted from either bone marrow mononuclear cells or blood mononuclear cells at the time of diagnosis. A clone-specific primer covering the rearrangement site ŽFig. 1. was used together with a primer from a conserved domain including a 3X mutation that creates the restriction site XhoI Žprimer-XhoI in Table 3.. The clone-specific primers were designed from the DNA sequences of the malignant clones determined at diagnosis. The PCR was performed as described above. The PCR product was cloned using the pCRw 2.1-TOPO kit ŽInvitrogen, Leek, the
Netherlands. and the competitor was made directly from the bacterial colony using vector-specific primers. Sequences were verified through DNA sequencing. The concentration of the competitor was determined by titration of a known quantity of a molecular standard pBR322rHaeIII ŽBoehringer Mannheim, Mannheim, Germany. in 96-well plates together with the competitor. The DNA concentration of the competitor was determined by a scanning procedure using the Cream 1-D package ŽKem-EnTec, Copenhagen, Denmark.. The concentration of competitor copies was calculated as: Ccompetitor w grml x P NA w copiesrmolex Mcompetitor w grmolex where NA is Avogadro’s number Žs 6.02 = 10 23 wcopiesrmolex.. The concentrations were verified by limiting dilution. The dilution series of the competitor used for competitive PCR was further diluted to 0.1 copyrml and 0.01 copyrml. Nested PCR was performed in 5
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
111
Table 3 Primer areas for the competitive PCR analysis TCR-delta-V2-XhoI TCR-delta-V2-1 TCR-delta-V2-2 TCR-gamma-XhoI TCR-gamma-1 TCR-gamma-2 IgH-J1-intron-XhoI IgH-J1-intron-1 IgH-J1-intron-2 IgH-J2-intron-XhoI IgH-J2-intron-1 IgH-J2-intron-2 IgH-J3-intron-XhoI IgH-J3-intron-1 IgH-J3-intron-2 IgH-J4-intron-XhoI IgH-J4-intron-1 IgH-J4-intron-2 IgH-J5-intron-XhoI IgH-J5-intron-1 IgH-J5-intron-2 IgH-J6-intron-XhoI IgH-J6-intron-1 IgH-J6-intron-2
CAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTCGAGATA CAAGGTGACATTGATATTGC GCAAAGAACCTGGCTGTACT TTTCTACATCAAATCCCCATCCAATTCCTCGAGTTTC TTTCTACATCAAATCCCCAT AAATCCCCATCCAATTCCTC CCAAGTCTGAAGCCAAAGCCCTTGCCTGCTCGAGTAC CCAAGTCTGAAGCCAAAGC AAGCCAAAGCCCTTGCCTG CATGGCGGAGACCCCAGGGATGGCAGCTCGAGTGGCCT CATGGCGGAGACCCCAGGG GACCCCAGGGATGGCAGCT CAAGGAGCCCCCGGACATTATCTCCCAGCTCGAGGAC CAAGGAGCCCCCGGACATT CGGACATTATCTCCCAGCTC AGCCCCCCAGGCTGCTCCGGGGCTCTCTCGAGAGGA AGCCCCCCAGGCTGCTCC GCTGCTCCGGGGCTCTCT CAGCTGCCGACATCTGTGGCCGGACTCGAGGAG CAGCTGCCGACATCTGTGG CGACATCTGTGGCCGGACT ACAGGCAGTAGCAGAAAACAAAGGCCCTCGAGTGGCC ACAGGCAGTAGCAGAAAAC AGCAGAAAACAAAGGCCC
The restriction sites for XhoI are highlighted and in italic.
replicates using 1 competitor copy, 0.1 competitor copy, 0.01 competitor copy, and H 2 O Žto exclude false positive PCR’s. as template. The criteria for acceptance of the competitor concentration was that 1, 2, 3, 4, or 5 of the 5 tubes with 1 competitor copy were PCR positive, that 0, 1, or 2 of the 5 tubes with 0.1 competitor copy were PCR positive, that 0 or 1 of the 5 tubes with 0.01 competitor copy were PCR positive and none of the negative controls were positive. These criteria were determined by assuming a Poisson distribution of the DNA copies in each tube and a binomial distribution of PCR positive tubes. 2.6. Semi-nested PCR A semi-nested PCR was used to increase the sensitivity of the quantitative PCR. The first PCR was performed with a clone-specific primer ŽTable 1. and consensus primer-1 ŽTable 3.. In the second PCR the clone-specific primer was reused together with consensus primer-2 ŽTable 3. The first PCR
was carried out in a total volume of 50 ml using the standard PCR procedure described above with the modification that the number of cycles was 26 and the annealing temperature was raised to 618C. In the nested amplification 0.5 ml PCR product from the first round of amplification was added in a total volume of 25 ml and reamplified with an annealing temperature of 618C, and a cycle number of 43. 2.7. Application of the competitor on DNA from the diagnostic bone marrow samples Eight hundred to one thousand copies Ždetermined by spectrophotometry. of total genomic DNA from the diagnostic bone marrow were amplified together with 10 4 , 10 3 , 750, 500, 250, 100 and 10 copies respectively of the competitor. Four control tubes with Ža. genomic DNA from the diagnostic bone marrow, Žb. competitor DNA, Žc. H 2 O, and Žd. a pool of lymphocyte DNA from healthy individuals were included in each titration series.
112
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
Fig. 1. The competitor was constructed by PCR by using genomic DNA from the malignant clone as template together with a clone-specific primer and primer-XhoI to introduce the restriction site. The first amplification in the semi-nested PCR was done with the clone-specific primer and primer-1 and the second amplification with the clone-specific primer and primer-2. The PCR products from the competitor are cleaved by the restriction enzyme XhoI while the PCR products from the malignant clone remain uncleaved.
2.8. Measurement of residual disease
2.9. Precautions against contamination of the PCR
At days 15 and 29, 100,000 copies of genomic DNA Žor less in the case of a hypocellular bone marrow. were amplified together with 10 5, 10 4 , 10 3, 750, 500, 250, 100, 75, 50, 25, 10, and 1 copies respectively of the competitor. The PCR products were digested with the restriction enzyme XhoI and the samples were analysed by 3% ethidiumbromide-stained agarose gel electrophoresis. Molar equality was found in the lane where the band originating from the competitor Žcompletely digested by XhoI. was approximately as intense as the undigested band originating from the malignant clone after correcting for the lower capacity to bind EtBr caused by the smaller molecular size of the competitor. The lane with molar equality could either be determined by a scanning procedure using the Cream 1-D package ŽKem-En-Tec. or visually. Both methods were shown to give the same results.
Meticulous precautions were taken to avoid contamination with previously made PCR products. The PCR was set up in a designated room located in another building and the technicians wore disposable clothes, i.e. lab coat, gloves, hair cover, and shoe covers.
3. Results 3.1. Detection of the clonal marker Samples from ALL patients, in whom we identified a clone-specific gene rearrangement could be quantified with our competitive PCR system. A clone-specific rearrangement was found in 98% of ALL patients at the time of diagnosis Žunpublished results of 192 patients studied..
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
3.2. SensitiÕity Using this semi-nested competitive PCR method we were able technically to detect one malignant cell in a background of 1,000,000 normal cells Žcorresponding to 6.25 mg genomic DNA. in a PCR volume of 50 ml. A limiting factor to the sensitivity was often the number of mononuclear cells in the 2–5 ml bone marrow aspirates obtained on days 15 and 29 when hypoplasia was frequently found. Therefore the analysis were routinely performed on only 100,000 mononuclear bone marrow cells. 3.3. Consistency More than one marker were detected in 72% of patients with the panel of PCR primers and sequencing primers applied. The reproducibility of the quantitative PCR method was tested on five patients Žpatients no. 1, 2, 3, 4 and 5, Table 1. by using two or three different genetic markers for tracing the same malignant clone. A competitor was designed for each of these genetic markers and its suitability
113
for quantitative MRD analysis was approved if the amount of MRD was between 25% and 100% at diagnosis. If the amount of MRD differed by more than a factor of two for the two markers at the time of diagnosis the minor clone was regarded as a subclone and was not included in this study. The samples obtained on days 15 and 29 were examined for MRD by the competitive quantification method. As shown in Fig. 2, the curves corresponding to the same clone followed each other thereby illustrating the reliability and reproducibility of the method. The bold lines indicate that two curves for the same patient were visually identical. The Spearman coefficient of correlation between the markers with the highest MRD and the markers with the lowest MRD was 0.98, Ž p s 0.0004. when only the two markers with the largest difference in MRD were used in the cases where three markers were investigated. 3.4. Accuracy To test the reliability of the PCR system, the MRD of three patients Žpatient no. 6: TCR-g, patient
Fig. 2. Patient no. 1 was quantified with two different clonal markers ŽTCR-d and IgH., patient no. 2 with two different clonal markers Žtwo TCR-g markers., patient no. 3 with two different clonal markers Žtwo TCR-d markers., and patient no. 4 with three different clonal markers ŽTCR-d, TCR-g and IgH. at the time of diagnosis and on days 15 and 29 after the beginning of induction therapy. Patient no. 5 was quantified with three different clonal markers Žtwo TCR-g markers and IgH. at the time of diagnosis and on day 29 after the beginning of induction therapy. The curves corresponding to the same clonal marker follow each other and illustrate the reliability and reproducibility of the method. The bold lines illustrate that two or three curves for the same patient are visually identical.
114
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
no. 7: TCR-d, and patient no. 8: IgH-J6, Table 1. were quantified at the time of diagnosis in three
different titration series ŽFig. 3.. In each series, the same twofold dilution series was used for the com-
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
petitor Ž2048, 1024, 512, 256, 128, 64, 32, 16, 8, 4, 2, and 1 copy respectively. while the genomic DNA was added in different concentrations Ž512, 64, and 8 genomic DNA copies respectively.. In each of the series a negative control and a control with a pool of lymphocyte DNA from healthy individuals were included. As indicated by arrows in Fig. 3, the point of equivalence Žcorrecting for the lower capacity for binding EtBr caused by the smaller molecular size. where the initial concentration of genomic DNA equals the initial concentration of competitor DNA was shifted 3 lanes to the right when the concentration of genomic DNA was reduced by a factor of eight. 3.5. Reproducibility To test the reproducibility of the method a single sample was analysed repetitively. The competitor was titrated by a factor of two Ž128, 64, 32, 16, 8, 4, 2, and 1 copy. and genomic DNA corresponding to 12 malignant cells diluted in DNA from 100,000 normal lymphocytes was added in each tube. The number of malignant cells was chosen as it corresponded to the median value at the end of induction therapy for patients in the NOPHO ALL MRD-95 study. A negative control and a control with a pool of lymphocyte DNA from normal cells were included in each experiment. Out of eight experiments five showed equilibrium between eight and 16 competitor copies as expected and three showed equilibrium at 16 competitor copies which was acceptable. 4. Discussion Detection of MRD with PCR in childhood ALL has mainly been applied either to determine residual
115
disease following induction therapy, i.e., early response to therapy, or to detect residual disease later on during therapy as reflecting persisting or even expanding leukaemia at a subclinical level. The rationale of the first application was supported by a number of earlier histomorphologic studies which indicated that the early response to therapy was clinically and statistically closely related to the risk of subsequent relapse ŽMiller et al., 1989; Gaynon et al., 1990.. This seemed to be the case whether it was determined through morphologic quantification of residual leukaemia ŽMiller et al., 1989; Gaynon et al., 1990. or through PCR based techniques ŽWasserman et al., 1992; Brisco et al., 1994; Cave et al., 1994; O’Reilly et al., 1995; Cave et al., 1998; Gruhn et al., 1998.. However, a major drawback of many of the PCR methods previously published has been either their lack of sensitivity or their lack of reproducibility. Morphological assessment of the bone marrow is a simple method to detect MRD but the sensitivity is only 5% ŽPotter, 1992. which is the level that defines morphologic remission. Using this method, less than 3% of all children treated according to the Nordic ALL protocols had detectable blasts on day 29 Žunpublished.. Although such patients have been shown to have an inferior outcome, the blast count on day 29 would predict only a few of the total number of relapses in childhood ALL. An alternative DNAbased method often used is the Southern-blot-based technique where a clone-specific probe has been used for tracing the malignant clone during and after treatment ŽJonsson et al., 1990; Wasserman et al., 1992; O’Reilly et al., 1995; Seriu et al., 1995a,b.. A drawback of this approach was the lack of reliability in quantifying the clone by hybridisation with clone-specific probes, because different probes
Fig. 3. Titration of the competitive PCR procedure. MW: molecular marker. The number of competitor copies ŽCC. are as follows: lane 1: 2048 CC, lane 2: 1024 CC, lane 3: 512 CC, lane 4: 256 CC, lane 5: 128 CC, lane 6: 64 CC, lane 7: 32 CC, lane 8: 16 CC, lane 9: 8 CC, lane 10: 4 CC, lane 11: 2 CC, and lane 12: 1 CC. Lane 13: H 2 O and lane 14: pool of lymphocyte DNA from healthy individuals. ŽA., ŽD., and ŽG.: 512 genomic copies ŽGC. in lanes 1–12. ŽB., ŽE., and ŽH.: 64 GC in lanes 1–12. ŽC., ŽF., and ŽI.: 8 GC in lanes 1–12. ŽA., ŽB. and ŽC.: MRD from patient no. 6 quantified with a clone-specific TCR-g marker. ŽD., ŽE., and ŽF.: MRD from patient no. 7 quantified with a clone-specific TCR-d marker. G, H, and I: MRD from patient no. 8 quantified with a clone-specific IgH-J6 marker. The competitor band will appear less intense than the genomic band at the equilibrium point due to the lower capacity for binding EtBr caused by the smaller molecular size of the competitor. The equilibrium points are indicated by arrows. Example of calculation of MRD: ŽH. 64r64s 100%. Note: ŽD., ŽE., ŽG., ŽH., and ŽI.: the photos have been cut between lanes 12 and 13 to exclude two lanes with additional controls as they were not relevant in this context.
116
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
were found to hybridise with different efficiencies. Wasserman et al. Ž1992. described a method of quantitative detection of malignant cells using phage libraries of the remission samples hybridised with clone-specific probes compared with the same phage library hybridised with a conserved probe. The extent and efficacy of hybridisation, however, strongly depends on the nucleotide sequence of the probes. Quantifying by limiting dilution has been another commonly used PCR-based approach. Ouspenskaia et al. Ž1995. used this method, which was based on the all-or-none response of the PCR within large groups of replicates. The same method was employed by the group of Brisco ŽBrisco et al., 1991., where an internal control was performed on the N-ras gene. However, coamplification with an internal control was believed to decrease the PCR sensitivity ŽOuspenskaia et al., 1995.. One of the weaknesses of limiting dilution is that the method relies on an all-or-none endpoint with an equal probability of a positive read-out regardless of whether one, two or more templates are present. Another weak point was that it can be impossible to distinguish between positive PCRs and contamination. A competitive PCR was developed by Cave´ et al. ŽCave et al., 1994, 1998. using a monoclonal T-cell clone as a competitor against the malignant clone. The competitor was added in a fixed quantity to a number of PCR tubes while the genomic DNA from the patient’s sample was titrated in the same tubes. PCR was performed with consensus primers with equal affinity for the competitor and the malignant clone. The PCR products were dot blotted on a membrane in duplicate and each series was hybridised with the competitor and the patient-specific probe, respectively, and the hybridisations were finally compared. An advantage of this method was that the competitor ŽDNA from a monoclonal T-cell clone. and the DNA from the malignant clone were amplified under identical conditions because the conserved primer sites were identical. A disadvantage was that it was necessary to hybridise with two different probes with different affinity for the PCR products to identify the PCR products derived from the competitor and the malignant clone. Pongers-Willemse et al. Ž1998. applied ‘real-time’ quantitative PCR based on TaqMan technology to DNA from bone marrow and blood samples in order
to detect MRD in ALL patients. Although this method was fast and reliable the sensitivity has not so far been as good as a nested PCR. Thus the clinical applicability of this technique depends on whether the very good responders Žvery low MRD level. or the poor responders Žhigh MRD level. need to be identified. The advantages of our competitive PCR quantification method is that we ensured an identical amplification and subsequent identification of the DNA from the malignant clone and the competitor as both were subject to the same conditions during the entire PCR. By restriction enzyme cleavage followed by gel electrophoresis we could easily distinguish between the PCR products derived from the competitor and from the malignant clone. Furthermore, cases of contamination would have been discovered because our gel electrophoresis band pattern ŽFig. 3. would deviate from the one expected. In this competitive PCR system, hetero-duplex formation during the last cycle of the PCR might, in theory, influence the result. If not all single-stranded templates are copied by a new strand synthesis in the last PCR cycle, single-stranded templates containing the XhoI site might anneal ‘incorrectly’ to singlestranded templates without the XhoI site. Such hetero-duplexes will not be cleaved by the restriction enzyme XhoI thus mimicking the clonal PCR product, eventually leading to a falsely high estimate of MRD. Theoretically, this hetero-duplex formation will, at maximum, displace the equilibrium by a factor of two, which is tolerable. The detection of the malignant clone by PCR in patients in complete clinical remission does not necessarily indicate a later relapse ŽRoberts et al., 1997., but the kinetics of the disappearing malignant clone during induction therapy is believed to be an important indicator for the prognosis in ALL ŽMiller et al., 1989; Wasserman et al., 1992; Brisco et al., 1994.. Beyond using the quantitative PCR to determine the early response to therapy, the assay could also be of value during and after treatment to detect a residual or expanding leukaemic clone in order to predict the risk of subsequent relapse ŽNeale et al., 1991; O’Reilly et al., 1995.. Although a number of retrospective and prospective studies have provided evidence that the amount of residual leukaemia following 4 weeks of induction
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
therapy is of prognostic significance, the full impact of these findings depends on their clinical applicability. The NOPHO ALL MRD-95 study aims at defining cut-off levels for the possible stratification of children with non-B cell ALL to therapy programs of different intensity in order to avoid both unnecessary long-term toxicity and failures due to insufficient treatment intensity. To achieve this, a highly reliable, precise, and reproducible method is needed which is applicable for at least 95% of children with ALL. The competitive assay detailed in this report fulfil these requirements. The ongoing study will determine to what extent it can be incorporated into future ALL treatment strategies.
Acknowledgements We wish to thank Ewa Szojmer, Ingrid Alsing, Tina Hartvig, Line Brixen, Michael Timm and Jannie Gregers for excellent technical assistance. This study has received financial support from: The Danish Medical Research Council Žgrant no. 9401011., The Biotechnological Centre for Cellular Communication, The Danish Cancer Society Žgrant no. 9510028, 9610007., The Kornerup Foundation, The Emil C. Hertz Foundation, and The Children’s Cancer Foundation, Sweden Žgrant no. 1996-073..
References Brisco, M.J., Condon, J., Sykes, P.J., Neoh, S.H., Morley, A.A., 1991. Detection and quantitation of neoplastic cells in acute lymphoblastic leukaemia, by use of the polymerase chain reaction. Br. J. Haematol. 79, 211. Brisco, M.J., Condon, J., Hughes, E., Neoh, S.H., Sykes, P.J., Seshadri, R., Toogood, I., Waters, K., Tauro, G., Ekert, H. et al., 1994. Outcome prediction in childhood acute lymphoblastic leukaemia by molecular quantification of residual disease at the end of induction. Lancet 343, 196. Cave, H., Guidal, C., Rohrlich, P., Delfau, M.H., Broyart, A., Lescoeur, B., Rahimy, C., Fenneteau, O., Monplaisir, N., d’Auriol, L. et al., 1994. Prospective monitoring and quantitation of residual blasts in childhood acute lymphoblastic leukemia by polymerase chain reaction study of delta and gamma T-cell receptor genes. Blood 83, 1892. Cave, H., van der Werff ten Bosch, J., Suciu, S., Guidal, C., Waterkeyn, C., Otten, J., Bakkus, M., Thielemans, K., Grandchamp, B., Vilmer, E., 1998. Clinical significance of minimal residual disease in childhood acute lymphoblastic
117
leukemia. European Organization for Research and Treatment of Cancer—Childhood Leukemia Cooperative Group. N. Engl. J. Med. 339, 591. Davey, M.P., Bongiovanni, K.F., Kaulfersch, W., Quertermous, T., Seidman, J.G., Hershfield, M.S., Kurtzberg, J., Haynes, B.F., Davis, M.M., Waldmann, T.A., 1986. Immunoglobulin and T-cell receptor gene rearrangement and expression in human lymphoid leukemia cells at different stages of maturation. Proc. Natl. Acad. Sci. U.S.A. 83, 8759. Deane, M., Norton, J.D., 1990. Immunoglobulin heavy chain variable region family usage is independent of tumor cell phenotype in human B lineage leukemias. Eur. J. Immunol. 20, 2209. Felix, C.A., Wright, J.J., Poplack, D.G., Reaman, G.H., Cole, D., Goldman, P., Korsmeyer, S.J., 1987. T cell receptor alpha-, beta-, and gamma-genes in T cell and pre-B cell acute lymphoblastic leukemia. J. Clin. Invest. 80, 545. Forestier, E., Nordenson, I., Lindstrom, A., Roos, G., Lindh, J., 1994. Simultaneous immunoglobulinrT-cell receptor gene rearrangements and multiclonality in childhood acute lymphoblastic leukemia. Acta Paediatr. 83, 319. Gaynon, P.S., Bleyer, W.A., Steinherz, P.G., Finklestein, J.Z., Littman, P., Miller, D.R., Reaman, G., Sather, H., Hammond, G.D., 1990. Day 7 marrow response and outcome for children with acute lymphoblastic leukemia and unfavorable presenting features. Med. Pediatr. Oncol. 18, 273. Genetics Computer Group, 1994. Program manual for the Wisconsin package. 8. Computer Program, Madison, WI. Gruhn, B., Hongeng, S., Yi, H., Hancock, M.L., Rubnitz, J.E., Neale, G.A.M., Kitchingman, G.R., 1998. Minimal residual disease after intensive induction therapy in childhood acute lymphoblastic leukemia predicts outcome. Leukemia 12, 675. Jonsson, O.G., Kitchens, R.L., Scott, F.C., Smith, R.G., 1990. Detection of minimal residual disease in acute lymphoblastic leukemia using immunoglobulin hypervariable region specific oligonucleotide probes. Blood 76, 2072. Macintyre, E.A., d’Auriol, L., Duparc, N., Leverger, G., Galibert, F., Sigaux, F., 1990. Use of oligonucleotide probes directed against T cell antigen receptor gamma delta variable-Ždiversity.-joining junctional sequences as a general method for detecting minimal residual disease in acute lymphoblastic leukemias. J. Clin. Invest. 86, 2125. Miller, S.A., Dykes, D.D., Polesky, H.F., 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16, 1215. Miller, D.R., Coccia, P.F., Bleyer, W.A., Lukens, J.N., Siegel, S.E., Sather, H.N., Hammond, G.D., 1989. Early response to induction therapy as a predictor of disease-free survival and late recurrence of childhood acute lymphoblastic leukemia: a report from the Childrens Cancer Study Group. J. Clin. Oncol. 7, 1807. Neale, G.A., Menarguez, J., Kitchingman, G.R., Fitzgerald, T.J., Koehler, M., Mirro, J. Jr., Goorha, R.M., 1991. Detection of minimal residual disease in T-cell acute lymphoblastic leukemia using polymerase chain reaction predicts impending relapse. Blood 78, 739. O’Reilly, J., Meyer, B., Baker, D., Herrmann, R., Cannell, P.,
118
C. NyÕold et al.r Journal of Immunological Methods 233 (2000) 107–118
Davies, J., 1995. Correlation of bone marrow minimal residual disease and apparent isolated extramedullary relapse in childhood acute lymphoblastic leukaemia. Leukemia 9, 624. Ouspenskaia, M.V., Johnston, D.A., Roberts, W.M., Estrov, Z., Zipf, T.F., 1995. Accurate quantitation of residual B-precursor acute lymphoblastic leukemia by limiting dilution and a PCRbased detection system: a description of the method and the principles involved. Leukemia 9, 321. Pelicci, P.G., Knowles, D.M. II, Dalla Favera, R., 1985. Lymphoid tumors displaying rearrangements of both immunoglobulin and T cell receptor genes. J. Exp. Med. 162, 1015. Pongers-Willemse, M.J., Verhagen, O.J.H.M., Tibbe, G.J.M., Wijkhuijs, A.J.M., van de Haas, V., Roovers, E., van der Schoot, C.E., van Dongen, J.J.M., 1998. Real-time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia using junctional region specific TaqMan probes. Leukemia 12, 2006. Potter, M.N., 1992. The detection of minimal residual disease in acute lymphoblastic leukaemia. Blood Rev. 6, 68. Ravetch, J.V., Siebenlist, U., Korsmeyer, S., Waldmann, T., Leder, P., 1981. Structure of the human immunoglobulin m locus: characterization of embryonic and rearranged J and D genes. Cell 27, 583. Roberts, W.M., Estrov, Z., Ouspenskaia, M.V., Johnston, D.A., McClain, K.L., Zipf, T.F., 1997. Measurement of residual leukemia during remission in childhood acute lymphoblastic leukemia. N. Engl. J. Med. 336, 317. Schmiegelow, K., Nyvold, C., Kaspers, G.J.L., Seyfarth, J., Pieters, R., Knabe, N., Madsen, H.O., Ryder, L.P., Jonsson, O.G., Wesenberg, F., 1998a. Day 29 residual disease in acute lymphoblastic leukemia reflects prednisone resistance, clinical risk factors Žage, WBC, phenotype. and relapse risk. NOPHO MRD-95 study. Med. Pediatr. Oncol. 31, 282, Abstract.
Schmiegelow, K., Nyvold, C., Seyfarth, J., Knabe, N., Madsen, H.O., Ryder, L.P., Jonsson, O.G., Soderhall, ¨ ¨ S., Wesenberg, F., 1998b. Day 29 residual disease in childhood ALL reflects clinical risk factors and relapse risk. NOPHO mrd study. Blood 92, 80a, Abstract. Seriu, T., Hansen Hagge, T.E., Erz, D.H., Bartram, C.R., 1995a. Improved detection of minimal residual leukemia through modifications of polymerase chain reaction analyses based on clonospecific T cell receptor junctions. Leukemia 9, 316. Seriu, T., Yokota, S., Nakao, M., Misawa, S., Takaue, Y., Koizumi, S., Kawai, S., Fujimoto, T., 1995b. Prospective monitoring of minimal residual disease during the course of chemotherapy in patients with acute lymphoblastic leukemia, and detection of contaminating tumor cells in peripheral blood stem cells for autotransplantation. Leukemia 9, 615. Sykes, P.J., Neoh, S.H., Brisco, M.J., Hughes, E., Condon, J., Morley, A.A., 1992. Quantitation of targets for PCR by use of limiting dilution. Biotechniques 13, 444. Waldmann, T.A., Davis, M.M., Bongiovanni, K.F., Korsmeyer, S.J., 1985. Rearrangements of genes for the antigen receptor on T cells as markers of lineage and clonality in human lymphoid neoplasms. N. Engl. J. Med. 313, 776. Wasserman, R., Galili, N., Ito, Y., Silber, J.H., Reichard, B.A., Shane, S., Womer, R.B., Lange, B., Rovera, G., 1992. Residual disease at the end of induction therapy as a predictor of relapse during therapy in childhood B-lineage acute lymphoblastic leukemia. J. Clin. Oncol. 10, 1879. Yamada, M., Hudson, S., Tournay, O., Bittenbender, S., Shane, S.S., Lange, B., Tsujimoto, Y., Caton, A.J., Rovera, G., 1989. Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-determining region ŽCDR-III.-specific probes. Proc. Natl. Acad. Sci. U.S.A. 86, 5123.
