Compartmentalization of NO signaling cascade in skeletal muscles

BBRC Biochemical and Biophysical Research Communications 330 (2005) 615–621 www.elsevier.com/locate/ybbrc

Compartmentalization of NO signaling cascade in skeletal muscles Igor B. Buchwalow a,*, Evgeny A. Minin a, Vera E. Samoilova a, Werner Boecker a, Maren Wellner b, Wilhelm Schmitz c, Joachim Neumann d, Karla Punkt e a Gerhard Domagk Institute of Pathology, University of Muenster, Muenster, Germany Franz Volhard Clinic, Medical Faculty of the Charite´, Humboldt University of Berlin, Berlin, Germany c Institute for Pharmacology and Toxicology, University of Muenster, Muenster, Germany Institute for Pharmacology and Toxicology, Martin-Luther University Halle-Wittenberg, Halle/Saale, Germany e Institute of Anatomy, University of Leipzig, Leipzig, Germany b

d

Received 21 February 2005 Available online 18 March 2005

Abstract Skeletal muscle functions regulated by NO are now firmly established. However, the literature on the compartmentalization of NO signaling in myocytes is highly controversial. To address this issue, we examined localization of enzymes engaged in L-arginineNO-cGMP signaling in the rat quadriceps muscle. Employing immunocytochemical labeling complemented with tyramide signal amplification and electron microscopy, we found NO synthase expressed not only in the sarcolemma, but also along contractile fibers, in the sarcoplasmic reticulum and mitochondria. The expression pattern of NO synthase in myocytes showed striking parallels with the enzymes engaged in L-arginine-NO-cGMP signaling (arginase, phosphodiesterase, and soluble guanylyl cyclase). Our findings are indicative of an autocrine fashion of NO signaling in skeletal muscles at both cellular and subcellular levels, and challenge the notion that the NO generation is restricted to the sarcolemma. Ó 2005 Elsevier Inc. All rights reserved. Keywords: Nitric oxide synthase; L-Arginine-NO-cGMP signaling; Skeletal muscle; Sarcolemma; Sarcoplasmic reticulum; Mitochondria

Muscle-derived NO mediates fundamental physiological actions on skeletal muscle. NO is involved in the regulation of contractile force [1,2] either directly by gating the sarcoplasmic reticulum calcium release channels [3] or indirectly by modulating mitochondrial oxidative phosphorylation [2] and increasing glucose uptake into muscle cells [4]. NO is also involved in muscle repair [5], helps to tolerate heavy exercise, and its abnormal deficiency may mediate pathophysiological aspects of Duchenne and Becker muscular dystrophy [6]. NO originates via the oxidative L-arginine pathway catalyzed by a NO-synthase (NOS) family constituted by three distinct NOS isoforms (EC. 1.14.13.39) representing the products of three distinct genes [7]. Neuronal *

Corresponding author. Fax: +49 251 83 55460. E-mail address: [email protected] (I.B. Buchwalow).

0006-291X/$ - see front matter Ó 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.02.182

and endothelial NOS (also designated NOS1 and NOS3) were identified in and cloned from neuronal and endothelial cells, respectively, whereas inducible NOS was isolated originally from activated macrophages and was therefore called macrophage NOS (also designated NOS2). However, with the advent of more powerful immunohistochemical techniques increasing the antigen detectability, it turns out, that, in reality, NOS1–3 are not unique for specific cell types [8]. With the appreciation that each of the NOSs in fact has a wide tissue distribution, the numerical designation has come into vogue; the conventional classification of NOS isoforms into neuronal, endothelial, and inducible NOS reflects only characteristics of the cells, in which the enzymes were first described and may cause confusion. In view of the potential pathological role of NO, a better understanding of the NO regulatory networks in

616

I.B. Buchwalow et al. / Biochemical and Biophysical Research Communications 330 (2005) 615–621

skeletal muscles may contribute to the development of novel drug and gene therapies of muscular deceases [6,9]. However, reports referring to the location of NO generation in skeletal myocytes contain rather confused matters. Accumulated evidence for the coexistence of NOS isoforms in inner sarcoplasmic compartments, such as mitochondria, sarcoplasmic reticulum, caveolae as well as in the cytosol of myocytes [2–4,8,10–14], is opposed by reports on an exclusive sarcolemmal localization of NOS [9,15–20]. To address these controversies, we investigated the NOS localization in the rat quadriceps muscle employing immunocytochemical labeling with tyramide signal amplification complemented with immunogold labeling at the ultrastructural level as in our earlier studies demonstrating NOS in the myocardium and in smooth muscles [8,10,11].

Materials and methods Tissue probes. Procedures involving animals were approved by the Institutional Animal Care and Use Committee of the University of Muenster. Probes of the rat quadriceps muscle were obtained from male Wistar rats (300–350 g). Tissue probes were fixed in buffered 4% formaldehyde and routinely embedded in paraffin. For RNA-isolation and TaqMan analysis, tissue samples were snap-frozen in liquid nitrogen. Antibodies and immunohistochemical techniques. Four micrometer sections of the paraffin blocks were dewaxed in xylene, rehydrated in graded alcohols, and transferred into phosphate-buffered saline (PBS). PBS was used for all washings and dilutions. After antigen retrieval (Reveal, Biocarta, Hamburg, Germany) for 5 min in a domestic pressure cooker and blocking non-specific binding sites with BSA-c basic blocking solution (1:10 in PBS, Aurion, Wageningen, The Netherlands) as described earlier [10], sections were immunoreacted with primary antibodies overnight at 4 °C. Characterization of rabbit primary polyclonal antibodies recognizing NOS1, NOS2, and NOS3 (Transduction Laboratories, Lexington, KY, USA, and Santa Cruz Biotechnology, Santa Cruz, California, USA) including Western blotting procedure was described elsewhere [8,10,11,21,22]. Primary anti-NOS1–3 antibodies were diluted to a final concentration of 1.0 lg ml 1. Rabbit antiserum raised against sGC was from Calbiochem–Novabiochem GmbH, Bad Soden, Germany, and used at a dilution of 1:100. Rabbit polyclonal antibody to arginase was from Polysciences, Warrington, USA, and applied at a dilution of 1:1000. After immunoreacting with primary antibodies and following washing

in PBS, the sections were treated for 10 min with methanol containing 0.6% H2O2 to quench endogenous peroxidase. For fluorescent visualization of bound primary rabbit antibodies, sections were further treated for 1 h at room temperature with DAKO anti-rabbit EnVision-HRP (Dako, Hamburg, Germany). The HRP label was amplified with FITC-conjugated tyramine. FITC-tyramine conjugate was synthesized in our laboratory from tyramine-HCl (Sigma, Taufkirchen, Germany) and FITC-succinimidyl ester (NHSFITC, Pierce, Rockford, IL 61105, USA) in DMSO following the guidelines recommended by the manufacturer. Incubation with FITCtyramine conjugate was carried out at a dilution of 1:300 in PBS in the presence of 0.02% H2O2 for 10 min. Finally, samples were counterstained for 15 s with DAPI (5 lg ml 1 PBS; Sigma, Germany) and mounted with Vectashield (Vector Laboratories, Burlingame, CA, USA). For simultaneous demonstration of NOS1 and arginase, tissue sections were subjected to antigen retrieval as described above, blocked with normal donkey serum (1:20, Santa Cruz), and immunoreacted with a mixture of rabbit anti-arginase antibody and sheep anti-bNOS antibody (1:100, Abcam, Cambridge, UK) overnight at 4 °C. Bound primary sheep antibodies were visualized via donkey-anti-sheep biotinylated antibodies (1:500, Dianova, Hamburg, Germany) with Streptavidin-Alexa 488 (1:200, Molecular Probes, Leiden, The Netherlands). Bound primary rabbit antibodies were visualized with goat-anti-rabbit antibodies conjugated with Cy3 (1:200, Dianova, Hamburg, Germany). The same strategy was used for simultaneous demonstration of bNOS1 with sGC and PDE. The exclusion of either the primary or the secondary antibody from the immunohistochemical reaction, substitution of primary antibodies with the corresponding IgG at the same final concentration, or preabsorption of primary antibodies with corresponding control peptides resulted in lack of immunostaining. Simultaneous or sequential application of immunosera in the case of triple immunolabeling resulted in equally powerful detection of every antigen. The TSA step alone did not contribute to any specific immunostaining that might have influenced the analysis. Visualization and image processing. Immunostained sections were examined on a motorized Zeiss Axiophot2 microscope equipped with appropriate filters. Separate images for DAPI staining, fluorophor (FITC, Cy3 or Alexa 488) immunolabeling, and for autofluorescence of myocytes were captured digitally into color-separated components using an AxioCam digital microscope camera and AxioVision multichannel image processing (Carl Zeiss Vision GmbH, Germany). Separate color images (blue for DAPI, red for Cy3 or for autofluorescence, and green for FITC or Alexa 488) were merged, and the co-expression sites appeared in a pseudo-orange color. Some images were obtained using the deconvolution module integrated in the AxioVision software. Resulting composite images were imported as BMP files into PhotoImpact 3.0 (Ulead Systems, Torrance, CA, USA) for analysis on Power PC followed with printing on a color printer Canon PIXMA

Table 1 Real-time (TaqMan) PCR primers and probes for the amplification of NOS1–3 mRNA Primers to

Oligonucleotide primer sequences

18S-forward 18S-reverse 18S

ACATCCAAGGAAGGCAGCAG TTTTCGTCACTACCTCCCCG FAM-CGCGCAAATTACCCACTCCCGAC-TAMRA

Rat NOS1 989 forward Rat NOS1 1050 reverse

TTTGCATGGGCTCGATCAT TGTGCGGACATCTTCTGGC

Rat NOS2 2977 forward Rat NOS2 3040 reverse

CGGCTCCATGACTCTCAGC TGCACCCAAACACCAAGGT

Rat NOS3 3411 forward Rat NOS3 3478 reverse

GCTGGATGAAGCCGGTGA CGAAAATGTCCTCGTGGTAGC

I.B. Buchwalow et al. / Biochemical and Biophysical Research Communications 330 (2005) 615–621

Fig. 1. Gene expression levels of NOS1, NOS2, and NOS3 assayed by real-time RT-PCR (for details, see Materials and methods). iP5000. Images shown are representative of at least five independent experiments which gave similar results. Immunogold labeling of ultrathin EPON sections. Fractions of dissected muscles (1 mm) were fixed with a mixture of 4% formaldehyde and 0.25% glutaraldehyde in PBS, pH 7.4, for 2 h at room temperature. After washing in PBS, specimens were post-fixed in 1% OsO4,

617

routinely dehydrated, embedded in EPON, and cut at 80 nm with a Reichert-Jung FC 4 E with a diamond knife. Sections were picked up on nickel grids, subjected to etching with sodium ethoxide with subsequent antigen retrieval in 10 mmol L 1 citric acid, pH 6.0, in a pressure cooker, and immunolabeled. Immunocytochemical labeling steps were blocking non-specific binding sites with blocking solution for goat gold conjugates (Aurion, Wageningen, The Netherlands) for 30 min, incubation with rabbit polyclonal AB (2.5 lg ml 1 PBS) at 4 °C overnight, and incubation with anti-rabbit AB coupled with 12 nm immunogold (Dianova) for 1 h. After the labeling procedure, sections were washed intensively with distilled water. The subsequent staining procedure included uranyl acetate and lead citrate. After thorough washing in distilled water, the grids were air-dried and finally examined under a Philips 410 electron microscope. RNA-isolation and TaqMan analysis. Total RNA from the muscle samples was isolated using Qiashredder and RNeasy spin columns including chromosomal DNase digestion (Qiagen, Hilden, FRG). RNA was reverse transcribed into cDNA using random primers. Gene expression levels were measured by real-time RT-PCR. TaqMan analysis was carried out according to the manufacturerÕs instructions using an Applied Biosystems 7700 Sequence detector (Applied Biosystems, Darmstadt, FRG). Each sample was measured in triplicate

Fig. 2. Immunofluorescent detection of NOS3 (A,B) and NOS2 (C,D) in the rat quadriceps muscle. These figures are composite images resulting from merging three color components—blue for nuclear DAPI staining, green for FITC-tyramide immunostaining, and red for myocytes eliciting autofluorescence under an exposure with a filter exciting the fluorescence in a red spectrum. (A) In transversely sectioned myocytes, green fluorescent FITC-tyramide marks NOS3 in a mosaic pattern. (B) In a longitudinal section, NOS3 targets to the sarcolemma and subsarcolemmal zones with a pronounced cross-striation immunostaining pattern in the sarcoplasm. (C,D) Depending on the level of optical sections taken from a deconvolution series under a higher magnification, NOS2 can be visualized within the same myocytes either in the sarcoplasm with a cross-striation immunostaining pattern and in subsarcolemmal zones (C) or preferentially in the sarcolemma (D). Fifty micrometer scale bar for (A) and (B). Twenty micrometer scale bar for (C) and (D).

618

I.B. Buchwalow et al. / Biochemical and Biophysical Research Communications 330 (2005) 615–621

and expression level was normalized to 18S expression using the standard curve method. For NOS1, NOS2, and NOS3, quantitative RT-PCR amplification was carried out in 25 ll SybrGreen PCR Master Mix (Applied Biosystems, Darmstadt, Germany) containing 300 nmol L 1 primer and 1 ll of the reverse transcription reaction. The used TaqMan primer sets are presented in Table 1.

Results and discussion TaqMan analysis of the rat quadriceps muscle probes used in this study (Fig. 1) revealed the expression of mRNA of all three NOS isoforms including NOS2 which is in accord with the earlier reported expression of this isoform in skeletal muscles both at the mRNA and protein levels [4]. Western blotting of anti-NOS antibodies from Transduction Laboratories (Lexington, KY, USA) and Santa Cruz Biotechnology (Santa Cruz, California, USA) has been tested by us earlier for the human and rat myocardium [8,14], smooth muscles [10,11], and skeletal muscles [21,22]. No cross-reactivity within NOS isoforms has been detected for these antibodies. Employing the same antibodies in this study, we have found all three NOS isoforms expressed in the rat quadriceps muscle exhibiting a pronounced mosaic pattern (Fig. 2) with a more intensive immunostaining of myofibers identified earlier as fast twitch-oxidative glycolytic fibers (FOG) [22,23]. In longitudinal sections, all three NOS isoforms were targeted to the sarcolemma and subsarcolemmal zones with a pronounced cross-striation immunostaining pattern in the sarcoplasm as shown in Fig. 2B for NOS3 and in Figs. 2C and D for NOS2. Within the sarcoplasm, the immunostaining for NOS3 and NOS2 was stronger than for NOS1, whereas the sarcolemma was more intensively immunostained with anti-NOS1 antibodies. Subsarcolemmal NOS immunostaining may be accounted for by the presence of mitochondria (Figs. 3A and C) and caveolae [12] in these zones. All three NOS isoforms were found in the rat quadriceps muscle not only in myocytes but also in capillaries and in arterioles (not shown). In view of our previous reports that the constitutive local NOS expression in the vascular smooth muscle may modulate vascular functions in an autocrine fashion [10,11], it is not likely that the myocyte-derived NO regulates blood flow to skeletal muscle in a paracrine mode. In accord with our earlier reports about NOS1–3 expression in the vasculature [10,11], the present findings lend additional support to the notion that NOS1–3 are not unique for specific cell types. Moreover, evidence generated in recent years indicates that all three NOS isoforms are subjected to expressional regulation [1,4,12–14] and that the so-called ‘‘inducible’’ NOS (NOS2) is also constitutively expressed in various tissues including myocardial, skeletal, and smooth muscles [4,8,10–12,22,23]. In view of these reports, the classification of NOSs as ‘‘constitutive’’ or ‘‘inducible’’ turns out to be unreliable because

Fig. 3. Immunogold localization of NOS in myocytes. (A) Immunogold labeling of NOS3 in subsarcolemmal mitochondria. (B) Inside of the sarcoplasm, NOS3 is localized along the contractile fibers, in the sarcoplasmic reticulum, and in mitochondria. (C) Immunogold labeling of NOS2 in subsarcolemmal mitochondria and in the sarcolemma of two adjacent myocytes. (D) Similar to NOS, arginase is localized inside of the sarcoplasm along the contractile fibers, in the sarcoplasmic reticulum, and in mitochondria. EPON embedding, etching with sodium ethoxide, antigen retrieval in citrate buffer, pH 6.0. Twelve nanometer immunogold. 0.20 lm scale bar for entire layout.

each of the isoforms may be regulated dynamically; inducibility is a function of the stimulus rather than the gene product [1]. We next examined the compartmentalization of NOS1–3 in the rat quadriceps muscle employing immunogold labeling at the ultrastructural level and found all three NOS isoforms co-expressed in myocytes in the sarcoplasmic reticulum and mitochondria, along contractile fibers, and in the sarcolemma (Figs. 3A–C). Like at the immunofluorescent level, immunogold labeling of NOS1 (not shown) within the sarcoplasm was markedly less intensive than those of NOS2 and NOS3. Subsarcolemmally clustered mitochondria (Figs. 3A and C) were stronger immunolabeled than markedly smaller mitochondria found between contractile fibers (Fig. 3B). NOS targeting to mitochondria and contractile fibers in myocytes suggests a modulatory role for NO in oxidative phosphorylation and, in turn, skeletal muscle contractility, like in the cardiac [8] and smooth muscles [10,11]. Our findings of NOS expression in the sarcoplasmic reticulum may be reconciled with reports about involvement of NO in the regulation of Ca2+ release and reuptake resulting in potentiation of the force-frequency response [24].

I.B. Buchwalow et al. / Biochemical and Biophysical Research Communications 330 (2005) 615–621

619

Fig. 4. Co-localization of NOS1 with sGC and arginase in the rat quadriceps muscle. (A–C) Co-localization of NOS1 with sGC. (D–F) Colocalization of NOS1 with arginase. (A,D) Composite images resulting from merging three color components—blue for nuclear DAPI staining, green for Alexa Fluor 488 immunostaining of NOS1 (B,E), and red for sGC (C) and arginase (F). Twenty micrometer scale bar for entire layout.

Mitochondrial localization of NOS has earlier been reported for various tissues including the skeletal, myocardial, and smooth muscles [2,8,11,25]. Ghafourifar and Richter [26] even claimed the existence of a special mitochondrial NOS (mtNOS) later identified as the a isoform of neuronal or NOS1 [27]. The existence of mtNOS has started to become widely accepted. Mitochondrially located NOS may be regarded as a ubiquitous regulator of mitochondrial oxidative phosphorylation in mammalian cells. Thereby, NO binds in competition with oxygen to mitochondrial cytochrome oxidase, the terminal enzyme of the respiratory chain, and subsequently inhibits the electron flow [28]. Finally, effectors or modulators of cytochrome oxidase (the irreversible step in oxidative phosphorylation) had been proposed during the last 40 years. Nitric oxide is the first

molecule that fulfills this role. However, for NO to fulfill this function it must meet some criteria: it should be present at the site of cytochrome oxidase and its concentration should be sufficient to compete with the concentration of O2 in that environment [29]. Indeed, our findings demonstrated that NO synthase is expressed in mitochondria at a fair measure and near the target site—namely in sites prescribed for the cytochrome oxidase localization [30]. Our data emphasize an interesting aspect that has received little or no attention—the role of NO in mitochondria-mediated apoptosis [29] possibly underlying the pathophysiology of Duchenne and Becker muscular dystrophy. Well-documented evidence for the NOS expression in mitochondria as well as in the sarcoplasmic reticulum [24] and our present findings are opposed by reports

620

I.B. Buchwalow et al. / Biochemical and Biophysical Research Communications 330 (2005) 615–621

about an exclusive sarcolemmal localization of NOS [15,17–20]. The reasons for the conflicting results might have been due to the use of an unusual immunocytochemical procedure, whereby muscle cryosections immunoreacted with primary anti-NOS antibodies for 18 h at room temperature [17,19], and the fluorophorimmunolabeled preparations were mounted without any antifading agent in Aquatex (Merck, Darmstadt, Germany) [19] or in glycerol/PBS mixture [17]. Attempts to complement the exclusive sarcolemmal localization of NOS with a modified NADPH-diaphorase (NADPH-d) enzymocytochemical reaction [15,18] may only lead to further confusion because the presence of NADPH diaphorase staining does not reliably or specifically indicate the presence of one or more NOS isoforms. Indeed, the existence of different types of NADPH-d was established, which are associated or not associated with nitric oxide synthase(s) [31,32]. In view that ortho- or pathophysiological effect of NO in skeletal muscle is regulated by a delicate balance between NOS, arginase, soluble guanylyl cyclase (sGC), and phosphodiesterase (PDE), we next examined the colocalization of NOS1–3 with these enzymes engaged in L-arginine-NO-cGMP signaling. As an example, Fig. 4 shows co-expression of NOS1 with sGC (Figs. 4A–C) and with arginase (Figs. 4D–F). The same could also be seen employing double immunostaining for NOS1 and PDE (not shown). With the use of immunogold labeling at the ultrastructural level, arginase, sGC, and PDE were localized also in the same subcellular compartments as NOS (Fig. 3D). The co-expression of enzymes engaged in L-arginine-NO-cGMP signaling (NOS, arginase, PDE, and sGC) in myocytes is indicative of an autocrine fashion of NO signaling in the skeletal muscle like in the vascular smooth muscle cells as shown by us elsewhere [10,11]. Moreover, immunogold labeling at the ultrastructural level gives evidence for an autocrine fashion of NO signaling in myocytes also at the level of individual subcellular compartments. To conclude, our findings challenge the view that the NO generation in skeletal muscles is restricted to the sarcolemma, and give evidence for the co-existence of all three NOS isoforms, not only in the sarcolemma, but also in the intracellular compartments such as mitochondria, sarcoplasmic reticulum, and along contractile fibers. Localization of NOS both in the mitochondria and along contractile fibers accentuates the role of NO in the respiratory and contractile functions of the skeletal muscle. Localization of NOS in mitochondria emphasizes an interesting aspect that has received little or no attention—the role of NO in mitochondria-mediated apoptosis possibly associated with muscular dystrophy. Finally, the co-expression of NOS, arginase, PDE, and sGC in myocytes is indicative of an autocrine fashion of NO signaling in the skeletal muscle at both cellular and subcellular levels.

Acknowledgments We thank Jana Czychi for technical assistance and other colleagues from the immunohistology laboratory for sharing probes and reagents. This study was supported by grants from IZKF, University of Muenster, and from Deutsche Krebshilfe.

References [1] U. Forstermann, J.P. Boissel, H. Kleinert, Expressional control of the ÔconstitutiveÕ isoforms of nitric oxide synthase (NOS I and NOS III), FASEB J. 12 (1998) 773–790. [2] L. Kobzik, B. Stringer, J.L. Balligand, M.B. Reid, J.S. Stamler, Endothelial type nitric oxide synthase in skeletal muscle fibers: mitochondrial relationships, Biochem. Biophys. Res. Commun. 211 (1995) 375–381. [3] K.Y. Xu, D.L. Huso, T.M. Dawson, D.S. Bredt, L.C. Becker, Nitric oxide synthase in cardiac sarcoplasmic reticulum, Proc. Natl. Acad. Sci. USA 96 (1999) 657–662. [4] I. Gath, E.I. Closs, U. Godtel-Armbrust, S. Schmitt, M. Nakane, I. Wessler, U. Forstermann, Inducible NO synthase II and neuronal NO synthase I are constitutively expressed in different structures of guinea pig skeletal muscle: implications for contractile function, FASEB J. 10 (1996) 1614–1620. [5] J.E. Anderson, A role for nitric oxide in muscle repair: nitric oxide-mediated activation of muscle satellite cells, Mol. Biol. Cell 11 (2000) 1859–1874. [6] J.S. Stamler, G. Meissner, Physiology of nitric oxide in skeletal muscle, Physiol. Rev. 81 (2001) 209–237. [7] S. Moncada, A. Higgs, R. Furchgott, International union of pharmacology nomenclature in nitric oxide research, Pharmacol. Rev. 49 (1997) 137–142. [8] I.B. Buchwalow, W. Schulze, P. Karczewski, M.M. Kostic, G. Wallukat, R. Morwinski, E.G. Krause, J. Muller, M. Paul, J. Slezak, F.C. Luft, H. Haller, Inducible nitric oxide synthase in the myocard, Mol. Cell. Biochem. 217 (2001) 73–82. [9] D.S. Bredt, NO skeletal muscle derived relaxing factor in Duchenne muscular dystrophy, Proc. Natl. Acad. Sci. USA 95 (1998) 14592–14593. [10] I.B. Buchwalow, T. Podzuweit, W. Bocker, V.E. Samoilova, S. Thomas, M. Wellnr, H.A. Baba, H. Robenek, J. Schnekenburger, M.M. Lerch, Vascular smooth muscle and nitric oxide synthase, FASEB J. 16 (2002) 500–508. [11] I.B. Buchwalow, T. Podzuweit, V.W. Samoilova, M. Wellner, H. Haller, S. Grote, S. Aleth, W. Boecker, W. Schmitz, J. Neumann, An in situ evidence for autocrine function of NO in the vasculature, Nitric Oxide 10 (2004) 203–212. [12] I. Gath, J. Ebert, U. Godtel-Armbrust, R. Ross, A.B. ReskeKunz, U. Forstermann, NO synthase II in mouse skeletal muscle is associated with caveolin 3, Biochem. J. 340 (1999) 723–728. [13] U.N. Riede, U. Forstermann, H. Drexler, B. FreudenbergPlessow, Inducible nitric oxide synthase in skeletal muscle of patients with chronic heart failure, J. Am. Coll. Cardiol. 32 (1998) 964–969. [14] J. Slezak, I.B. Buchwalow, W. Schulze, P. Karczewski, G. Wallukat, V.E. Samoilova, E.G. Krause, J. Neumann, H. Haller, Cellular control of nitric oxide synthase expression and activity in rat cardiomyocytes, Antioxid. Redox Signal. 6 (2004) 345– 352. [15] O. Baum, A. Miethke, A. Wockel, G. Willerding, G. Planitzer, The specificity of the histochemical NADPH diaphorase reaction for nitric oxide synthase-1 in skeletal muscles is increased in the presence of urea, Acta Histochem. 104 (2002) 3–14.

I.B. Buchwalow et al. / Biochemical and Biophysical Research Communications 330 (2005) 615–621 [16] D.S. Chao, J.R. Gorospe, J.E. Brenman, J.A. Rafael, M.F. Peters, S.C. Froehner, E.P. Hoffman, J.S. Chamberlain, D.S. Bredt, Selective loss of sarcolemmal nitric oxide synthase in Becker muscular dystrophy, J. Exp. Med. 184 (1996) 609–618. [17] A. Miethke, M. Feussner, G. Planitzer, H. Richter, M. Gutsmann, R. Gossrau, Localization of NOS-1 in the sarcolemma region of a subpopulation of atrial cardiomyocytes including myoendocrine cells and NOS-3 in vascular and endocardial endothelial cells of the rat heart, Acta Histochem. 105 (2003) 43–55. [18] G. Planitzer, O. Baum, R. Gossrau, Skeletal muscle fibres show NADPH diaphorase activity associated with mitochondria, the sarcoplasmic reticulum and the NOS-1-containing sarcolemma, Histochem. J. 32 (2000) 303–312. [19] G. Planitzer, A. Miethke, O. Baum, Nitric oxide synthase-1 is enriched in fast-twitch oxidative myofibers, Cell Tissue Res. 306 (2001) 325–333. [20] G. Planitzer, H. Richter, R. Gossrau, The nitric oxide synthase-1 and nitric oxide synthase-3/nitric oxide signalling systems in the heart of wild type mice and mouse mutants, Histochem. J. 34 (2002) 345–355. [21] K. Punkt, S. Zaitsev, J.K. Park, M. Wellner, I.B. Buchwalow, Nitric oxide synthase isoforms I, III and protein kinase-C theta in skeletal muscle fibres of normal and streptozotocin-induced diabetic rats with and without Ginkgo biloba extract treatment, Histochem. J. 33 (2001) 213–219. [22] K. Punkt, A. Naupert, M. Wellner, G. Asmussen, C. Schmidt, I.B. Buchwalow, Nitric oxide synthase II in rat skeletal muscles, Histochem. Cell Biol. 118 (2002) 371–379. [23] K. Punkt, S. Zaitsev, M. Wellner, T. Schreiter, G. Fitzl, I.B. Buchwalow, Myopathy-dependent changes in activity of ATPase,

[24]

[25]

[26] [27]

[28] [29]

[30] [31]

[32]

621

SDH and GPDH and NOS expression in the different fibre types of hamster muscles, Acta Histochem. 104 (2002) 15–22. S.A. Khan, M.W. Skaf, R.W. Harrison, K. Lee, K.M. Minhas, A. Kumar, M. Fradley, A.A. Shoukas, D.E. Berkowitz, J.M. Hare, Nitric oxide regulation of myocardial contractility and calcium cycling: independent impact of neuronal and endothelial nitric oxide synthases, Circ. Res. 92 (2003) 1322–1329. T.E. Bates, A. Loesch, G. Burnstock, J.B. Clark, Mitochondrial nitric oxide synthase: a ubiquitous regulator of oxidative phosphorylation?, Biochem. Biophys. Res. Commun. 218 (1996) 40–44. P. Ghafourifar, C. Richter, Nitric oxide synthase activity in mitochondria, FEBS Lett. 418 (1997) 291–296. V. Haynes, S. Elfering, N. Traaseth, C. Giulivi, Mitochondrial nitric-oxide synthase: enzyme expression, characterization, and regulation, J. Bioenerg. Biomembr. 36 (2004) 341–346. G.C. Brown, Nitric oxide and mitochondrial respiration, Biochim. Biophys. Acta 1411 (1999) 351–369. S. Moncada, J.D. Erusalimsky, Opinion—does nitric oxide modulate mitochondrial energy generation and apoptosis? Nat. Rev. Mol. Cell Biol. 3 (2002) 214–220. C. Giulivi, Characterization and function of mitochondrial nitric oxide synthase, Free Radic. Biol. Med. 34 (2003) 397–408. P.J. Norris, I.G. Charles, C.A. Scorer, P.C. Emson, Studies on the localization and expression of nitric-oxide synthase using histochemical techniques, Histochem. J. 27 (1995) 745–756. J. Worl, M. Wiesand, B. Mayer, K.R. Greskotter, W.L. Neuhuber, Neuronal and endothelial nitric-oxide synthase immunoreactivity and Nadph-Diaphorase staining in rat and human pancreas—influence of fixation, Histochemistry 102 (1994) 353– 364.