Comparison of gene transcription in cloned bovine embryos produced by different nuclear transfer techniques

MOLECULAR REPRODUCTION AND DEVELOPMENT 60:281±288 (2001)

Comparison of Gene Transcription in Cloned Bovine Embryos Produced by Different Nuclear Transfer Techniques R. DANIELS,* V.J. HALL, A.J. FRENCH, N.A. KORFIATIS, AND A.O. TROUNSON Centre For Early Human Development, Monash Institute of Reproduction and Development, Monash University, Wright Street, Melbourne, Victoria, Australia

ABSTRACT The efficiency of animal production using cloning technology is still relatively low and research to determine a more efficient nuclear transfer procedure is ongoing. One approach which may be informative in assessing the viability of nuclear transfer embryos is the analysis of embryonic gene expression. Using RT-PCR techniques we have previously detected the aberrant expression of FGF4, FGFr2 and IL6 in a significant proportion of bovine granulosa cell-derived nuclear transfer embryos, which correlated with a limited developmental potential in vivo. In order to analyse the effect of different donor cell nuclei on embryonic gene expression we have now analysed the expression of these genes in nuclear transfer embryos reconstructed with fetal epithelial cell nuclei. In addition, we have compared the expression of these genes in bovine nuclear transfer embryos produced by cell fusion or direct injection with variations in the timing of oocyte activation. In all nuclear transfer embryos analysed, FGFr2 and IL6 transcripts were detected at a similar rate to that in IVF embryos. However, the absence of FGF4 transcripts was again evident in a large proportion of nuclear transfer embryos and most significantly in those embryos whose development was activated almost immediately following the transfer of the donor nucleus. The results demonstrate the effects that different donor cell lines and different nuclear transfer procedures may have on the expression of developmentally important genes in nuclear transfer embryos. Mol. Reprod. Dev. 60:

281±288, 2001. ß 2001 Wiley-Liss, Inc.

Key Words: nuclear transfer; reprogramming; gene expression; implantation INTRODUCTION Although animals of a number of different species have been successfully cloned from somatic cell nuclei, the inef®ciency of generating cloned animals using nuclear transfer impedes its application to advance animal production systems (Wilmut et al., 1997; Cibelli et al., 1998; Kato et al., 1998; Wakayama et al., 1998). In order to increase the ef®ciency of animal cloning, researchers are now analysing aspects of the nuclear transfer techniques to ®nd potential areas of improve-

ß 2001 WILEY-LISS, INC.

ment. A number of parameters may be varied, including the cell type and passage number of the donor nucleus, the cell cycle stage of the donor nucleus and recipient cytoplast, the method of donor nucleus delivery to the enucleated oocyte, the timing of oocyte activation and, the methods used to culture the resulting embryos (Smith et al., 1996; Wilmut et al., 1997; Wakayama et al., 1998; Kato et al., 1999; Wells et al., 1999; Zakhartchenko et al., 1999a,b,c; Kues et al., 2000; Kubota et al., 2000; Ogura et al., 2000; Onishi et al., 2000). One of the main factors inhibiting the progress of such research is the need for reliable markers of developmental competence during the early stages of embryo development. The successful production of morphologically normal blastocyst stage embryos has not proved reliable in indicating whether a successful pregnancy will be established. A large proportion of embryos are either lost between the time of transfer and implantation, during pregnancy or at birth (Wilmut et al., 1997; Wakayama et al., 1998; Kato et al., 1999; Zakhartchenko et al., 1999a,b,c; Kues et al., 2000; Kubota et al., 2000; Ogura et al., 2000). In the case of domestic farm species such as the cow, pregnancy testing via ultrasound is usually carried out 1 month following embryo transfer. This represents a long developmental time period in which a wide range of defects may occur undetected. Experiments comparing different aspects of nuclear transfer procedures may thus prove uninformative unless large variations in pregnancy rates or live birth rates are evident. An alternative approach could be to assess embryo viability using molecular markers, in particular gene expression pro®les, prior to embryo transfer. We have recently demonstrated the aberrant expression of ®broblast growth factor 4 (FGF4), ®broblast growth factor receptor 2 (FGFr2) and interleukin-6 (IL6) in bovine nuclear transfer embryos produced Grant sponsor: Dairy Research and Development Coorporation; Grant sponsor: Genetics Australia Cooperative Ltd. *Correspondence to: R. Daniels, Centre For Early Human Development, Monash Institute of Reproduction and Development, Monash University, 27-31 Wright Street, Melbourne, Victoria 3800, Australia. E-mail: [email protected] Received 10 January 2001; Accepted 28 March 2001

282

R. DANIELS ET AL.

using granulosa cells as the source of donor nuclei (Daniels et al., 2000). Transcripts of FGF4 and FGFr2 were not detected in a signi®cant number of embryos and correlated with a lack of developmental competency in vivo. Mouse embryos homozygous for targeted disruptions of either the FGF4 or FGFr2 genes have been shown to die at the time of implantation (Feldman et al., 1995; Arman et al., 1998). The lack of expression of these developmentally important genes in a cohort of bovine embryos failing to develop in vivo, demonstrated the potential for gene expression analysis to provide markers with which to assess embryo viability. In the present study, in order to analyse the effect a different donor cell line may have on the expression of these developmentally important genes in nuclear transfer embryos, embryos were produced using a fetal epithelial cell line as the source of the donor nuclei. In addition, to determine whether different nuclear transfer techniques themselves may affect gene expression patterns in the resulting embryos, we have compared the expression of FGF4, FGFr2, and IL6 in nuclear transfer embryos produced by either nuclear injection or cell fusion techniques and with or without a delay prior to the activation of the reconstructed embryo. METHODS Collection of Bovine Oocytes Bovine ovaries were obtained from a local slaughterhouse, transported at 25±308C to the laboratory and washed in 308C PBS (Baxter Healthcare Pty Ltd, NSW, Australia). Ovarian antral follicles (2±8 mm) were aspirated using an 18-gauge needle and collected into HEPES buffered tissue culture Medium 199 (H-TCM199, Gibco BRL/Life Technologies, Melbourne, Australia) with heparin (30 IU/ml, Sigma Chemical Company, St. Louis, MO), 2% fetal calf serum (FCS, Gibco/Life Technologies), and amphotericin B (2.5 mg/ ml, Sigma). Cumulus oocyte complexes (COCs) showing an even cytoplasm, and surrounded by at least three layers of compact cumulus cells, were collected from the follicular ¯uid. COCs were incubated and matured in groups of 25 in a TCM199 medium supplemented with gentamycin sulphate (40 mg/ml, Sigma), L-glutamine (97 mg/ml, Sigma), hCG (0.15 IU/ml Chorulon, Intervet, NSW, Australia), PMSG (1 IU/ml Folligon, Intervet) and 15% FCS at 398C in 5% CO2 in air, until required. Preparation of Oocytes for Nuclear Transfer In order to remove the surrounding cumulus, matured oocytes at 18±21 hr post maturation (hpm) were vortexed in 80 ml maturation media and 20 ml hyaluronidase (0.1%, Sigma) for 3 min in Eppendorf tubes (Quantum Scienti®c, Paddington, Queensland, Australia). The oocytes were washed through handling media (H-TCM199 supplemented with 5% FCS [199HF]) and morphologically assessed for the presence

of the ®rst polar body (metaphase II) prior to nuclear transfer. After careful removal of any remaining cumulus cells, a number of single matured oocytes were added to 5 ml lysis buffer for the reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of gene transcription, as described later. Epithelial Cell Collection, Culture and Characterisation Epithelial cells were prepared from internal organs from approximately 50±60 day old bovine fetuses. Tissue sections were diced in PBS using sterile scalpels and tweezers prior to digestion in 0.25% trypsin at 378C for 20±30 min. DMEM culture media containing 10% FCS was then added to the sample to inactivate the trypsin and, the sample centrifuged for 5 min to pellet the cells. Following the removal of the supernatant, the cells were resuspended in DMEM with 10% FCS and cultured for up to three passages. Epithelial cells at 70% con¯uency were cultured for a further 5±7 days in serum depleted media (DMEM plus 0.5% FCS) prior to nuclear transfer. Chromosomal evaluation of the cell line was conducted using standard cytogenetic procedures (Rong-Hao et al., 1996). Chromosome spreads (n ˆ 30) revealed a normal bovine chromosome number. Immunostaining of the cell line with a monoclonal antibody for cytokeratin protein 8, anticytokeratin (CAM5.2, Beckton Dickinson, Sydney, NSW, Australia), con®rmed the cell line was epithelial with 90±95% of the cells stained positive. Nuclear Transfer by Direct Nucleus Microinjection Bovine oocytes were enucleated at 18±22 hpm in handling media containing cytochalasin B (0.25 ml/ml, Sigma) by gentle aspiration of the polar body and metaphase plate in a small amount of cytoplasm using a glass pipette (inner diameter: 10±15 mm). The cytoplasts were transferred into TCM199 with 10% FCS and incubated at 398C in 5% CO2 in air, until microinjection or cell fusion. After mechanical disruption of the cell membranes in 199HF using the injection pipette, epithelial cells were injected directly into the cytoplasts. The reconstructed embryos were transferred back into TCM199 ‡ 10% FCS until activation. Nuclear Transfer by Subzona Pellucida Injection and Cell Fusion Bovine oocytes were enucleated at 18±22 hpm in handling media, as described above. A donor cell was then injected into the oocyte's perivitelline space, directly following enucleation. The oocyte±cell complexes were cultured in maturation medium for approximately half an hour to one hour prior to cell fusion. Oocyte±cell complexes were transferred to mannitol fusion media (0.3 M Mannitol, 0.01% PVA, 50 mM MgSO4, 25 mM CaCl2, 0.5 mM HEPES, all Sigma) at room temperature, aligned and fused with two pulses of

GENE TRANSCRIPTION IN CLONED BOVINE EMBRYOS 160±190 kV/cm for 15±30 msec, 1 sec apart (Genetics Australia Fusion Machine, Bacchus Marsh, Victoria, Australia), using wire electrodes 0.5 mm apart (BTX, San Diego, CA). The oocyte±cell complexes are then placed into the maturation medium to allow cytoplasmic fusion to occur. Activation Arti®cial activation was induced either 0.5 or 4 hr after fusion or injection by exposing the oocytes to 5 mM calcium ionophore in H-TCM199 for 4 min, prior to culture in 2 mM 6-DMAP for 5 hr. In Vitro Culture of Nuclear Transfer Embryos Embryos were cultured in modi®ed synthetic oviductal ¯uid (SOF) culture medium (Gardner et al., 1994) supplemented with nonessential (10 ml/ml) and essential (30 ml/ml) amino acids (Sigma), 5% FCS, myoinositol (0.05 g/10 ml, Sigma) and sodium tri citrate (1mg/1ml, Selby Scienti®c, Clayton, Melbourne, Australia). Embryos were cultured in 4-well plates in gassed foil bags (Wests Packaging Services, Carrum Downs, Melbourne, Australia) containing 5% O2, 5% CO2 and 90% N2 and submerged in a submarineincubation-system (SIS, Vajta et al., 1997) at 398C. Embryos were removed at the blastocyst stage following approximately 168 hr in culture, for RT-PCR analysis. In Vitro Fertilisation (IVF) and Culture of Bovine Oocytes Bovine COC's matured for approximately 24 hr were fertilised in Fert-Talp medium supplemented with gentamycin sulphate (0.5 mg/ml, Sigma), heparin (30 mg/ml), hypotaurine (1.65 mg/ml, Sigma), epinephrine (0.27 mg/ml, Sigma) and penicillamine (4.5 mg/ml, Sigma). Frozen-thawed semen from an elite bull was prepared using a modi®ed Percoll (Sigma) separation protocol (Ord et al., 1990). COCs were co-cultured with sperm (2  106 motile sperm/ml) for 24 hr at 398C, in 5% CO2 in air. Following fertilisation, cumulus cells were removed from presumptive zygotes by vortexing for 1.5 min in a 15 ml centrifuge tube (Becton±Dickinson). Denuded embryos were washed in H-TCM199 with 5% FCS before being transferred into 4-well Nunc plates (Medos, Melbourne, Australia) containing SOF culture media, as previously described. Embryos were collected for RT-PCR analysis at the same time as indicated for the nuclear transfer (NT) embryos. Parthenogenetically Activated Oocytes Unfertilised oocytes were activated as described for nuclear transfer embryos by exposure to a 5 mM calcium ionophore for 4 min, prior to culture in 2 mM 6-DMAP for 5 hr. Parthenogenetic embryos were then cultured in SOF medium and were collected for RT-PCR analysis at the same time as indicated for the NT and IVF embryos.

283

Analysis of Embryo Total Cell Numbers Day 7 blastocysts were removed from culture and ®xed by resuspension in 70% ethanol (CSR, Yarraville, Victoria, Australia) for 1 min. Following ®xation, embryos were incubated for 2 min in 80 mg/ml propidium iodide (PI: Sigma) in PBS to stain the cell nuclei. Embryos were then mounted in glycerol (Sigma), transferred to glass slides and ®rmly compressed with a coverslip (22  40 mm size 11/2 Esco, Selby-Biolab Pty Ltd, Mulgrave North, Victoria). Staining was observed under a Leica DMR microscope (Leica, Microscopy Systems Ltd, Heerbrugg, Switzerland) equipped with epi¯uorescence, with excitation set at 340±380 nm and emission at 425 nm, with a long pass ®lter. RT-PCR The protocols used for sample preparation, reverse transcription (RT) and polymerase chain reaction (PCR) ampli®cation have been described previously. Brie¯y, single oocytes or embryos were added to 5 ml lysis buffer (0.8% Igepal, 5 mM DTT, 1U/ ml RNAsin), snap frozen in liquid nitrogen and stored at ÿ808C prior to use. When required, samples were heated to 808C for 5 min, transferred straight to ice and the RT premix added. Reverse transcription was carried out in a ®nal volume of 10 ml comprising of the cell lysate, 1  RT buffer, 100 U SuperScript Hÿ reverse transcriptase (gibco BRL), 1.5 mg random primers (Gibco BRL), 5 mM DTT and 1 U/ml RNAsin. Reactions were held at 378C for 1 hr. For epithelial cell samples, cells were scraped from the culture ¯ask and pelleted in an Eppendorf tube in STE buffer (0.1 M NaCl, 20 mM Tris pH 7.4, 10 mM EDTA pH 8.0). The supernatant was then removed, the cells resuspended in 40 ml lysis buffer, snap frozen in liquid nitrogen and stored at ÿ808C. On use, cell lysates were thawed and centrifuged at 12,000g for 10 min to pellet cell debris. The supernatant was then transferred to a fresh Eppendorf tube and mRNA was extracted using a Dynal Beads mRNA puri®cation kit (Dynal Pty Ltd., Australia), as directed. Reverse transcription was carried out in a 20 ml reaction mix with reagent concentrations as described for embryo analysis. Negative controls, omitting reverse transcriptase or added sample were always included. PCR ampli®cation was carried out on 2.5 ml of the RT product from embryos or 1 ml (approximately 20 ng RNA or 2000 cells equivalent) from epithelial cell cDNA products. PCR cycles were as follows: 948C  50 followed by 50 cycles for embryos or 30 for cell samples of 948C  10 ; 528C  10 ; 728C  20 . Ten ml of the PCR products were visualised under ultra violet light on 2% agarose gels containing 1 mg/ml ethidium bromide. Primer sequences for FGF4, IL6 and Poly(A) polymerase were as previously described (Daniels et al., 2000). The sequences for FGFr2 were (50 ±30 ) GGATGGAGTATTCCTACGAC and CATCCACTTGACCGGAAGTC.

284

R. DANIELS ET AL.

Fig. 1. Day 7 IVF (A) and NTC (B) embryos stained with propidium iodide and viewed under ¯uorescence (100).

Statistical Analysis The signi®cance of the difference in the number of embryos in which transcripts were detected in IVF and nuclear transfer derived embryos was determined using w2 contingency tables. The statistical difference between the cell numbers in IVF and nuclear transfer embryos was calculated using a t-test. RESULTS Blastocyst Development and Cell Number The in vitro culture of embryos may itself affect the transcription of some embryonic genes (Niemann and Wrenzycki, 2000), therefore, IVF embryos were used as a positive control to identify those changes in gene expression which were a result of the nuclear transfer procedures and not of the in vitro culture conditions used. In addition to the control IVF embryos, three types of nuclear transfer embryos were analysed; NTA embryos were produced by direct nuclear injection with only a short delay prior to activation of the reconstructed embryo, NTB embryos were produced by direct nuclear injection but with a 4 hr delay included prior to activation and, NTC embryos were produced by cell fusion procedures including a 4 hr delay prior to activation. See Materials and Methods for full details of nuclear transfer procedures. The blastocyst development rates (number of blastocysts/number of oocytes in culture) for NTA, NTB and NTC nuclear transfer embryos were 32 (32/99), 21 (26/121) and 25% (25/101), respectively. This is similar to the rate of IVF blastocyst development in our laboratory, 29% (3,046/10,351) during the previous 12 months. Total cell counts were carried out for 30 IVF embryos and 24 NTC embryos. The counts were signi®cantly (P < 0.0001) higher for the IVF blastocysts analysed (mean ˆ 129  37) than for the nuclear transfer embryos analysed (mean ˆ 67  34.85). The IVF group of embryos contained mainly expanded blastocysts (20/ 30), whereas, the NT group of embryos contained only

earlier blastocyst stages. Figure 1 shows an example of an IVF and a nuclear transfer blastocyst prepared for cell counting. Analysis of FGF4, FGFr2, IL6, and Poly(A) Polymerase Transcription in the Donor Epithelial Cell Line In order to assess the effects of nuclear reprogramming on the donor epithelial cell nuclei it was important to initially analyse the transcription of FGF4, FGFr2 and IL6 in cDNA derived from the epithelial cell line. Figure 2 shows the results obtained following the RT-PCR analysis of an epithelial cell cDNA sample. Transcripts of IL6 and Poly(A) polymerase were clearly detected, transcripts of FGFr2 were detected but only a faint PCR product was obtained indicating a low level of transcription and, no transcripts of FGF4 were detected. Analysis of FGF4, FGFr2, IL6, and Poly(A) Polymerase Transcription in Bovine IVF, Parthenogenetic and Nuclear Transfer Embryos Having established the pattern of expression of the three genes of interest in the donor cell line, their expression was analysed in individual blastocyst stage embryos derived from either IVF, parthenogenetic activation or one of the three nuclear transfer procedures, NTA, NTB or NTC. The embryos analysed were mostly scored as early blastocysts, however, a small number of expanding blastocysts were included in each group. The results are summarised in Table 1. Figure 3 shows an example of the results obtained following the analysis of an IVF embryo, a parthenogenetic embryo and a nuclear transfer NTA embryo. In this example, transcripts of FGFr2, IL6 and Poly(A) polymerase were detected in all three embryos shown; transcripts of FGF4 were only detected in the blastocysts derived from IVF procedures and parthenogenetic activation.

GENE TRANSCRIPTION IN CLONED BOVINE EMBRYOS

285

TABLE 1. A Summary of RT-PCR Results Following the Analysis of Bovine Blastocysts Derived From IVF, Parthenogenetic Activation, and Nuclear Transfer Techniques Gene FGF4 FGFr2 IL6 Poly (A) Polymerase

IVF

Parthenotes

NTA embryos

NTB embryos

NTC embryos

37/43a (86%) 34/40* (85%) 42/43 (98%) 43/43 (100%)

21/38a,b,c (55%) 32/35*(91%) 38/38 (100%) 38/38 (100%)

8/21a,b (38%) 18/18* (100%) 21/21 (100%) 21/21 (100%)

12/20a,b,c (60%) 20/20 (100%) 20/20 (100%) 20/20 (100%)

13/21a,b,c (62%) 19/21 (90%) 20/21 (100%) 21/21 (100%)

NTA embryos were produced by direct nuclear injection with only a short delay prior to activation of the reconstructed embryo, NTB embryos were produced by direct nuclear injection but with a 4 hr delay included prior to activation, and NTC embryos were produced by cell fusion procedures including a 4-hr delay prior to activation. Number of blastocysts with a positive signal/ number blastocysts analysed. Like sets of letters indicate statistical difference (a, 0.001 > P< 0.01; b, 0.1 > P < 0.5; c, no signi®cant difference). *In experiments involving the analysis of three of the embryos in each of these groups the FGFr2 PCR failed to amplify all samples and, hence, results were not counted.

Overall, transcripts of FGFr2, IL6 and Poly(A) polymerase were detected with a high frequency in all blastocysts produced by IVF procedures, parthenogenetic activation and all three nuclear transfer techniques, see Table 1. In the case of FGF4, transcripts were detected with the highest frequency in blastocysts produced using IVF procedures, 86% (37/43). In parthenogenetic, NTA, NTB and NTC blastocysts, FGF4 transcripts were detected with lower frequencies of 55 (21/38), 38 (8/21), 60 (12/20) and 62% (13/21), respectively. The frequency of detection of FGF4 transcripts was signi®cantly different between all groups of embryos analysed (0.001 > P < 0.01), but not between parthenogenetic, NTA, NTB, and NTC embryos

(0.1 > P < 0.5), nor between parthenogenetic, NTB, and NTC embryos (P > 0.5), as summarised in Table 1. DISCUSSION In an attempt to determine the underlying causes for the high rates of developmental failure seen in embryos produced by somatic cell nuclear transfer procedures, we have previously analysed the expression of a number of developmentally important genes in bovine nuclear transfer embryos reconstructed with granulosa cell nuclei (Daniels et al., 2000). In this previous study we found that FGF4 and FGFr2 were aberrantly expressed in a signi®cant number of nuclear transfer embryos, and that the onset of IL6 transcription

Fig. 2. Analysis of FGF4, FGFr2, IL6 and Poly (A) polymerase transcription in epithelial cell cDNA. Both positive (E‡) samples and negative control reactions (Eÿ) omitting the reverse transcriptase enzyme are shown. Lanes marked L show a 100 bp ladder. The sizes of the expected PCR products are shown in base pairs (bp).

286

R. DANIELS ET AL.

Fig. 3. An example of the results obtained following the analysis of FGF4, FGFr2, IL6, and Poly (A) polymerase transcripts in single bovine blastocyst stage embryos derived from (a) IVF procedures, (b) parthenogenetic activation and (c) NTA nuclear transfer. Each lane represents the analysis of one quarter of the cDNA derived from a single blastocyst stage embryo. Lanes marked L show a 100 bp ladder.

appeared to be delayed. The aberrant transcription of FGF4, FGFr2, and IL6 correlated with an inability of the group of embryos analysed to establish successful pregnancies following transfer to recipient cows. In mice, all three of these genes have been shown to have important functions at or around the time of embryo implantation (Feldman et al., 1995; Arman et al., 1998; Desai et al., 1999; Meisser et al., 1999). The previous study raised several questions regarding whether the cell type and origin of the donor cell nucleus and variations in the nuclear transfer techniques used may impact on the patterns of gene expression detected in the resulting embryos. In this present study, therefore, we have analysed the affect of a different donor cell line, a fetal epithelial cell line, on the expression of FGF4, FGFr2, and IL6 in the

resulting nuclear transfer embryos. In addition, we have compared the transcription of these genes in embryos produced by direct nucleus injection with or without a 4 hr delay prior to activation of the reconstructed embryo and, by cell fusion with a 4 hr delay prior to activation. In the parthenogenetic and nuclear transfer embryos analysed, regardless of the nuclear transfer technique used, FGFr2 and IL6 were detected with a high ef®ciency similar to that in IVF embryos. This is in contrast to our previous study on FGFr2 transcription in granulosa cell nuclear transfer embryos where transcripts were not detected in a signi®cant number of morula and blastocyst stage embryos. The onset of IL6 transcription also appeared to be delayed in granulosa cell-derived nuclear transfer embryos, although, transcripts were consistently detected at the blastocyst stage. In this study, embryos at earlier stages of development than the blastocyst were not analysed and therefore a similar delay in IL6 transcription would not have been detected. The difference in FGFr2 gene expression patterns detected in nuclear transfer embryos produced using either granulosa or epithelial cell nuclei may be a re¯ection of the status of the FGFr2 gene in the donor cell lines. No transcripts of FGFr2 were detected in granulosa cell cDNA (Daniels et al., 2000), whereas, FGFr2 transcripts were detected in the epithelial cells of the present study suggesting that when a gene is transcribed in the donor nucleus it may be easier to transcribe in the resulting embryo, and vice versa. This demonstrates the possible effect different donor cell types may have on the expression of developmentally important genes in nuclear transfer embryos, which in turn would affect embryo viability. Previous studies have shown that certain cell types are more suitable than others for use in nuclear transfer procedures (Wakayama et al., 1998; Ogura et al., 2000), and this may be re¯ected in the patterns of gene expression seen in the resulting embryos. Certain cell types or lines may be harder to reprogram, resulting in the abnormal expression of embryonic genes necessary for successful development. Identifying those genes whose expression is crucial to the early stages of development would provide a cohort of genetic markers with which to analyse nuclear transfer embryos in order to assess their developmental viability. Embryos produced using nuclei from different cell types or lines could then be analysed at the level of gene expression in order to determine which cell type or line produces nuclear transfer embryos with the highest potential to develop in vivo. In the present study, transcripts of FGF4 were detected with a high ef®ciency in IVF embryos, con®rming our previous results (Daniels et al., 2000). However, in both parthenogenetic embryos and those produced by nuclear transfer procedures, the proportion of embryos expressing FGF4 was reduced when compared to IVF embryos. FGF4 transcripts were not detected in the donor fetal epithelial cells; hence its

GENE TRANSCRIPTION IN CLONED BOVINE EMBRYOS transcription in the reconstructed embryos requires ef®cient reprogramming of the donor nucleus. The frequency of FGF4 transcript detection in the ®ve groups of embryos analysed was signi®cantly different (0.001 > P < 0.01). The cause of this signi®cant difference appears to be due to the particularly high and particularly low frequencies of FGF4 transcript detection in IVF and NTA embryos, respectively. The delay prior to activation in the NTB and NTC embryos improved the ef®ciency of nuclear reprogramming and resulted in an increased proportion of nuclear transfer embryos expressing FGF4. These results correlate with previous studies which have suggested that donor somatic cell nuclei are more ef®ciently reprogrammed when a delay is included prior to activation, resulting in improved developmental outcomes (Wakayama et al., 1998, 2000). Presumably, this is due to the increased exposure of the donor nucleus to the factors present in the cytoplasm of unfertilised oocytes, which are responsible for nuclear reprogramming. The abnormal expression of FGF4 in the nuclear transfer embryos could be attributed to a delay in their development. Embryos from all three nuclear transfer groups developed to the blastocyst stage at similar rates to IVF embryos. However, the total blastocyst cell numbers in the NTC embryos analysed were signi®cantly lower than in those derived from IVF procedures. Although this was largely attributable to the IVF group of embryos containing mainly expanded blastocysts, this indicates a delay in the timing of development of the nuclear transfer embryos when compared to that of IVF embryos. However, it is unlikely that this is the cause for the lack of FGF4 expression seen in a high proportion of the nuclear transfer blastocysts analysed here, since we have previously shown that the onset of FGF4 expression in bovine embryo development normally occurs earlier, at the morula stage (Daniels et al., 2000). Interestingly, FGF4 transcripts were not detected in a signi®cant number of parthenogenetic blastocysts. In the cow, as with other mammals, parthenogenetic embryos fail to produce viable pregnancies following transfer to recipients (Fukui et al., 1992). Hence, the lack of FGF4 transcription is again associated with a group of embryos which are not developmentally viable. The results presented in this paper demonstrate the potential effect different donor cell types and different nuclear transfer procedures can have on the expression of genes in nuclear transfer embryos and, therefore, on their developmental viability. Work is currently being carried out using differential gene expression studies to identify further genes which are aberrantly expressed in nuclear transfer embryos in comparison to in vitro and in vivo produced embryos. The identi®cation of a cohort of such genes will provide a useful tool to analyse the developmental potential of nuclear transfer embryos reconstructed using different donor cell types or different nuclear transfer procedures.

287

ACKNOWLEDGMENTS We thank Michaela Travers, Renee Travers, and Elspeth Mackay for the preparation of the oocytes used in this study. REFERENCES Arman E, Haffner-Krauz R, Chen Y, Heath JK, Lonai P. 1998. Targeted disruption of ®broblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad Sci 95:5082±5087. Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J, Blackwell C, Ponce de Leon FA, Robl JM. 1998. Cloned transgenic calves produced from nonquiescent fetal ®broblasts. Science 280:1256±1258. Daniels R, Hall V, Trounson AO. 2000. Analysis of gene transcription in bovine nuclear transfer embryos reconstructed with granulosa cell nuclei. Biol Reprod 63:1034±1040. Desai N, Scarrow M, Lawson J, Kinzer D, Goldfarb J. 1999. Evaluation of the effect of interleukin-6 and human extracellular matrix on embryonic development. Hum Reprod 14:1588±1592. Feldman B, Poueymirou W, Papaioannou VE, DeChiara TM, Goldfarb M. 1995. Requirement of FGF-4 for postimplantation mouse development. Science 267:246±249. Fukui Y, Sawai K, Furudate M, Sato N, Iwazumi Y, Ohsaki K. 1992. Parthenogenetic development of bovine oocytes treated with ethanol and cytochalasin B after in vitro maturation. Mol Reprod Dev 33:357±362. Gardner DK, Lane M, Spitzer A, Batt P. 1994. Enhanced rates of cleavage and development for sheep zygotes cultured to the blastocyst stage in the absence of serum and somatic cells: Amino acids, vitamins and culturing embryos in groups stimulate development. Biol Reprod 50:390±400. Kato Y, Tani T, Sotomaru Y, Kurokawa K, Kato J-Y, Doguchi H, Yasue H, Tsunoda Y. 1998. Eight calves cloned from somatic cells of a single adult. Science 282:2095±2098. Kato Y, Rideout WM, Hilton K, Barton S, Tsunoda Y, Surani A. 1999. Developmental potential of mouse primordial germ cells. Development 126:1823±1832. Kubota C, Yamakuchi H, Todoroki J, Mizoshita K, Tabara N, Barber M, Yang X. 2000. Six cloned calves produced from adult ®broblast cells after long term culture. Proc Nat Acad Sci USA 97:990± 995. Kues WA, Anger M, Carnwath JW, Paul D, Motlik J, Niemann H. 2000. Cell cycle synchronisation of porcine fetal ®broblasts: effect of serum deprivation and reversible cell cycle inhibitors. Biol Reprod 62:412±419. Meisser A, Cameo P, Islami D, Campana A, Bischof P. 1999. Effects of interleukin-6 (IL-6) on cytotrophoblastic cells. Mol Hum Reprod 5:1055±1058. Niemann H, Wrenzycki C. 2000. Alterations in the expression of developmentally important genes in preimplantation bovine embryos by in vitro culture conditions: implications for subsequent development. Theriogenology 53:21±34. Ogura A, Inoue K, Ogonuki N, Noguchi A, Takano K, Nagano R, Suzuki O, Lee J, Ishino F, Matsuda J. 2000. Production of male mice cloned from fresh, cultured and cryopreserved immature sertoli cells. Biol Reprod 62:1579±1584. Onishi A, Iwamoto M, Akita T, Mikawa S, Takeda K, Awata T, Hanada H, Perry ACF. 2000. Pig cloning by microinjection of fetal ®broblast nuclei. Science 289:1188±1190. Ord T, Patrizio P, Marello E, Balmaceda J, Asch R. 1990. Mini-Percoll: a new method of semen preparation for IVF in severe male factor infertility. Hum Reprod 5:987±989. Rong-Hao L, Luo S, Zhuang LZ. 1996. Establishment and characterization of a cytotrophoblast cell line from normal placenta of human origin. Hum Reprod 11:1328±1333. Smith SD, Soloy E, Kanka J, Holm P, Callesen H. 1996. In¯uence of recipient cytoplasm cell stage on transcription in bovine nucleus transfer embryos. Mol Reprod Dev 45:444±450. Vajta G, Holm P, Greve T, Callesen H. 1997. The submarine incubation system, a new tool for in vitro embryo culture. A technique report. Theriogenology 48:1379±1385.

288

R. DANIELS ET AL.

Wakayama T, Perry ACF, Zuccotti M, Johnson KR, Yanagamachi R. 1998. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 394:369±374. Wakayama T, Tateno H, Mombaerts P, Yanagamachi R. 2000. Nuclear transfer into mouse zygotes. Nat Genet 24:108±109. Wells DN, Misica PM, Tervit HR. 1999. Production of cloned calves following nuclear transfer with cultured adult mural granulosa cells. Biol Reprod 60:996±1005. Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KHS. 1997. Viable offspring derived from fetal and adult mammalian cells. Nature 385:810±813. Zakhartchenko V, Durcova-Hills G, Stojkovic M, Schernthaner W, Prelle K, Steinborn R, Muller M, Brem G, Wolf E. 1999a Effects

of serum starvation and re-cloning on the ef®ciency of nuclear transfer using bovine fetal ®broblasts. J Reprod Fert 115:325± 331. Zakhartchenko V, Durcova-Hills G, Schernthaner W, Stojkovic M, Reichenbach H-D, Mueller S, Steinborn R, Mueller M, Wenigerkind H, Prelle K, Wolf E, Brem G. 1999b Potential of fetal germ cells for nuclear transfer in cattle. Mol Reprod Dev 52:421± 426. Zakhartchenko V, Alberio R, Stojkovic M, Prelle K, Schernthaner W, Stojkovic P, Wenigerkind H, Wanke R, Duchler M, Steinborn R, Mueller M, Brem G, Wolf E. 1999c. Adult cloning in cattle: potential of nuclei from a permanent cell line and from primary cultures. Mol Reprod Dev 54:264±272.