Commonand Rare Genotypesof HumanApolipoprotein E Determinedby Specific Restriction Profilesof PolymeraseChainReaction-Amplified DNA

CUN.

CHEM. 40/1, 24-29 (1994) #{149} Molecular

Pathology

Common and Rare Genotypes of Human ApolipoproteinE Determined by Specific Restriction Profiles of Polymerase Chain Reaction-Amplified DNA Pascale Richard,’ Andr#{233} Cassaigne,’

Ginette Thomas,2 Maria Pascual de Zulueta,’ Gilbert B#{233}r#{233}ziat,2 and Albert Iron’

The three common isoforms of human apolipoprotein E (apo E) differ at positions 112 and 158 and are named E3, E4, and E2 according to phenotypingby isoelectric focusing (IEF). The potymerase chain reaction (PCR) method allows the detection of common and several rare allelicapo E variants not detected by IEF. We propose a genotyping procedurefor apo E that characterizesa given allele on the basis of amplification of specific sequences of the gene followed by the action of restrictionendonucleases. When the nucleotide change does not lead to a restriction site,

Jean-Luc

De Gennes,3

Michel Thomas,4

tamed from a precursor molecule after intracellular maturation and extracellular desialylation (7). In humans, the structural gene locus for ape E is polymorphic. This genetic variation seems to be a major determinant of plasma lipid concentrations and of the interindividual variations in susceptibffity to coronary artery disease (8). The common alleles encode for the three major plasma ape E isoforms: ape E4, ape E3, and ape E2 (9-11). These proteins differ by amino acid substitution at one or both of the 112 and 158 positions, the PCR-directed mutagenesis creates the discnminant site, latter being the principal residue of the binding domain and the differentiationof the three common alleles and five for the ape E receptor. The E3 polypeptide [Cys112/ rare variants is possible. We present here profiles of comArg155], the most common isoform, is the wild type. The mon alleles and of three rare alleles, Weisgraber [Cys112/ E4 isoform [Arg1j/Arg1] is often associated with inAsp1/Cys1], Chnstchurch [Cys112/Ser1/Arg1], and a creased concentrations of cholesterol and a higher risk new rare variant [Cys112/Leu142/Cys1]. of coronary disease (8, 12). The E2 isoform [Cys112/ Cys158] is associated with decreased concentrations of Indexing Terms: isoelectric focusing/gene polymorphisms/phenocholesterol (13). Of the patients presenting with type Ill typing hyperlipeproteinemia, 90% are homozygous for the E2 isoform (14). In addition to the common ape E isoforms, Apolipoprotein E (apo E) plays a major physiological several other rare variants have been identified (3, 15role in the metabolism of chylomicrons and very-low20), the majority being associated with severe type III density lipoprotein remnants, which are rapidly rehyperlipoproteinemias. moved from the circulation by a receptor-mediated enThe classification of the common isoforms of ape E is docytosis in the liver (1 )6 Apo E serves as a ligand for based on the global charge of the protein. The reference the low-density lipoprotein receptor uptake-also reis E3 (0 charge). E4 and E2 present one more (+1) and ferred to as apo BIE receptor (2)-and mediates the one less (-1) positive charge, respectively. Classically, binding of chylomicron remnants to a second type of ape E phenotyping is based on the charge differences receptor, possibly a hepatic receptor, called the chylomiand separation of common isoforms by isoelectric focuscron remnant receptor or apo E receptor (3, 4). The ing (IEF) (21), often with neuraminidase (9) or cysteintransport of cholesterol from peripheral tissues to the amine (11) treatment to prevent charge alterations secliver (reverse cholesterol transport) may be permitted ondary to the presence of variable amounts of sialic acid. via the binding of ape E-containing high-density lipoThe application of molecular biology techniques alprotein particles to hepatic ape E receptors. The human ape E gene is located on chromosome 19 lows ape E genotyping, since it is now possible to deterand spans 3.7 kilobases, including four exons (5). The mine the allelie variation at the genomic level as easily nucleotide sequence and the structure of the human ape as charge differences at the protein level. These methods B gene are completely determined (6). The mature ape allow the detection of specific DNA changes directly by E molecule, containing 299 amino acid residues, is obusing radioactive synthetic allele-specific oligonucleotide (ASO) probes with a Southern blotting technique; ‘Departement de Biochiinie M#{233}dicale et Biologie Mol#{233}culaire, their sensitivity is increased by using the polymerase Universit#{233} de Bordeaux II, 146 rue Leo Saignat, 33076 Bordeaux chain reaction (PCR) to amplify specific ape E sequences Cedex, France. and use ASO probes with dot-blotting techniques (222,oratojre de Biochimie B, CHU Saint-Antoine, 75012 Paris, 24). A good choice of PCR primers associated with the France. 3Clinique des Maladies Metaboliques, CHU Pitie-Salp#{233}tri#{232}re, use of different specific probes may permit the identifi75013 Paris, France. cation of all known mutations. Another technique takes 4Service de M#{233}decine Interne, Hopital Jean Verdier 93140 Bo. advantage of the H/ui! restriction fragment length polybigny, France. D Author for correspondence. Fax Int +33-56-99-03-80. morphisms corresponding to the presence or absence of 6Nonstandard abbreviations: ape E, apolipoprotein E; PCR, an Arg residue at positions 112 and 158 (25). This polymerase chain reaction; ASO, allele-specific oligonucleotide; method was extended to the detection of a rare ape E IEF, isoelectric focusing; and RE, restriction endonuclease. variant showing the El phenotype [Asp127], whose subReceived June 4, 1993; accepted August 24, 1993. 24 CLINICALCHEMISTRY, Vol. 40, No. 1, 1994

stitution of a single base generates a TaqI restriction site (26). In this report, we present a strategy for ape E genotyping that allows the differentiation of common and rare alleles (Table 1) according to specific restriction profiles on PCR-aniplifled DNA, using normal and degenerate primers. The procedure was applied to the detection of the three common isoforms and of the rare Weisgraber [Cys11/Asp127/Cys1] and Christchurch [Cys112/Ser1/ Cys1] variants. The procedure also permitted the identification of a new rare ape E [Cys112/Leu142/Cys1] associated with a type II! hyperlipoproteinemia.

Materials and Methods Subjects and blood samples. We obtained venous blood samples collected into EDTA anticoagulant from adult patients treated for hyperlipidemia at Jean Verdier Hospital (Bobigny, France) or at La Piti#{233}-Salpdtri#{232}re Hospital (Paris, France). These studies were performed in accordance with the Helsinki Declaration of 1975, as revised in 1983. Leukocyte DNA was extracted from 10 mL of anticoagulated whole blood (27) and stored at -20#{176}C. The methodwas also applied to -50 j.iL of whole blood spotted on Whatman filter paper. After drying, the spet was fixed with methanol and stored at room temperature. A disc 5 mm in diameter was punched out and mixed with 100 1L of deionized sterile water and placed in a boiling water bath for 30 min to lyse the cells. We used 20 L of this mixture as a DNA source for amplification. PCR amplification of apo E gene. Two specific sequences of exon 4 were designated on the basis of the known nucleotide sequence of the ape E gene (6). They were enzymatically amplified in the presence of 20-mer oligonucleotide primers. PCR 1 was carried out with the

primers

P1 (5’ AACAACTGACCCCGGTGGCG

3’) and

P2 (5’ ATGGCGCTGAGGCCGCGCTC 3’). PCR 2 was done with primers P3 (5’ CCCACCTGCGCAAGCTGCGC 3’) and P2. The amplification mixture consisted of amplification buffer (Perkin-Elmer Cetus, Norwalk, CT), 250 ng of DNA, 40 pmol of each primer, 8 nmol of each dNTP, 100 milL dimethyl sulfoxide, and 3.5 U of Taq DNA polymerase (Perkin-Elmer Cetus) in a final volume of 100 pL. After a denaturation step of 12 mm at

95#{176}C, the amplification reaction began by 5 cycles of 1 mm at 95#{176}C (for denaturation), followed by 3 mm at 72#{176}C (for primer annealing and extension). Then a series of 30 cycles (95#{176}C for 1 mm, 65#{176}C for 1 mm, 72#{176}C for 1 mm) was carried out. PCR products were run on 100 g/L polyacrylainide gel in the presence of the DNA size marker, pBR322 DNA digested with HaeI!I (Marker V; Boehringer Mannheim, Mannheim, Germany), for 45 mm at 25W, constant. After electrophoresis, the gel was soaked in ethidium bromide solution, illuminated with ultraviolet light, and photographed on Polaroid Type 665 film to distinguish the expected amplimers from nonspecific amplifications. Endonuclease restriction digestion of PCR products. After amplification, each PCR product (90 pL) was precipitated by 3 mol/L sodium acetate (4.5 L) and frozen absolute ethanol (180 iL) and left for a night at -20#{176}C. The precipitate was washed with frozen 700 milL ethanol, solubilized in sterile water, and divided into two parts for endonuclease digestions with 250 kUIL enzyme for 4 h. The amplified products were 292 bp and 115 bp for PCR1 and PCR2, respectively. As shown in Fig. 1, the first aliquot of PCR1 was digested by HhaI (Gibco BRL, Paisley, UK) at 37#{176}C, the second one by TaqI (Gibco BRL) at 65#{176}C. Half of the PCR2 product was treated with FspI (New England Biolabs, Beverly, MA) at 37#{176}C and half with HhaI at 37#{176}C. Each digested PCR product was then loaded on a 100 g/L pelyacrylamide gel for a 45-min electrophoresis at 25 W, constant. The DNA fragments separated after digestion were revealed by ethidium bromide under ultraviolet illumination. Their sizes were determined by comparison with an appropriate DNA size marker. Apo E genotyping by slot-blot hybridization with allele-specific oligonucleotide probes. We blotted 2 jL of P1P2 PCR product diluted with 200 L of 0.4 mol/L NaOH and 25 mmol/L EDTA onto 10 different charged nylon filters (Gene Screen Plus; DuPont-NEN products, Lea Ulis, France). The wells were washed twice with 400 tL of 2 x saline-sodium citrate buffer (NaCl 175 gIL, C6H5O7Na3 88 g/L, pH 7). The filters were washed for 2 min with 2 x saline-sodium phosphate-EDTA buffer (NaC1 175 gIL, NaH2PO4 6 H20 27.6 g/L, EDTA 7.4 g/L, adjusted to pH 7.4 with 10 mol/L NaOH) and dried.

Table 1. MutatIons of apo E polypeptlde. Amino acid resIdue Apo E variant

CommonE36 CommonE4 CommonE2 Rare Christchurch Rare [Cys11Cys1/Arg1] Rare (Cys11GIn1/Arg1] Rare [Arg11Cys142/Arg1) Rare Leiden

112

121

127

136

142

145

146

158

CYS

Glu

Gly

Arg

Arg

Arg

Lys

kg

Arg

Cys Ser Cys Gin kg kg

Cys IGlu

Gly]

Ref. 9-11 9-Il 9-11 16 17 18 19 20

duplication Rare Weisgraber a

Asp

Cys

15

Wild-type. Where no amino acid Is noted, there is no change from E3.

CLINICAL CHEMISTRY, Vol. 40, No. 1, 1994

25

ApoEgene

EXON4

s”

I PCR1(PUtt)

PCR

.r

13’

PCR2(pn)

115

292

PRODUCTS P3

106 61

4 &

72

4j

lihal

fragments

48 4

4 4

91

61

4

109

ei

#{163}4

fl

Fspl fragments

Christchurch allele ((y 1421allele

66

112

TaqI fragment,

4

35

139

91

4

153

1

1461allele

so

97

.

orner alleles

E2aIleIe

4

4 4

HhaI fragmenis,

#{163} 35 “

.

(Ag 158) alleles

#{163}4 #{163} otheralleles

Lelden allele

.

_______________________ 61

((

E4alleie

44

61

61

4

E3 allele

.

(Cy, 1451allele (GIn 1461allele

Welegraber allele

Fig. 1. Strategy for differentiationof common and rare apo E allelesby restrictionsite analysison PCR1 and PCR2 products. P1,P2, P3: prImers; P1(5’ AACAACTGACCCCGGTGGCG3’), P2(5’ ATGGCGCTGAGGCCGCGCTC 3’), P3(5’ CCCACCTGCGCAAGCTGCGC 3’). : Hhal cutting site (GC GC); l.: Taql cutting site (recognitionsequence Is TICGA); 0: Fspl cutting site (recognitionsequence Is TGCGCA). Numbers in circles Indicatevariable amino acids. Numbersshow sizes In base paIrs of visiblerestrictionfragments formed.

Samples

were prehybridized for 30 mm at 58#{176}C with 20x saline-sodium citrate, 100 g/L sodium dodecyl sulfate, 100 x Denhardt’s solution (including Ficoll 0.2 g/L), and 0.2 g of polyvinylpyrrolidone. The oligonucleotide probes were designed according to Emi et al. (22) as follows: Cys112 (5’ GCGGCGGCACACGTCCTC 3’); Arg112 (5’ GAGGACGTGCGCGGCCCC 3’); Cys (5’ CTGCCAGGCACTFCTGCAG 3’); Arg (5’ CTGCAGAAGCGCJTGGCAG 3’); Cys (5’ CCGCV1’ACACACC1TGCGC 3’); Arg145 (5’ GCGCAAGCTGCGTAAGCGG 3’); Ser (5’ AGGCGAGGCTCACCCGCA 3’); Arg (5’ TGCGGGTGCGCJTCGCCT 3’); Lys1 (5’ GOAGCCGCTTACGCAGCTF 3’); and GIn1 (5’ GGAGCCGCTGACGCCTT 3’). Oligonudeotides were labeled with [‘y.32P}dATP (Amersham, Bucks, UK) and T4 pelynucleotide kinase. Each ifiter was hybridized for 1 hat 58#{176}C with one of the 10 labeled oligonucleotides described above in the solution described above. After hybridization, the filters were washed twice for 5 mm at room temperature with a solution containing, per liter, 0.3 mol of NaC1, 30 mmol of trisodium citrate, and 1 g of sodium dodecyl sulfate. The same solution was then used to wash the filters for 2 mm at the following temperatures: 62#{176}C for probe Lys1; 64#{176}C for probes Cys, Arg, and Gln1; 66#{176}C for probes Ser136, Arg145, and Cys; 68#{176}C for probes Arg112, Cys, and Arg. Finally, the dried ifiters were autoradiographed by exposure to Hyperfllm-MM RNP6 (Amersham) for 24 h at -80#{176}C.

Results and DiscussIon Because of the clinical implications of ape E polymorphism (28), the study of ape E phenotype is of great 26

CLINICAL

CHEMISTRY,

Vol. 40, No. 1,

1994

interest. Until now, this polymorphism has been assessed by IEF. Although there have been improvements in IEF techniques (29-31), the fact that this methodology is based on charge differences between proteins limits its use for the detection of rare variants that can present the same charge as common isoforms. False results may also be attributable to the variability of sialylation, particularly in pathological situations such as diabetes meilitus (32). To avoid this pitfall, ape E genotyping has been developed. The genotyping strategy described in this paper is summed up in Fig. 1. It relies on the analysis of two specific sequences of the ape E gene. The allelic differentiation from PCR1 amplification digested by HhaI or TaqI is based on the appearance or on the disappearance of natural restriction sites of the ape E gene as already described (25, 26). With PCR1, it is possible to detect the common alleles E4 [Arg115/Arg1], E3 [C1/Arg1], and E2 [C sJCys], and the four rare alleles [Cys1/

AsP127/CY5158](Weisgraber), [Cys er36/Arg] (Christchurch), [Arg11/Glu121-+Gly127 duplication/Arg166] (Leiden), and [Arg1/C s1/Arg136] (Fig. 1). The two rare ape E alleles [Cys ys/Arg and [Cys1/Gln1/Arg158] cannot

be differentiated from the common E3 [CysJ because the nucleotide changes do not produce a change in the restriction site profile obtained after RhaI or TaqI digestion. We found a complementary strategy in creating new restriction sites specific for one of these two alleles by PCR-directed mutagenesis (33). Such a strategy can discriminate between variants of human alcohol dehydrogenase at Al)H2 and ADH3 loci (34). For ape E genotyping, PCR2 was performed by using the primer P3,

Arg]

sites guarantee the efficiency of endonudease deavages. the samples analyzed, one divergence appeared for a sample labeled E4E4 and E3E3 with PCR-ASO and PCR-RE, respectively; a subsequent study confirmed the presence of the homozygous E3 allele. The ASO method did not permit an unequivocal detection of the second allele of a heterozygote sample, which was a rare Christchurch allele (109-48--35-bp bands) (Fig. 3B). With ASO, we obtained an incomplete result (E2E2) in the presence of a rare Weisgraber allele, demonstrated after TaqI digestion of PCR1 that generated 153- and 139-bp fragments (Fig. 3A).

which contains one mismatch at its 3’ end, giving rise to the sequence TGCGCA recognized byFspl and HhaI on all the ape E alleles known hitherto except [Cys112/Gln1/ Arg]. The corresponding nucleotide sequence is TGCGCC, which contains only an HhaI site. To validate our ape E genotyping by the PCR-restriction endonudease (RE) site method, we studied several samples previously analyzed by PCR-ASO probes. The patterns that we obtained for the six common genotypes (homozygotes E4E4, E3E3, E2E2, and heterozygotes E3E4, E3E2, E4E2) are provided in Fig. 2 by the identification of H/wI and TaqI bands resulting from the digestion of PCR1 (P1P2) and of FspI and HhaI bands resulting from the digestion of PCR2(P3P2). The constant presence of a 61-bp band after digestion of PCR1 by IIhaI and the total disappearance of the 115-bp band after PCR2 digestion because of the presence of permanent FspI and HhaI

HOMOZYGOTE M

bp

I

2

5

In conclusion, ape E analysis at the genomic level can be alternative or complementary to IEF and may be necessary in pathological cases in which pesttranscriptional modifications may lead to disparities between

HOMOZYGOTE

E4E4

3

Among

6

bp

bp

M

I

2

3

E3ES 4

5

HOMOZYGUTE

6

bp

bp

M

I

2

3

E2E2 4

5

6

bp

292

292

‘I

6I

72 ‘I

4$

35

35

HETEROZYGOTE bp

292

HETEROZYGOTE

E4ES bp

M

I

2

3

4

HETEROZYGOTE ESE2

E4E2 3

6

bp

bp

M

I

2

3

4

5

6

bp

292

‘I 9I

$3

72

72

SI

‘I

4$

4$

35

35

Fig. 2. PCR products of six common apo E genotypes; products were separated in 100 g/L polyacrylamide gel stained with ethidium bromide. M, size marker pBR322 DNA digested with HaeIII; lanes 1-3, PCR1 product; lanes 4-6, PCR2 product; lanes 1 and 4, undigestedfragment; lanes 2 and 6, digestion with HhaI; lane 3, digestion with TaqI; lane 5, digestion with Fspi.

CLINICALCHEMISTRY, Vol.

40, No. 1, 1994

27

bp

M

I

2

3

4

5

6

bp

292

bp

M

2

3

4

5

6

bp

292

bp

Mi

2

3

4

5

6

bp

292

153 139 IIi

91

109

I IS

91

83

97

74

74

Iii I0I 91 83

97

61

61

74 61

48

39 35

35

A

B

C

Fig. 3. PCR products of three rare ape E genotypes: (A) ICys/Asp1Cys1 Weisgraberallele, homozygous;(B) heterozygoteE3 with Christchurch allele [Cysi1Ser13JArg1]; (C) heterozygoteE3 wIth [Cys11Leu,42/Cys,] allele. Products were separatedIn 100g/l. polyacrylamide gel stained with ethidlum bromide. M, size marker pBR322DNAdigestedwith Haeill; lanes 1-3, PCR1 product; lanes 4-6, PCR2 product; lanes I and 4, undigestedfragment lanes 2 and 6, dIgestionwith Hhai; lane 3, digestionwith Taql; lane 5, digestIonwith Fspl.

apparent phenotypes and genotypes (32). Several PCR techniques can be used for ape B genotyping. The ones that associate PCR with ASO hybridization (22-24,35) need numerous and very careful hybridization procedures and sometimes are unable to provide a correct genotype. Other original molecular biology techniques, such as an amplification refractory mutation system (36) and a radioactive primer-guided nucleotide incorporation assay (37), have been proposed for the analysis of ape E genotype but they are limited to the detection of the common alleles. Our strategy of genotyping based on analysis of specific restriction profiles on PCR-amplifled DNA with normal and degenerate primers is simpler, faster, and cheaper than molecular biology methods with hybridization and sequencing steps and allows simultaneous detection of common and rare alleles. An additional advantage might be the application of ape E genotyping on a microblood sample dried on blotting paper for epidemiological studies. Also, this procedure is likely to reveal a modification hitherto unknown of the nucleotide sequence of the ape E gene from the restriction profiles of the two amplification steps. A sample identified as homozygous [Cys11/Cys1J by the PCRASO technique presented an unexpected profile with the PCR-RE method (Fig. 3C), indicating a new rare ape E variant identified afterward as a new rare allele [Cys112J u1/Cys1], here associated with E2 allele (unpublished results).

References 1. Breslow JL. Apolipoprotein

genetic variation

ease. Physiol Rev 1988;68:85-132. 2. Brown MS, Goldstein JL. A receptor.mediated

and human

dis-

pathway for

cholesterol

homeostasis. Science 1986;232:34-47. 3. Mahley RW, Innerarity TL, Rail SC, Weisgraber RH. Plasma lipoproteins: apolipoprotein structure and function. J Lipid Res

1984;25:1277-94. 4. Mahley RW. Apolipoprotein E: cholesterol transport protein with expanding role in cell biolor. Science 1988;240:622-30. 5. Das MK, McPherson J, Burns GAP, Karatanasis 5K, Breslow JL. Isolation, characterization and mapping to chromosome 19 of the human apolipoprotein E gene. J Biol Chem 1985;260:6240-7.

28 CUNICAL CHEMISTRY, Vol. 40, No. 1, 1994

6. Paik YK, Chang DJ, Reardon CA, Davies GE, Mahley RW, Taylor JM. Nucleotide sequence and structure of the human apolipoprotein E gene. Proc Natl Acad Sd USA 1985;82:3445-9. 7. Zannis VI, Just PW, Breslow JL. Human apolipoprotein E isoprotein subclasses are genetically determinecL Am J Hum Genet 1981;33:11-24. 8. Davignon J, Gregg RE, Sing CF. Apolipoprotein E polymorphism and atherosclerosis. Arteriosclerosis 1988;8:1-21. 9. Zannis VI, Brealow JL. Human very low density lipoprotein E isoprotem polymorphism is explained by genetic variation and post translational modification. Biochemistry 198120:1033-41. 10. Utermann GU, Langenback U, Beisigel U, Weber W. Genetics of the apolipoprotein E system in man. Am J Hum Genet 1980;32:

339-47. 11. Weisgraber RH, Rail SC, Mahley RW. Human E apoprotein heterogeneity: cysteine.arginune interchanges in the amino acid sequence of the ape E isoforins. J Biol Chem 1981;256:237-41. 12. Uterman G, Hardewig A, Zimmer F. Apolipoprotein E phenotypes in patients with myocardial infection. Hum Genet 1984;65: 237-41. 13. Boerwinkle E, Visvikis S, Welsh D, Steunmeitz J, Hannash SM, Sing CF. The use of measured genotype information in the analysis of quantitative phenotypes in man. H. The role of the apolipoprotein E polymorphism in determining levels, variability, and covariability of cholesterol, betalipoprotein and triglycerides in a sample of unrelated individuals. Am J Med Genet 1989;27: 1224-35. 14. Breslow JL, Zannis VI, Sangiacomo TB., Third JL, Tracy T, Glueck CJ. Studies of fcimilii’il type Ill hyperlipoproteinemia using as a genetic marker the ape B phenotype E2/E2. J Lipid Rae 1982;23:1224-35. 15. Weisgraber RH, Rail SC Jr, Innerarity 11, Mahley RW, Kuusi T, Ehnholm C. A novel electrophoretic variant of human apolipoprotein E. Identification and characterization of apolipopro. tein El. J Cliii Invest 1984;73:1024-33. 16. Wardell MB., Brennan SO,Janus ED, Fraser B., Carrell RW. Apolipoprotein E2.Christchurch (136 Arg-#Ser). New variant of human apolipoprotein B in a patient with type ifi hyperlipopro. teinemia. J Cliii Invest 1987;80:483-90. 17. Rail SC Jr, Weisgraber RH, Innerarity TL, Mahley RW. Structural basis for receptor binding heterogeneity of apolipopro-

tein B from type HI hyperlipoproteinemia subjects. Proc Natl Aced Sci USA 1982;79:4696-700. 18. Rail SC Jr, Weisgraber KR, Innerarity TL, Bersot TP, Mahley RW, Blum CB. Identification of a new structural variant of human apolipoprotein E, E2 (Lys1-.Gln), in a type Ill hyperlipoproteune. mic subject with the E-3/2 phenotype. J Clin Invest 1983;72: 128897. 19. Rail SC Jr, Newhouse YM, Clarke HRG, Weisgraber RH, McCarthy BJ, Mahley RW, Bersot TP. Type Ill hyperlipoprotein.

emia associated with apolipoprotein B phenotype E3/3. Structure and genetics of an apolipoproteun E3 variant. J Clin Invest 1989; 83:1095-101. 20. Wardeil MR. Weisgraber KR, Havekes LM, Rail SC Jr.

polymorphism and genetic variants: current methods for ape B phenotyping. Ann Biol Cliii 1991;49:1-8. 29. Eichner JE, Kuiler LH, Ferrell RE, Kamboh MI. A simplified method for screening the apolipoprotein B polymorphism. Hum

Apolipoprotein E3-Leiden contains a seven-amino acid insertion that is a tandem repeat of residues 121-127. J Biol Chem 1989;

Hered 1991;41:61-4. 30. MSrz W, Cezanne 5, Grab W. Phenotypung of apolipoprotein B by immunoblotting in immobilized pH gradients. Electrophoresis 1991;12:59-63. 31. Luley C, Baumstark MW, Wieland H. Rapid apolipoprotein E phenotyping by immunofixation in agarose. J Lipid Roe 1989;30: 880-3. 32. Snowdon C, Houlston RS, ArifMH, Laker MF, Humphries SE, Alberti KGMM. Disparity between apolipoprotein E phenotypes and genotypes (as determined by polymerase chain reaction and

264:21205-10. 21. Bouthillier D, Sing CF, Davignon J. Apolipoprotein E phenotyping with a single gel method. Application to the study of informative matings. J Lipid Res 1983;24:1060-9. 22. Emi ML, Wu L, Robertson MA, Myers RL, Hegele RA, Williams RR, et al. Genotyping and sequence analysis of apolipoprotein E isoforms. Genomics 1988;3:373-9. 23. Weisgraber RH, Newhouse YM, Mahley RW. Apolipoprotein B genotyping using the PCR and allele specific oligonucleotide probes. Biochem Biophys Res Commun 1988;157:1212-7. 24. Main BF, Jones PJH, MacGillivray RFA, Banfleld DK Ape E genotyping using the polymerase chain reaction and allele-specific oligonucleotide primers. J Lipid Res 1991;32:183-7. 25. Hixson JE, Vernier DT. Restriction iaotyping of human apelipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res l990;31:545-8. 26. Kontula K, Aalto-SetSlA K, Kuusi T, H5ni5l5inen L, Syvanen AC. Apolipoprotein B polymorphism determined by restriction enzyme analysis of DNA amplified by polymerase chain reaction: convenient alternative to phenotyping by isoelectric focusing. Clin Chem 1990;36:2087-92. 27. Kunkel LM, Smith lCD, Boyer SH, Borgaonkar DS, Wachtel SS, Miller OJ, et aL Analysis of human Y-chromosome-speciflc reiterated DNA in chromosome variants. Proc Nati Aced Sci USA 1977;74:1245-9. 28. Steinmetz A. Clinical implications of the apolipoprotein E

oligonucleotide probes) in patients with non.unsulun-dependent diabetes meliitus. Clin Chim Acta 1991;196:49-58. 33. Friedman KJ, Highsmith WE Jr, Prior TW, Perry TR, Silverman LM. Cystic fibrosis deletion mutation detected by PCRmediated site-directed mutagenesis. Clin Chem 1990;36:695-6. 34. Groppi A, Begueret J, Iron A. Improved methods for genotype determination of human alcohol dehydrogenase (ADH) at ADH2 and ADH3 loci by using polymerase chain reaction-directed mutagenesis. Cliii Chem 1990;36:1765-8. 35. Smeets HJM, Poddighe J, Stuyt PMJ, StalenhoefAFH, Ropers HIT, Wieringa B. Identification of apolipoprotein E polymorphism by using synthetic oligonucleotides. J Lipid Res 1988;29:1231-7. 36. Wenham PR., Newton CR, Price WH. Analysis of apolipoprotein B genotypes by the amplification refractory mutation system.

Clin Chem 1991;37:241-4. 37. Syvanen AC, Aalto-SetfiIA K, Haiju L, Kontula K, S#{246}derlun H. A primer-guided nucleotide incorporation assay in the genotyping of Apo B. Genomics 1990;8:684-92.

CLINICAL CHEMISTRY, Vol. 40, No. 1, 1994

29