Microbes and Infection 4 (2002) 1027–1034 www.elsevier.com/locate/micinf
Original article
Characterization of a gene which encodes a mannosyltransferase homolog of Paracoccidioides brasiliensis Alessandra A. Costa a, Francisco J. Gómez b, Maristela Pereira a, M. Sueli S. Felipe c, Rosália S.A. Jesuino a, George S. Deepe Jr. b, Célia M. de Almeida Soares a,* a
Laboratório de Biologia Molecular, Instituto de Ciências Biológicas, Universidade Federal de Goiás, 74001-970, Goiânia, Goiás, Brazil b Division of Infectious Diseases, University of Cincinnati, OH, USA c Laboratório de Biologia Molecular, Instituto de Biologia, Universidade de Brasília, 70910-900, Brasília, D.F., Brazil Received 30 January 2002; accepted 10 April 2002
Abstract We screened an expression library of the yeast form of Paracoccidioides brasiliensis with a pool of human sera that was pre-adsorbed with mycelium, from patients with paracoccidioidomycosis (PCM). A sequence (PbYmnt) was obtained and characterized. A genomic clone was obtained by PCR of P. brasiliensis total DNA. The sequence contained a single open reading frame (ORF) encoding a protein of 357 amino acid residues, with a molecular mass of 39.78 kDa. The deduced amino acid sequence exhibited identity to mannosyl- and glycosyltransferases from several sources. A DXD motif was present in the translated gene and this sequence is characteristic of the glycosyltransferases. Hydropathy analysis revealed a single transmembrane region near the amino terminus of the molecule that suggested a type II membrane protein. The PbYmnt was expressed preferentially in the yeast parasitic phase. The accession number of the nucleotide sequence of PbYmnt and its flanking regions is AF374353. A recombinant protein was generated in Escherichia coli. Our data suggest that PbYmnt encodes one member of a glycosyltransferase family of proteins and that our strategy was useful in the isolation of differentially expressed genes. © 2002 Éditions scientifiques et médicales Elsevier SAS. All rights reserved. Keywords: Paracoccidioides brasiliensis; Antigens; Mannosyltransferases; Yeast phase
1. Introduction Paracoccidioides brasiliensis, the causative agent of paracoccidioidomycosis (PCM), manifests thermal dimorphism [1]. At room temperature, the fungus exists in the saprobic phase, and upon temperature elevation, the mycelia convert to the yeast phase. Host infection typically occurs by inhalation of conidia that are small enough to reach the alveoli, where they differentiate into the yeast form [2]. Once established, the disease may evolve into acute, subacute or chronic forms. These manifestations are dependent on the virulence of the fungal isolate as well as the condition of the human host [3]. The participation of cell-mediated immunity has been postulated to be the most important host defense mechanism against P. brasiliensis, and studies have indicated a high * Corresponding author. Tel.: +55-62-5211110; fax: +55-62-5211110. E-mail address:
[email protected] (C.M. de Almeida Soares). © 2002 Éditions scientifiques et médicales Elsevier SAS. All rights reserved. PII: S 1 2 8 6 - 4 5 7 9 ( 0 2 ) 0 1 6 2 6 - X
association between the integrity of humoral and cellular immune responses and resolution of disease [4,5]. The yeast phase synthesizes antigenic molecules that are able to interact with the host’s immune system and contribute to the pathogenesis of disease. Some of these key antigens have been characterized [6–12]. We focused our studies on the identification and characterization of genes and their cognate proteins that are potentially involved in the host–fungus interaction. To begin to characterize new antigenic molecules from P. brasiliensis, we previously described the cloning, heterologous expression, and immunological reactivity of HSP60 [10,11]. In addition we have characterized by amino acid sequencing the antigens catalase, fructose-1-6-biphosphate aldolase, glyceraldehyde-3-phosphate dehydrogenase, malate dehy drogenase and triosephosphate isomerase, all of them preferentially expressed in the yeast phase of P. brasiliensis [12]. In this paper, we sought to identify genes preferentially expressed in the yeast phase by immunoscreening of an
1028
A.A. Costa et al. / Microbes and Infection 4 (2002) 1027–1034
expression library with sera from PCM patients preadsorbed with total extract from the mycelia fungus phase. This strategy was done in anticipation that the cloning of those genes could also provide new insights into this parasitic phase of P. brasiliensis. In this communication, we describe the molecular cloning of a gene encoding a mannosyltransferase, an antigen preferentially expressed in the yeast phase. 2. Materials and methods 2.1. Strains, growth conditions and general procedures P. brasiliensis, isolate Pb 01 (ATCC, MYA-826) has been investigated in our laboratory and was used in this study. The mycelial phase was grown at 22 °C and the yeast cells at 36 °C. In addition the isolates of P. brasiliensis named E, 16, 53, 135, 3171, 4268 and 6810, all obtained from patients and kindly provided by M.R.R. Silva (Goiânia, Brazil), were grown at the yeast phase, at 36 °C. 2.2. Human sera A total of 18 human serum samples collected at the time of diagnosis from patients with confirmed PCM (KOH direct examination of the fungus, culture isolation and immunodiffusion tests) were pooled and used in the reaction to the cDNA library of the yeast phase of P. brasiliensis. Sera from 15 non-immune individuals were also pooled and used in the control reactions. 2.3. Cloning a sequence by immunoscreening of an expression library A cDNA library from the yeast phase of P. brasiliensis constructed in λZAPII (Stratagene, La Jolla, CA, USA) was screened by expression with the pooled sera of PCM patients. Prior to the reaction with the library proteins, the human sera pool was pre-adsorbed with total extract of the fungus mycelial phase (300 µg of total protein to 1.0 ml of human sera). The screening was performed using standard methods [13]. The reaction was developed using the AttoPhos fluorescent substrate system (Promega, Madison, USA). Positive plaques were tested by two additional cycles of selection and then subcloned by in vivo excision [14]. The Escherichia coli, transformed with the plasmids obtained by in vivo excision, were induced for expression of the fusion recombinant protein.
0.1 mM IPTG (isopropyl thiogalactopyranoside). After 2 h, the cells were washed and collected by centrifugation at 10 000 × g and the proteins fractionated by one-dimensional gel electrophoresis (12% SDS-PAGE) according to Laemmli [15]. 2.5. Western blotting After one-dimensional gel electrophoresis, the proteins were transferred to nylon membranes according to standard protocols [13]. The membranes were reacted to the pool of human sera at 1:500 dilution, pre-adsorbed with E. coli extracts. The secondary antibody, antihuman IgG, was used at 1:1000 dilution. The reactions were developed by BCIP/NBT (5-bromo-4-chloro-3-indolil-phosphatenitroblue tetrazolium). 2.6. Preparation and analysis of DNA and RNA Genomic DNA from P. brasiliensis was isolated by the cationic-hexadecyl trimethyl ammonium bromide (CTAB) method [16]. Total RNA was obtained by the TRIZOL extraction method (Invitrogen, Carlsbad, CA, USA). Northern blots were prepared as described in standard protocols [13]. The sense primer (S1) 5' CTCCTTCAATTCTCTGTC 3' and antisense primer (AT1) 5' TGTTCAGGTATCCAGTCACG 3' (Fig. 1A) were constructed on the basis of the PbYmnt gene (see below) and were used to amplify a 926-bp genomic fragment that was sequenced and used as a probe in the northern blot assays. Also, the primers were used to amplify fragments from the total DNA of isolates from P. brasiliensis and other dimorphic fungi (see below). 2.7. Isolation of the PbYmnt gene Primers were designed based on the DNA sequence obtained by immunoscreening of the expression yeast library, as shown in Fig. 1, panels A and B. The following primers were used: sense (S2) 5' GCGCAATCAGATATTTCACAG 3' and antisense (AT2) 5' GCGACTCGTTGCCGTCT 3'. The amplification protocol consisted of a denaturation step at 95 °C for 2 min, followed by 35 cycles of the following steps: denaturation at 95 °C for 1 min, annealing at 51 °C for 1 min and extension at 72 °C for 1 min. A final elongation step was performed at 72 °C for 7 min. The resulting 2872-bp product was subcloned into pGEM-T-Easy (Promega, Madison, USA).
2.4. Expression of the fusion protein
2.8. Nucleotide and deduced amino acid sequences of the PbYmnt gene
After three cycles of immunological screening and in vivo excision, the recombinant clones were tested by induction and reaction of the fusion protein to the sera of infected patients. The E. coli transformed cells were grown to an absorbance of 0.6 at 600 nm and then induced with
The nucleotide sequence of the entire gene and flanking sequences both upstream and downstream of the start codon were determined on both strands by automated DNA se quencing, applying the DNA sequencing method of Sanger et al. [17].
A.A. Costa et al. / Microbes and Infection 4 (2002) 1027–1034
1029
Fig. 1. Schematic diagram and sequence of the PbYmnt gene. (A) Diagram constructed on the basis of the 4498-nt DNA sequence obtained by immunoscreening of an expression library. ORFs 1 and 2 were obtained by analysis of the nucleotide sequence of the expression library. The primers S1 and AT1 were used for obtaining the probe used in the northern blot assay and for the PCR amplification of DNA from different isolates of P. brasiliensis and from several fungi. The primers S2 and AT2 were used for the PCR in the cloning of the PbYmnt gene. (B) Nucleotide sequence of PbYmnt gene and deduced amino acid sequence. The presumed TATA, CAAT and HSE elements at the promoter region are boxed. The asterisk in the 5' region is the putative start codon. The intron sequence is represented in lowercase. Underlined sequences indicate the conserved 5'/3' of the intron. Parentheses and bold type indicate the intron lariat sequence. The asterisk in the 3' region is the putative stop codon. Parentheses indicate the putative PolyA signal. The putative N-glycosylation sites in the deduced amino acid sequence are double boxed.
2.9. Sequence analysis Nucleotide sequence analysis was performed with the Wisconsin Genetics Computer Group Sequence Analysis software package, version 7.0 [18]. The NCBI BLAST program [19] was used to search for nucleotide and protein sequences with similarity to the PbYmnt. The values of similarity among protein sequences were based on the
alignment of amino acid sequences taking into account conserved substitutions of residues [20]. 2.10. Nucleotide sequence accession number The nucleotide sequence data reported in this paper have been submitted to GenBank under accession number AF 374353.
1030
A.A. Costa et al. / Microbes and Infection 4 (2002) 1027–1034
3. Results
3.2. Sequence analysis of the P. brasiliensis PbYmnt gene
3.1. Cloning the cDNA and heterologous expression of the recombinant protein
Since the sequence could represent DNA contamination during the library construction, primers (S2 and AT2) corresponding to the region of the putative ORF2 and flanking regions, as shown in Fig. 1A, were used for PCR amplification of the P. brasiliensis genomic DNA. These primers amplified a 2872-bp product in the genomic DNA of P. brasiliensis. The 2872-bp fragment was sequenced entirely and is shown in Fig. 1B. The sequence encompassed a single ORF interrupted by one intron and a likely transcription terminator. A sequence identical to a putative TATA box (TATA) was identified 84 nucleotides upstream from the proposed start codon. Three conserved nucleotide sequences NGAAN were present at positions 186, 242 and 536 upstream from the proposed start codon and may be components of the heat shock element (HSE) of this gene [21,22]. Two nucleotide sequences identical to putative CAAT boxes (CAAT) were identified at positions 165 and 153 upstream of the proposed translation start site. The sequence also has a purine (adenine) in the –3 position (Kozak’s rule), a prerequisite for an initiation codon [23]. Nucleotide sequence analysis revealed that the PbYmnt gene consists of two exons interrupted by one intron of 102 nt. The intron has a 5' GT dinucleotide and a 3' AG dinucleotide at the intron–exon junctions involved in the splicing process. Also, a lariat site (TGCTAAG), characteristic of fungal introns [24], was found at position 2076. The predicted protein start site at position 984 of the gene was the furthest upstream AUG codon that was in frame with the first exon. At the 3' end, a UAA, stop codon at position 2157, was within the second putative exon. The presence of initiation and stop codons, as well as a putative poly A signal (ATAA) at position 2438, together with the alignment with similar sequences (shown below), indicates that the PbYmnt encompassed the full-length gene.
P. brasiliensis PbYmnt was cloned by immunoscreening of an expression library (λZAPII-Stratagene) with pooled serum of PCM patients. The sera were pre-adsorbed with a total extract of mycelia phase. Three cycles of selection were performed. As a final step, the clone was excised from the pBluescript SK– (Stratagene) and the expression of the recombinant protein was induced by IPTG. The E. coli XL1-Blue cellular extracts were analyzed by SDS-PAGE and western blotting with pooled sera from PCM patients, as shown in Fig. 2. IPTG induced the expression of a 39-kDa protein that was reactive with the serum from patients with PCM, as detected by western blot (Fig. 2, lane 4). Based on the results obtained by the reactivity of the recombinant protein with serum from PCM patients, the clone was further characterized. A total of 4498 nt were sequenced. Sequence analysis showed the presence of two putative open reading frames (ORFs), nearby in the P. brasiliensis genome, that were of different sizes (Fig. 1A). No significant homology was found to ORF1. ORF2 exhibited homology to mannosyltransferases and glycosyltransferases (data not shown).
3.3. Analysis of the deduced amino acid sequence
Fig. 2. Immunoblot analysis of the expression of PbYmnt protein. An SDS-PAGE (12% polyacrylamide) gel was loaded with XL1-Blue cellular extracts before (lane 3) and after (lane 4) IPTG induction. The immunoblots were reacted with human PCM sera (1:500 diluted). After reaction with alkaline phosphatase labeled antihuman IgG, the reaction was developed with BCIP/NBT. E. coli not containing (lane 1) and containing (lane 2) the plasmid pBluescript SK–.
The PbYmnt gene contained a single ORF encoding a predicted protein of 357 amino acids. The calculated molecular size of the translated protein is 39.78 kDa and its isoelectric point is 9.33. When the deduced amino acid sequence from PbYmnt was used to search related sequences, three related genes were found with a significant score calculated using the BLAST algorithm [19]. The related sequences are Hoc1p, coding for a mannosyltransferase from Saccharomyces cerevisiae [25,26], a membrane-bound alpha-1,6-mannosyltransferase Och1p from S. cerevisiae [26–28] and a genomic sequence coding for a putative glycosyltransferase from Schizosaccharomy ces pombe (R.C. Mc Dougall, M.A. Rajandream, B.G. Barrell, M. Simmonds, C.M. Churcher, 2000, GenBank direct submission, unpublished). Fig. 3 shows the sequence alignment of the PbYMNT and the sequences cited above. The homology among the proteins is distributed over the
A.A. Costa et al. / Microbes and Infection 4 (2002) 1027–1034
1031
Fig. 3. Alignment of the predicted amino acid sequences of PbYmnt and related sequences. The amino acid is given in single-letter code. Asterisks indicate conserved amino acid residues. The symbols (: , .) denote a decreasing order of matching similarity between each corresponding amino acid pair. The DXD motif is boxed. The sequences were: YMNp.Pb (mannosyltransferase of P. brasiliensis, accession number AF 374353), HOC1p.Sc (mannosyltransferase of S. cerevisiae, accession number NP 012609); OCH1p. Sc (mannosyltransferase of S. cerevisiae, accession number NP 011477) and Gt.Sp (glycosyltransferase of S. pombe, accession number T 50453).
entire sequence. Of special note is a short conserved DXD motif. The conserved pair of aspartates appears in glycosyltransferase families, as described [29]. The deduced amino acid sequence demonstrated 26.3% identity and 48.2% similarity to Hoc1p, the putative Golgi mannosyltransferase of S. cerevisiae [25,26]. In addition the PbYMNT exhibited 48.7%, similarity to Och1p, a putative α-1,6mannosyltransferase of the S. cerevisiae Golgi apparatus [28]. 3.4. Hydropathy profile of the deduced PbYMNT protein Hydropathy analysis was performed using the TmPred program [30]. A single short potential transmembrane spanning a region of 17 amino acids, from amino acids 47 to 64,
near the amino terminus of the protein was predicted, as shown in Fig. 4. 3.5. PbYmnt expression The expression of the gene coding for the PbYMNT was studied in yeast and mycelium cells by northern blotting with a 926-bp fragment of the gene (Fig. 1A). Northern blot analysis showed the presence of one clearly visible hybrid ization band, that is highly expressed in the yeast parasitic phase and weakly detectable in the mycelial phase, as shown in Fig. 5B, lanes 1 and 2, respectively. In these experiments, the amount of rRNA, as detected by ethidium bromide, was used as an internal transcriptional control (Fig. 5A, lanes 1 and 2).
1032
A.A. Costa et al. / Microbes and Infection 4 (2002) 1027–1034
Fig. 4. Hydropathic profile of the deduced PbYMNT protein. Predicted architecture was based on the sequence presented in Fig. 2. Negative numbers indicate hydrophilic and positive values indicate hydrophobic protein portions.
3.6. PCR detection of the PbYmnt gene The oligonucleotide primer pairs (S1 and AT1) derived from the PbYmnt gene sequence amplified an identical 926-bp product in all of the nine selected clinical isolates of P. brasiliensis (Fig. 6, lanes 1–9). In addition no amplification of DNA from other fungal isolates was detected (Fig. 6, lanes 10–15). Southern blot analysis confirmed the PCR results (data not shown).
4. Discussion We have determined the sequence of a gene encoding an immunoreactive protein of P. brasiliensis manifesting identity to sequences of the glycosyltransferase families from
Fig. 5. PbYmnt gene expression in P. brasiliensis cells. RNA was extracted from yeast (lanes 1) or mycelium (lanes 2). Panel A (lanes 1 and 2) shows the rRNA bands, as detected by ethidium bromide staining of the gel. The nitrocellulose filter containing the blotted RNA was hybridized under high-stringency conditions with the 926-bp fragment of PbYmnt gene, as shown in panel B.
Fig. 6. Specificity of PCR with primers derived from the PbYmnt gene. Agarose gel electrophoresis of PCR products amplified from genomic DNA of (lanes 1–9) P. brasiliensis, isolates Pb 01, E, 16, 53, 735, 3171, 4268, 5979 and 6810. Lane 10, C. albicans; lane 11, Histoplasma capsulatum; lane 12, Coccidioides immitis; lane 13, S. cerevisiae; lane 14, Aspergillus fumigatus; and lane 15, Blastomyces dermatitidis.
A.A. Costa et al. / Microbes and Infection 4 (2002) 1027–1034
other fungi. The ORF encoded a 357 amino acid polypeptide with a calculated molecular mass of 39.8 kDa. The recombinant protein obtained in a heterologous system and recognized by sera from PCM patients demonstrated a similar apparent molecular mass (39 kDa) upon denaturing conditions. The screening of the λZAPII library with serum samples from PCM patients provided a DNA sequence composed of two ORFs. PCR analysis using primers spanning the entire sequence confirmed that the two ORFs were nearby in the P. brasiliensis genome. These results indicated that the library contained genomic DNA. This assumption is supported by the high number of adenine repeats present in the cloned sequence (data not shown). Primers corresponding to ORF2 were synthesized to amplify the P. brasiliensis genomic DNA. The genomic PCR product of 2872 bp, PbYmnt, was entirely sequenced in both directions. The PbYmnt encoded for a putative mannosyltransferase. The evidence to support this contention is as follows. First, homology was observed between PbYMNT and mannosyltransferases from other organisms. The most related sequence was Hoc1p, an α-1,6 mannosyltransferase that resides in the Golgi [31]. Also, there was homology to Och1p, an α-1,6 mannosyltransferase of S. cerevisiae that resides in the Golgi and catalyzes the addition of an α-1,6 linked mannose to the core oligosaccharide that is attached to the protein in the endoplasmic reticulum [32]. Of special note is the presence in PbYMNT of the conserved motif DXD manifesting hydrophobic residues at the N-terminal site, as described for glycosyltransferases from both prokaryotes and eukaryotes [29]. This motif, although short, has been suggested to be involved in folding of a small region of glycosyltransferases and may be required for catalysis [29]. Hydropathy analysis of the deduced protein PbYMNT showed the presence of a single short transmembrane region, near the amino terminus of the molecule, suggesting that it may be a type II membrane protein. Hoc1p, the yeast α-1-6- mannosyltransferase, is predicted to be a type II integral membrane protein, localized at the Golgi apparatus and is required for the proper construction of the cell wall [31]. Also, Och1p is predicted to be a type II integral membrane protein with a short cytoplasmic amino-terminal domain and a carboxy-terminal catalytic domain [28]. CaMnt1p, a mannosyltransferase from Candida albicans, is also predicted to be a type II membrane protein present in the Golgi compartment [33]. Mannosyltransferases initiate glycosylation of secreted proteins in fungi by the attachment of short glycosyl chains consisting of one to seven mannoses to residues of serine or threonine [34]. In addition to the essential role in cell survival, the mannosyltransferases have been associated with morphogenesis and virulence. For example, in C. albicans, the disruption of PMT1, encoding a mannosyltrans ferase, creates mutants that are defective in hyphal morphogenesis and highly susceptible to antifungal agents. Ho-
1033
mozygous pmt1 mutants are avirulent in a mouse model of systemic infection [35]. The physiological role of PbYMNT has to be elucidated. The PbYmnt is highly expressed at the temperature experienced by P. brasiliensis in the infected human host. Motifs similar to HSE were found at the promoter gene region, suggesting its regulation by the temperature. The high and preferential expression of the PbYmnt in the parasitic phase suggests a putative role in morphogenesis for mannosyltransferases in P. brasiliensis. In this vein, the PMT6 of C. albicans is related to fungus morphogenesis, since its deletion leads to defective filamentation [36]. PCR analysis of P. brasiliensis DNA using the oligonucleotides S1 and AT1 derived from the PbYmnt gene showed amplification of an identical 926-bp product in all the selected isolates of P. brasiliensis. The primers did not amplify the DNA from other fungi. This result suggests the utility of those primers for the detection of P. brasiliensis. Further studies will be necessary to test the efficacy of those primers in the detection of P. brasiliensis in patient specimens. We have cloned the gene encoding this potentially immunogenic mannosyltransferase protein. Expression of the cDNA and isolation of recombinant protein will allow direct testing of its role in human immunity to PCM, as well as in providing a possible new diagnostic test. In addition the cloned mannosyltransferase gene will enhance studies on the role of the protein in fungus physiology, including susceptibility to antifungal agents.
Acknowledgements We are grateful to Drs. David Finkel, University of Minnesota for providing C. albicans DNA; Kris Osborn and John Galgiani, University of Arizona for providing the DNA of C. immitis; Judith Rhodes, University of Cincinnati for providing the DNAs of S. cerevisiae and A. fumigatus and Dr. Bruce Klein, University of Wisconsin, for providing the B. dermatitidis DNA. We also thank Dr. M.R.R. Silva for supplying the isolates E, 16, 53, 135, 3171, 4268 and 6810. This investigation was supported by grants from CNPq (520679/99-7) and A. I. 34261 from the National Institute of Allergy and Infectious Diseases.
References [1]
F. Kanetsuna, L.M. Carbonell, I. Azuma, Y. Yamamura, Biochemical studies on the thermal dimorphism of Paracoccidioides brasiliensis, J. Bacteriol. 110 (1972) 208–218.
[2]
E. Brummer, E. Castaneda, A. Restrepo, Paracoccidioidomycosis: an update, Clin. Microbiol. Rev. 6 (1993) 89–117.
[3]
M. Franco, Host-parasite relationship in paracoccidioidomycosis, J. Clin. Microbiol. 25 (1987) 5–18.
1034 [4]
[5]
[6] [7]
[8]
[9]
[10]
[11]
[12]
[13]
[14] [15] [16]
[17]
[18]
[19] [20]
[21]
A.A. Costa et al. / Microbes and Infection 4 (2002) 1027–1034 P.W.Y. Mok, D.L. Greer, Cell-mediated immune response in patients with paracoccidioidomycosis, Clin. Exp. Immunol. 28 (1997) 89–98. C.P. Taborda, M.A. Juliano, R. Puccia, M. Franco, L.R. Travassos, Mapping of the T-cell epitope in the major 43-kilodalton glycoprotein of Paracoccidioides brasiliensis which induces a Th-1 response protective against fungal infection in BALB/c mice, Infect. Immun. 66 (1998) 786–793. M. Casoto, Characterization of cellular antigens of Paracoccidioides brasiliensis yeast form, J. Clin. Microbiol. 28 (1990) 1188–1193. M.J.S. Mendes-Giannini, E. Toscano, G.B. Del Negro, C.M. Assis, N.M. Garcia, Immunochemical study of a Paracoccidioides brasiliensis polysaccharide-like antigen, J. Med. Vet. Mycol. 33 (1995) 379–383. P.S. Cisalpino, R. Puccia, L.M. Yamamuchi, M.J. Cano, F.J. Da Silveira, L.R. Travassos, Cloning, characterization and epitope expression of the major diagnostic antigen of Paracoccidioides brasiliensis, J. Biol. Chem. 271 (1996) 4553–4560. J.G. McEween, B.L. Ortiz, A.M. Garcia, A.M. Florez, S. Botero, A. Restrepo, Molecular cloning, nucleotide sequencing, and characterization of a 27-kDa antigenic protein from Paracoccidioides brasiliensis, Fungal Genet. Biol. 20 (1996) 125–131. S.M. Salem-Izacc, F.J. Gomez, R.S.A. Jesuino, C.A. Fonseca, M.S.S. Felipe, G.S. Deepe Jr, C.M.A. Soares, Molecular cloning, characterization and expression of the heat shock protein 60 gene from the human pathogenic fungus Paracoccidioides brasiliensis, Med. Mycol. 39 (2001) 445–455. D.A. Cunha, R.M. Zancopé-Oliveira, M.S.S. Felipe, S.M. SalemIzacc, G.S. Deepe Jr, C.M.A. Soares, Heterologous expression, purification and immunological reactivity of a recombinant HSP60 from Paracoccidioides brasiliensis, Clin. Diagn. Lab. Immunol. 9 (2002) 374–377. C.A. Fonseca, R.S.A. Jesuino, M.S.S. Felipe, D.A. Cunha, W.A. Brito, C.M.A. Soares, Two-dimensional electrophoresis and characterization of antigens from Paracoccidioides brasiliensis, Microbes Infect. 3 (2001) 535–542. J.E. Sambrook, F. Fritsch, T. Maniatis (Eds.), Molecular Cloning: A Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. J.M. Short, J.A. Sorge, In vivo excision properties of bacteriophage λ Zap expression vector, Methods Enzymol. 216 (1992) 495–508. U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 224 (1970) 680–685. G. Del Sal, G. Manfioletti, C. Schneider, The CTAB-DNA precipitation method: a common mini-scale preparation of template DNA from phagemids phages or plasmids suitable for sequencing, Biotechniques 7 (1989) 514–519. F. Sanger, S. Nicklen, A.R. Coulson, DNA sequencing with chainterminating inhibitors, Proc. Natl. Acad. Sci. USA 74 (1977) 5463–5467. J. Devereux, P. Haeberli, O. Smithies, A comprehensive set of sequence analysis for the UAX, Nucleic Acids Res. 12 (1984) 387–395. S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, Basic local alignment search tool, J. Mol. Biol. 215 (1990) 403–410. D.G. Higgins, P.M. Sharp, Clustal: a package for performing multiple sequence alignment on a microcomputer, Gene 73 (1988) 237–244. H.R.B. Pelham, M. Bienz, A synthetic heat shock promoter element confers heat-inducibility on the herpes simplex virus thymidine kinase gene, EMBO J. 1 (1982) 1473–1486.
[22] M. Kapoor, C.A. Curle, C. Runham, The hsp70 gene family of Neurospora crassa: cloning, sequence analysis, expression and genetic mapping of the major stress-inducible member, J. Bacteriol. 177 (1995) 212–221. [23] M. Kozak, Point mutations define a sequence flanking the AUG initiation codon that modulates translation by eukaryotic ribosomes, Cell 44 (1986) 283–292. [24] D.J. Ballance, Sequences important for gene expression in filamentous fungi, Yeast 2 (1986) 229–236. [25] F. Galibert, D. Alexandraki, A. Faur, E. Boles, N. Chalwatziz, J.C. Chuat, F. Coster, C. Cziepluch, M. de Haan, H. Domdey, A. Hennemamm, C.J. Herbert, K. Heumann, F. Hilger, C.P. Hollenberg, L. Karpfinger-Hartl, Complete nucleotide sequence of Saccharomyces cerevisiae chromosome X, EMBO J. 15 (1996) 2031–2049. [26] A. Goffeau, B.G. Barrell, H. Bussey, R.W. Davis, B. Dujon, F. Feldmannh Galibert, J.D. Hoheisel, C. Jacq, M. Johnston, E.J. Louis, J.W. Mewes, Y. Murakami, P. Philippse, H. Tettelin, S.G. Oliver, Life with 6000 genes, Science 274 (1996) 546. [27] H. Tettelin, C.M.L. Agostomi, K. Albermann, M. Albers, J. Arroyo, U. Backes, T. Barreiros, I. Bertani, A.J. Bjourson, M. Bruckner, C.V. Bruschi, G. Carignani, L. Castagnoli, E. Cerdan, M.L. Clemente, A. Cobllenz, M. Coglievina, E. Coissac, E. Defoor, S. Del Bino, H. Delius, D. Delneri, P. De Wergifosse, B. Dujon, K. Leine, The nucleotide sequence of Saccharomyces cerevisiae chromosome VII, Nature 387 (1997) 81–84. [28] K. Nakayama, T. Nagasu, Y. Shimma, J. Kuromitsu, Y. Jigami, OCH1 encodes a novel membrane bound mannosyltransferase: outer chain elongation of asparagines-linked oligosaccharides, EMBO J. 11 (1992) 2511–2519. [29] C.A.R. Wiggins, S. Munro, Activity of the yeast MNN1 α-1,3mannosyltransferase requires a motif conserved in many other families of glycosyltransferases, Proc. Natl. Acad. Sci. USA 95 (1998) 7945–7950. [30] K. Hofmann, W. Stoffel, Tmbase – a database of membrane spanning proteins segments, Biol. Chem. Hoppe-Seyler 374 (1993) 166. [31] A.M. Neiman, V. Mhaiskar, V. Nanus, F. Galibert, N. Dean, Saccharomyces cerevisiae HOC1, a suppressor of pkc1, encodes a putative glycosyltransferase, Genetics 145 (1977) 637–645. [32] Y. Naranishi-Shindo, K. Nakawama, A. Tanaka, Y. Toda, Y. Jigami, Structure of the N-linked oligosaccharides that show the complete loss of α1.6- polymannose outer chain from och1, mn1 and och1 mn1 alg3 mutants of Saccharomyces cerevisiae, J. Biol. Chem. 268 (1993) 26338–26345. [33] E. Buurman, C. Westwater, B. Hube, A.J.P. Brown, D.C. Odds, N.A.R. Gow, Molecular analysis of CaMnt1p, a mannosyl transferase important for adhesion and virulence of Candida albicans, Proc. Natl. Acad. Sci. USA 95 (1998) 7670–7675. [34] S. Strahl-Bolsinger, M. Gentzsch, W. Tunner, Protein O-mannosylation, Biochem. Biophys. Acta 1426 (1999) 297–307. [35] C. Timpel, S. Strahl-Bolsinger, K. Ziegelbauer, J. Ernst, Multiple functions of Pmt 1p-mediated protein O-mannosylation in the fungal pathogen Candida albicans, J. Biol. Chem. 2734 (1998) 20837–20846. [36] C. Timpel, S. Zink, S. Strahl-Bolsinger, K. Schroppel, J. Ernst, Morphogenesis, adhesive properties and antifungal resistance depend on the PMT6 protein mannosyltransferase in the fungal pathogen Candida albicans, J. Bacteriol. 182 (2000) 3063–3071.
