Carbonic anhydrase II promotes cardiomyocyte hypertrophy

1599

Carbonic anhydrase II promotes cardiomyocyte hypertrophy

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

Brittany F. Brown, Anita Quon, Jason R.B. Dyck, and Joseph R. Casey

Abstract: Pathological cardiac hypertrophy, the maladaptive remodelling of the myocardium, often progresses to heart failure. The sodium–proton exchanger (NHE1) and chloride– bicarbonate exchanger (AE3) have been implicated as important in the hypertrophic cascade. Carbonic anhydrase II (CAII) provides substrates for these transporters (protons and bicarbonate, respectively). CAII physically interacts with NHE1 and AE3, enhancing their respective ion transport activities by increasing the concentration of substrate at their transport sites. Earlier studies found that a broad-spectrum carbonic anhydrase inhibitor prevented cardiomyocyte hypertrophy (CH), suggesting that carbonic anhydrase is important in the development of hypertrophy. Here we investigated whether cytosolic CAII was the CA isoform involved in hypertrophy. Neonatal rat ventricular myocytes (NRVMs) were transduced with recombinant adenoviral constructs to over-express wildtype or catalytically inactive CAII (CAII-V143Y). Over-expression of wild-type CAII in NRVMs did not affect CH development. In contrast, CAII-V143Y over-expression suppressed the response to hypertrophic stimuli, suggesting that CAII-V143Y behaves in a dominant negative fashion over endogenous CAII to suppress hypertrophy. We also examined CAII-deficient (Car2) mice, whose hearts exhibit physiological hypertrophy without any decrease in cardiac function. Moreover, cardiomyocytes from Car2 mice do not respond to prohypertrophic stimulation. Together, these findings support a role of CAII in promoting CH. Key words: cardiac hypertrophy, heart failure, carbonic anhydrase, bicarbonate transport, sodium–proton exchange, adenovirus, knockout mouse. Résumé : L’hypertrophie cardiaque pathologique, un remodelage mal adapté du myocarde, évolue souvent vers l’insuffisance cardiaque. L’échangeur sodium–proton (NHE1) et l’échangeur chlorure– bicarbonate (AE3) ont été impliqués comme joueurs importants de la cascade hypertrophique. L’anhydrase carbonique II (CA II) fournit les substrats de ces transporteurs (protons et bicarbonate, respectivement). La CA II interagit physiquement avec NHE1 et AE3, augmentant leurs activités de transport ionique respectives en élevant la concentration de substrat aux sites de transport. Des études antérieures ont montré qu’un inhibiteur d’anhydrase carbonique a` large spectre prévenait l’hypertrophie des cardiomyocytes (HC), suggérant que l’anhydrase carbonique soit importante dans le développement de l’hypertrophie. Nous examinons ici si la CA II cytosolique est l’isoforme de CA impliquée dans l’hypertrophie. Des myocytes ventriculaires de rats nouveaunés (MVRN) ont été transduits avec des constructions adénovirales qui surexpriment la CA II sauvage ou une CAII inactive sur le plan catalytique (CAII-V143Y). La surexpression de CA II sauvage chez les MVRN n’affectait pas le développement de l’HC. Au contraire, la surexpression de CAII-V143Y supprimait la réponse aux stimuli hypertrophiques, suggérant que la CAII-V143Y agit de façon dominante négative sur la CAII endogène pour supprimer l’hypertrophie. Nous avons aussi examiné des souris dépourvues de CAII (Car2), dont les cœurs présentent une hypertrophie physiologique sans diminution de la fonction cardiaque. Aussi, les cardiomyocytes des souris Car2 ne répondaient pas a` une stimulation prohypertrophique. Dans l’ensemble, ces données appuient l’hypothèse que la CAII favorise l’HC. Mots-clés : hypertrophie cardiaque, insuffisance cardiaque, anhydrase carbonique, transport du bicarbonate, échangeur sodium–proton, adénovirus, souris knockout. [Traduit par la Rédaction]

Introduction Cardiovascular pH regulation processes are implicated in the progression of pathological cardiac hypertrophy (Alvarez et al. 2001; Ennis et al. 2003; Hayasaki-Kajiwara et al. 1999; Karmazyn et al. 2003; Kusumoto et al. 2001; Yoshida and

Karmazyn 2000). The molecular mechanisms underlying the phenomenon converge on the plasma membrane Na⫹/H⫹ exchanger NHE1 (Cingolani and Camilion De Hurtado 2002), which expels protons from the cell in exchange for Na⫹ to control cytosolic acidity. Hypertrophic signalling pathways are coupled to activation of protein kinase C (PKC), which

Received 30 May 2012. Accepted 20 September 2012. Published at www.nrcresearchpress.com/cjpp on 23 November 2012. B.F. Brown, A. Quon, and J.R. Casey. Membrane Protein Disease Research Group, Department of Biochemistry, School of Translational Medicine, University of Alberta, Edmonton, AB T6G 2H7, Canada. J.R.B. Dyck. Department of Pediatrics, Cardiovascular Research Centre, Mazankowski Alberta Heart Institute, University of Alberta, Edmonton, AB T6G 2S2, Canada. Corresponding author: Joseph R. Casey (e-mail: [email protected]). Can. J. Physiol. Pharmacol. 90: 1599 –1610 (2012)

doi:10.1139/y2012-142

Published by NRC Research Press

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

1600

leads to phosphorylation of NHE1 by the mitogen-activated protein kinase pathway and consequently increases NHE1 activity (Moor and Fliegel 1999). The associated increase in intracellular Na⫹ promotes hypertrophy through sustained activation of PKC (Hayasaki-Kajiwara et al. 1999), as well as inhibition–reverse action of the Na⫹/Ca2⫹ exchanger (NCX), which results in elevated cytosolic Ca2⫹ levels (Pérez et al. 2001). Increased cytosolic Ca2⫹ activates the calcineurin– nuclear factor of activated T cells transcription pathway to promote hypertrophic cell growth (Molkentin et al. 1998). While NHE1 expression varies in different ischemic and hypertrophic models, inhibition of NHE1 prevents the development of hypertrophy both in vitro and in vivo (Ennis et al. 2003; Fliegel 2008; Karmazyn et al. 2003; Kusumoto et al. 2001; Yoshida and Karmazyn 2000). In promoting cardiomyocyte hypertrophy, NHE1 does not function alone. NHE1 activity has an alkalinizing effect, yet major changes in intracellular pH do not occur during hypertrophic stimulation of cardiomyocytes (Pérez et al. 1995). This indicates that there is a parallel acidifying pathway in the cardiomyocyte that is activated during hypertrophy, otherwise the alkalosis would auto-inhibit NHE1 activity through a cytosolic modifier site (Counillon and Pouyssegur 2000). Plasma membrane chloride– bicarbonate exchangers of the anion exchanger (AE) family (Cordat and Casey 2009) provide the principal acid-loading pathway in cardiomyocytes (Alvarez et al. 2004). Amongst these, AE3 is the only Cl–/HCO3– exchanger that is activated by PKC, indicating that it is the transporter acting counter to NHE1 in response to the hypertrophic stimuli coupled to PKC activation (e.g., angiotensin II, ␣-adrenergic agonists) (Alvarez et al. 2001). Transport activity of both AE3 and NHE1 is activated by carbonic anhydrases (CA), which provide transport substrates for AE3 and NHE1 (H⫹ and HCO3–, respectively) by catalysis of the hydration of CO2 into H⫹ and HCO3– (Li et al. 2002; Sterling et al. 2001). CAII physically interacts with NHE1 and AE3, which has been described as a transport metabolon, a physical complex of proteins that increases the efficiency of substrate transport across the plasma membrane (Li et al. 2002; Srere 1987; Sterling et al. 2001). Localization of CAII to the cytosolic surface of AE3 and NHE1 maximizes transport substrate availability at their transport sites (Li et al. 2002; Sterling et al. 2001). Over-expression of the catalytically inactive CAII mutant, V143Y, reduced chloride– bicarbonate exchange and NHE1 transport activity, consistent with a dominant negative mode of action: CAII-V143Y displaces wildtype (WT) CAII bound to the transporters, reducing local transport substrate availability (Li et al. 2002; Sterling et al. 2001). Isoforms of CA present in the heart include cytosolic CAII, and extracellular anchored CAIV, CAIX, and CAXIV (Fujikawa-Adachi et al. 1999; Okuyama et al. 1992; Scheibe et al. 2006). NHE1 is a promising target in treatment of cardiac hypertrophy, but clinical trials of NHE1 inhibitors (in the context of ischemia–reperfusion injury) revealed significant stroke risk, which halted further consideration of these drugs (Erhardt 1999; Karmazyn 2000; Théroux et al. 2000). An alternative approach to reduce NHE1 activity, and thereby to reduce hypertrophic growth, is to target the ion substrate supply of this transporter. Indeed, carbonic anhydrase inhibition, using ethoxyzolamide (ETZ), prevented and reverted cardio-

Can. J. Physiol. Pharmacol. Vol. 90, 2012

myocyte hypertrophy (Alvarez et al. 2007b). In particular, the phenylephrine-induced increases in cell surface area and expression of the hypertrophic marker, atrial natriuretic peptide (ANP), in neonatal and adult murine cardiomyocytes, were attenuated by ETZ (Alvarez et al. 2007b). Similarly, phenylephrine and angiotensin II induced activation of NHE1 and AE3 (Alvarez et al. 2007b) was also attenuated by ETZ. Together this work suggested that carbonic anhydrase was important in the development of cardiomyocyte hypertrophy, by activation of NHE1. The study was, however, unable to draw a firm conclusion about which CA isoform was involved in hypertrophy, and left open the possibility that ETZ targeted a process other than CA. In this study, we investigated the importance of CAII in the development of cardiomyocyte hypertrophy. Recombinant adenoviral constructs were used to over-express WT CAII and a catalytically inactive CAII mutant, V143Y, in neonatal rat cardiomyocytes. We also examined hypertrophic growth in CAII-deficient (Car2) mice (Lewis et al. 1988).

Materials and methods Animal care Experimental protocols involving animals were carried out in accordance with policies of the Canadian Council on Animal Care, and were approved by the Faculty of Medicine and Dentistry, University of Alberta’s Animal Care and Use Committee. Cardiomyocyte isolation and culture Neonatal rat cardiomyocytes were isolated and cultured following a protocol (Kovacic et al. 2003), with revisions (Alvarez et al. 2007b). Adult mouse cardiomyocytes were isolated and cultured as previously described (Alvarez et al. 2007b; Sambrano et al. 2002). Generation of recombinant adenoviruses The plasmids pJRC36 (containing human CAII cDNA) (Sterling et al. 2001) and pDS14 (containing cDNA for CAIIV143Y, a catalytically inactive form of CAII) (Sterling et al. 2001) were initially digested with the restriction enzyme EcoRI. After gel purification, the linearized products were digested using mung bean exonuclease to create a blunt end. The final fragments were cloned into the XbaI and EcoRV sites of pAdTRACK-CMV (He et al. 1998) to create pDAS1 (encoding wild-type human CAII) and pDAS2 (encoding CAII-V143Y). Cloning was confirmed by DNA sequencing. pDAS1 and pDAS2 were used to generate recombinant adenoviruses by the Cardiovascular Research Centre Gene Transfer Core (University of Alberta) (He et al. 1998). AdCAIIWT encoded for WT CAII and green fluorescent protein (GFP), and AdCAII-V143Y encoded for CAII-V143Y and GFP. A recombinant adenovirus encoding only GFP (AdGFP) was also generated. CAII-deficient mice Experiments were performed using male C57BL/6 CAIIdeficient (Car2) mice (Jackson Laboratories). The mice have a null mutation at the caii locus on chromosome 3, achieved by treatment with N-ethyl-N-nitrosourea (Lewis et al. 1988). Agematched WT mice were used as controls. Published by NRC Research Press

Brown et al.

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

Heart weight to body weight ratio Mice were weighed and then euthanized by intraperitoneal injection with sodium pentobarbital (50 mg/kg of body mass). The hearts were excised and rinsed in 4°C phosphate buffered saline (PBS). The ventricles were separated from the atria and blood vessels, blotted dry, and weighed. Heart weight to body weight ratio was calculated by dividing the weight of the ventricles by the weight of the whole animal. Blood pressure and heart rate recording Blood pressure and heart rate recordings were collected by the Cardiovascular Research Centre Core Facility (University of Alberta), following established standard operating procedures. A 26°C warming chamber, restrainers, and tail cuff sensors (IITC Life Science) were used to collect blood pressure measurements (systolic and diastolic) and heart rates from the mice. Mice were tail-cuffed 3 times/week for 2 weeks to train their response, prior to recording of heart rate and blood pressure. Three tests (30 s/reading) were performed for each mouse. Echocardiography Echocardiography was performed by the Cardiovascular Research Centre Core Facility (University of Alberta). Mice were anesthetized using 3.0% (v/v) Isoflurane in a Vevo Compact Anesthesia System (VisualSonics), which was switched to 1.0%–1.5% (v/v) once masks were applied to the animals. Echocardiography parameters were measured and calculated using a Visualsonics 770 High Resolution Imaging system (VisualSonics). Wall measurements, ejection fraction, and fractional shortening were calculated, using a 30 MHz probe, to obtain M-mode images in the parasternal long axis and short axis view at the papillary level. Mitral velocities, E and A, were obtained using a 4-chamber view to calculate the mitral valve E/A ratio. The Tissue Doppler was taken from the mitral septal annulus to give the E= tissue motion value, which was used to calculate the E/E= ratio. Cardiomyocyte treatment Neonatal rat ventricular myocytes were incubated for 18 h at 37 °C and 5% CO2, then washed with PBS and subsequently wash medium (Dulbecco’s Modified Eagle’s Medium F12 medium, 4 mmol/L of L-glutamine, and 0.05 mg/mL of gentamycin). Myocytes were then incubated at 37 °C and 5% CO2 for 48 h in serum-free medium (Dulbecco’s Modified Eagle’s Medium F12 medium, 1% w/v ITS Liquid Media Supplement 100x (SIGMA), 4 mmol/L of L-glutamine, and 0.05 mg/mL of gentamycin). To transduce the cells, AdGFP (MOI 12), AdCAII-WT, or AdCAII-V143Y (MOI 40) were added to the appropriate dishes at the same time as the addition of the serum-free medium. Phenylephrine (10 ␮mol/L) (SIGMA) or vehicle was added 24 h post-transduction. Adult mouse ventricular myocytes were incubated for 18 h at 37 °C and 5% CO2, then treated with vehicle or 10 ␮mol/L of phenylephrine. The cells were incubated in the presence of vehicle or phenylephrine for 24 h at 37 °C and 5% CO2. Cell size analysis Images of cultured neonatal rat cardiomyocytes were collected 48 h post-transduction, using a QICAM fast cooled 12-bit colour camera (QImaging Corp.). Images of cultured adult mouse cardiomyocytes were collected 24 h after treat-

1601

ment with vehicle or phenylephrine. Image-Pro Plus software (Media Cybernetics) was used to measure cell surface area. Areas of 140 –200 cells were measured for each treatment. [3H]Phenylalanine incorporation [3H]Phenylalanine incorporation assays were performed, using a modified protocol that was previously described (Link and Labaer 2011). [3H]Phenylalanine (1 ␮Ci/mL) (PerkinElmer) was added to cultured myocytes at the time of drug treatment (vehicle or phenylephrine), and the cells were incubated for 24 h at 37 °C and 5% CO2. Medium was aspirated, and the cells were lysed with 0.5% (v/v) Triton x-100 in PBS, containing Complete Mini Protease Inhibitor Cocktail (Roche) and collected in 1.5 mL microcentrifuge tubes. Trichloroacetic acid (100%: 500 g in 350 mL of H2O) was added to the lysates to a final concentration of 40% (v/v), and the lysates were incubated at 4 °C for 30 min. The lysates were centrifuged for 15 min at 12 682g, and the supernatants were discarded. The pellets were resuspended in 200 ␮L of –20 °C acetone, and centrifuged again for 10 min at 12 682g. This step was repeated twice in total, and the final pellets were resuspended in 200 ␮L of 0.2 mol/L NaOH, 1% (w/v) SDS. The radioactivity of [3H]phenylalanine in the samples was measured using a Beckman LS6500 liquid scintillation counter. SDS PAGE and immunoblotting Neonatal rat cardiomyocytes were plated at a density of 2.0 ⫻ 106 cells per 60 mm dish. Cells were lysed in SDS– PAGE sample buffer, containing Complete Mini Protease Inhibitor Cocktail (Roche), and SDS–PAGE and immunoblotting were performed as described previously (Alvarez et al. 2007b). Antibodies used in this study were anti-CAII antibody (rabbit polyclonal H-70; Santa Cruz Biotechnology; 1:1000), polyclonal rabbit anti-GFP antibody (a kind gift from Dr. L. Berthiaume, University of Alberta, Edmonton, Alberta, Canada; 1:30 000), anti-␤-actin antibody (mouse monoclonal; Santa Cruz Biotechnology; 1:1000), and secondary antibodies donkey anti-rabbit IgG conjugated to horseradish peroxidase (Santa Cruz Biotechnology), anti-mouse IgG conjugated to horseradish peroxidase (Santa Cruz Biotechnology), or mouse anti-goat IgG conjugated to horseradish peroxidase (Santa Cruz Biotechnology). Quantitative densitometry of immunoblots was performed, using Kodak Molecular Imaging Software version 4.0.3 (Kodak). cDNA synthesis and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) Cardiomyocyte lysates were collected, using 350 ␮L Buffer RLT (Qiagen). mRNA was extracted from the lysates using an RNeasy Plus Mini Kit, as per manufacturer’s instructions (Qiagen), and quantified using a Nanodrop 2000c spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized as described previously (Alvarez et al. 2007b). Three samples were pooled for subsequent analysis. Real-time qRT-PCR was performed, as previously described (Alvarez et al. 2007b), except using a Rotorgene 3000 real time thermal cycler (Corbett Research) with 5 ␮L of template cDNA along with 12 ␮L 2x Rotor-Gene SYBR Green PCR Master Mix (Rotor-Gene SYBR Green PCR Kit, Qiagen) and 1 ␮mol/L of each primer. To correct for differences in the amount of mRNA between the samples, the Ct values of GAPDH were made to be the same, and that corPublished by NRC Research Press

1602

Can. J. Physiol. Pharmacol. Vol. 90, 2012

Species/ gene

Forward primer (5=¡3=)

Reverse primer (5=¡3=)

Expected PCR product size (bp)

Observed PCR product size (bp)

mcaii manp mbnp mnhe1 mbhc mae3 mgapdh rcaii ranp rbnp rnhe1 rbhc rgapdh rae3

CTCTGCTGGAATGTGTGACCT TCCAGGCCATATTGGAGCAAATCC TGGGCTGTAACGCACTGAAGTTG TTTTCACCGTCTTTGTGCAG GAGACGGAGAATGGCAAGAC AGGCTCAAATGTTGGTTCT CCTCGTCCCGTAGACAAAAT GGGTAGGATTGACAGGAT CTTGGGCTGTGACGGGCTGAG CGGGTCATCGAGCCGCTCTTC GGCAGAGGAGAGGGCGGACA ACATGCCTGGGGGAGACGGT GGCATTGCTCTCAATGACAA CCTCGTCCCGTAGACAAAAT

GCGTACGGAAATGAGACATCTGC TCCAGGTGGTCTAGCAGGTTCTTG TCAAAGGTGGTCCCAGAGCTGGG TGTGTGGATCTCCTCGTTGA AAGCGTAGCGCTCCTTGAG CTGTATCCGGGATGGTTTCT TGATGGCAACAATCTCCACT GGATCTTTTGCGATCTGCTC GCTGGGGAAAGAAGAGCCGCA CTCCTGAGGCGATGAGGGCCA ACTCTTCATTCAGGCCCTTGGCG AGAAAGGCACGCGCCCACA ATGTAGGCCATGAGGTCCAC TGATGGCAACAATCTCCACT

81 87 107 107 148 107 112 104 92 103 92 82 95 112

75 70 90 90 125 100 105 105 105 105 90 95 95 105

Note: Prefixes on the gene name refer to the species: m, mouse; r, rat. Anp, atrial natriuretic peptide; Bnp, brain/B-type natriuretic peptide; Ae3, anion exchanger 3; Nhe1, sodium proton exchanger 1; Gapdh, glyceraldehyde 3-phosphate dehydrogenase.

rection was applied to the Ct values of the other proteins. The anti-log2 of the difference between the sample Ct values and control Ct values represented the relative transcript abundance in the samples compared with the control. The primers (Table 1) were generated using Primer3 (available from http://frodo.wi.mit.edu/primer3/). Statistics Data are expressed as means ⫾ SE. Unpaired t tests were used to determine the statistical difference between treatment groups. P ⬍ 0.05 was considered to be significant.

Results Adenovirus-mediated CAII gene transfer into neonatal rat ventricular myocytes To examine the role of CAII in cardiomyocyte hypertrophy, we studied the effect of CAII over-expression. We constructed recombinant adenoviruses that encode WT CAII (AdCAIIWT) or catalytically inactive CAII-V143Y (AdCAII-V143Y), both of which also express GFP as a marker of virally transduced cells. To determine the level of adenovirus required to produce an increase in CAII expression, we transduced cultured neonatal rat ventricular myocytes with increasing multiplicities of infection (MOIs) of AdCAII-WT or AdCAIIV143Y. MOI is the ratio of virus particles, or plaque forming units, per cell. Cardiomyocytes were incubated with adenoviral constructs at a range of MOIs for 48 h, and cell lysates were analysed on immunoblots. Increased CAII expression above endogenous levels was evident in cardiomyocytes transduced with either AdCAII-WT or AdCAII-V143Y at MOIs of 40, 80, 120, and 160 (Fig. 1a). We decided to use an MOI of 80 in subsequent experiments, since at this MOI CAII expression is 12-fold higher compared with endogenous CAII (Fig. 1b), and there is a lower probability of side effects from viral overload caused from using higher viral MOIs. We also had to ensure that the adenoviruses induced expression of the same amount of GFP to rule out effects arising from differences in GFP expression. The same immunoblots used to examine CAII expression were stripped and re-probed

Fig. 1. Adenovirus-mediated CAII over-expression in neonatal rat ventricular myocytes. Cellular lysates were prepared from neonatal rat ventricular myocytes, which were untreated (0), or transduced with increasing multiplicities of infection (MOI 40, 80, 120, 160) of adenovirus encoding wild-type (WT) carbonic anhydrase II (AdCAII-WT), or catalytically inactive mutant carbonic anhydrase II (AdCAII-V143Y). (a) Immunoblots of the cardiomyocyte lysates were probed with antibodies against CAII and ␤-actin. (b) Expression levels of CAII, normalized to levels of ␤-actin, were quantified by densitometry. Values are means ⫾ SE, n ⫽ 3.

a

MOI AdCAII-WT

MOI AdCAII-V143Y

kDa 0 40 80 120 160 37 50

kDa 0 40 80 120 160 37 CAII

CAII

ß-actin 50

ß-actin

b

CAII expression Normalized to β-Actin Expression

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

Table 1. Polymerase chain reaction (PCR) analysis of transcript abundance.

AdCAII-WT AdCAII-V143Y

2.4 2.0 1.6 1.2 0.8 0.4 0

0

40

80

120

160

Multiplicity of Infection Published by NRC Research Press

Brown et al.

Effect of CAII over-expression on cardiomyocyte cell surface area The heart increases in size under prohypertrophic conditions, which is the result of an increase in cardiomyocyte size rather than number. Cardiomyocyte surface area is therefore a key marker of hypertrophic growth. To determine whether CAII over-expression affects cell surface area, cultured neonatal rat ventricular myocytes were transduced with AdGFP, AdCAIIWT, or AdCAII-V143Y 18 h after plating, and treated with phenylephrine 24 h later. Images of the myocytes were taken 48 h after adenoviral transduction, and cell surface areas were measured (Fig. 2a). Over-expression of WT CAII or CAII-V143Y in untreated cardiomyocytes did not induce any change in cell surface area compared with control (AdGFP) myocytes (Fig. 2b). Treatment with the prohypertrophic agonist, phenylephrine, however, resulted in a significant increase in cell surface area in control (AdGFP) myocytes and in myocytes over-expressing WT CAII (AdCAII-WT). In contrast, over-expression of CAIIV143Y (AdCAII-V143Y) suppressed the effect of phenylephrine on cell surface area. Effect of CAII over-expression on protein synthesis To accommodate the growth associated with cardiomyocyte hypertrophy, cardiomyocytes increase their protein and RNA content (Bogoyevitch et al. 1993). As with the cell surface data, over-expression of WT or CAII-V143Y did not induce any change in protein synthesis compared with control (AdGFP) myocytes (Fig. 3). Treatment with phenylephrine, however, induced a significant increase in protein synthesis in control (AdGFP) myocytes and myocytes over-expressing WT CAII (AdCAII-WT). In contrast, protein synthesis in cardiomyocytes over-expressing CAII-V143Y (AdCAII-V143Y) in the presence of phenylephrine was not significantly different from control (AdGFP) myocytes without phenylephrine (P ⫽ 0.0695). Effect of CAII over-expression on hypertrophic gene expression During hypertrophic growth, the heart reactivates its fetal gene program and upregulates expression of a number of genes, including ANP and B-type natriuretic peptide (BNP) (Barry et al. 2008). qRT-PCR was specific and amplified the appropriate amplicon, on the basis of the agreement between expected and observed size of PCR products analysed on agarose gels and the presence of only a single PCR product for each primer pair (Table 1 and Fig. S11). ANP and BNP transcript abundances were not significantly different in cardiomyocytes overexpressing WT or catalytically inactive CAII from control (AdGFP) myocytes (Figs. 4a and 4b). Conversely, phenylephrine induced a 15-fold increase in transcript abundance of both natriuretic peptides in all 3 groups. None of the phenylephrine-treated groups were significantly different from one another. 1

Fig. 2. Effect of phenylephrine (PE) on the cell surface area of cultured neonatal rat ventricular myocytes. Cardiomyocytes were transduced with the indicated adenovirus (adenoviruses encode GFP alone (AdGFP), CAII wild-type (WT) (AdCAII-WT), and CAII V143Y mutant (AdCAII-V143Y)) after 18 h of culture. Cells were treated with 10 ␮mol/L of PE or vehicle (control) 24 h later. (a) Images of cultured rat neonatal myocytes 24 h after incubation with PE. Scale bars represent 50 ␮m. Black arrows indicate examples of cells used for cell surface area measurements. (b) Cell surface areas were measured and represented as % relative to untreated AdGFP. Black bars represent untreated groups, and blue bars (grey in print) represent PE-treated groups. Values are means ⫾ SE, n ⫽ 4 –5 (total cells analysed in each group, 160 –200). *, P ⬍ 0.05, compared with control AdGFP; †, P ⬍ 0.05, compared with AdGFP treated with PE.

a

AdCAII-WT

AdGFP

AdGFP

AdCAII-V143Y

AdCAII-V143Y

AdCAII-WT + PE

b Cell Surface Area (% Relative to AdGFP)

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

with a rabbit polyclonal anti-GFP antibody (data not shown). Cells transduced with AdGFP at an MOI of 12 expressed the same level of GFP as AdCAII-WT and AdCAII-V143Y at MOIs of 80. AdGFP at an MOI of 12 was therefore used in subsequent experiments as a control.

1603

*

120

*

Control PE (10 µmol/L)

†

100 80 60 40 20 0

Ad

Ad

GF

P

Ad

CA

CA

II-W

T

II-V

14 3

Y

Since CAII functionally and physically interacts with NHE1 and AE3, we examined the abundances of AE3 and NHE1 mRNA by real-time qRT-PCR. AE3 transcript abundance in cardiomyocytes over-expressing WT CAII or CAII-V143Y was not significantly different from control (AdGFP) myo-

Supplementary data are available with the article through the journal Web site at http://www.nrcreseaerchpress.com/doi/suppl/10.1139/y2012-142. Published by NRC Research Press

1604

Can. J. Physiol. Pharmacol. Vol. 90, 2012

[3H]Phenylalanine Incorporation (%DPM relative to AdGFP)

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

Fig. 3. Effect of phenylephrine (PE) on the rate of protein synthesis in cultured neonatal rat ventricular myocytes. Cells were transduced with the indicated adenovirus after 18 h of culture. Cells were treated with 10 ␮mol/L of PE or vehicle (control) 24 h later and incubated with [3H]phenylalanine (1 ␮Ci/mL of medium). After 24 h cells were lysed and the proteins precipitated using TCA. Incorporated [3H] was quantified and expressed as % relative to untreated AdGFP. Values are means ⫾ SE, n ⫽ 5. *, P ⬍ 0.05, compared with control AdGFP.

Control PE (10 µmol/L)

200

*

175

*

150 125 100 75 50 25

systole and diastole, as well as a decreased left ventricular internal diameter. No significant alteration of systolic function was evident in Car2 mice. Echocardiographic parameters were measured to assess diastolic function. Blood flow velocities through the mitral valve were measured during left ventricular diastole (early filling phase – E wave) and left atrial systole (atrial kick – A wave). A lower E/A ratio would suggest that more blood is entering the ventricle from the atrial kick than during ventricular relaxation, and therefore diastolic dysfunction. Mitral valve tissue motion during the E and A waves was measured using tissue Doppler echocardiography. A lower E/E= ratio is indicative of decreased blood flow into the left ventricle during diastole (E) with increased mitral valve motion (E=), which implies diastolic dysfunction. The isovolumic relaxation time (IVRT) is the time from the closure of the aortic valve to the opening of the mitral valve, and the initiation of left ventricular filling. An increased IVRT would reflect prolonged myocardial relaxation, and therefore diastolic dysfunction. The E/A ratio and IVRT in Car2 mice were not significantly different from WT mice, but the E/E= ratio of Car2 mice was significantly lower (Table 3). These data suggest that diastolic dysfunction in Car2 mice is unlikely, considering that 2 of the 3 parameters measured were not significantly different from WT mice.

0

Ad

Ad

GF

P

Ad

CA

II-W

CA

T

II-V

14

3Y

cytes (Fig. 4c). Phenylephrine, however, induced a significant decrease in AE3 transcript abundance in control (AdGFP) myocytes and myocytes over-expressing CAII-V143Y. NHE1 transcript abundance was not affected by CAII overexpression or the presence of phenylephrine (Fig. 4d). Baseline cardiovascular parameters of WT and Car2 mice As a second approach to examine the role of CAII in the hypertrophic cascade, we examined homozygous Car2 mice. These mice have a disruption in their caii gene and do not express CAII protein (Lewis et al. 1988). Throughout the manuscript Car2 mice refers to genotyped mice homozygous for the Car2 allele of caii. Cardiovascular parameters of WT and Car2 mice were measured prior to in vitro experiments to ascertain any differences between the 2 lines. No significant differences in heart weight, body weight, heart rate, and blood pressure were observed between 1–3 month old male WT and Car2 mice (Table 2). The Car2 mice had a significant increase in heart weight to body weight ratio compared with WT mice. In vivo cardiac function parameters of Car2 mice Echocardiographic assessments of WT and Car2 mice were performed to measure their systolic and diastolic function. Ejection fraction and fractional shortening were both increased in Car2 mice, although not significantly (Table 3). Car2 mice also exhibited a nonsignificant increase in intraventricular septal and left ventricular posterior wall thickness during both

Effect of phenylephrine on cell surface area of cultured Car2 cardiomyocytes To assess whether hypertrophy occurs in the absence of CAII, adult mouse ventricular myocytes were cultured from WT and Car2 mice and treated with 10 ␮mol/L of phenylephrine or vehicle 18 h after plating. Cell surface area increased significantly, by 15%, with the addition of phenylephrine in myocytes cultured from WT mice (Fig. 5a,b), which is comparable to previous studies (Alvarez et al. 2007b). In contrast, myocytes cultured from Car2 mice did not show a significant increase in cell surface area in response to phenylephrine. Compared with vehicle-treated myocytes from WT mice, cell surface area of both vehicle and phenylephrinetreated myocytes was increased in the Car2 mice. Effect of phenylephrine on AE3 and NHE1 gene expression in cultured Car2 cardiomyocytes Real-time qRT-PCR was used to measure expression of AE3 and NHE1 transcript abundance. AE3 transcript abundance was significantly higher in cardiomyocytes from Car2 mice compared with cardiomyocytes from WT mice (Fig. 6a). Furthermore, phenylephrine induced a significant increase in AE3 transcript abundance, which was even larger in Car2 mice (Fig. 6a). Unlike AE3, NHE1 transcript abundance was not affected by CAII ablation or the presence of phenylephrine (Fig. 6b).

Discussion The increasing health and financial burden of heart failure provides impetus to identify new therapeutic strategies to intervene in the cascade of hypertrophic cardiomyocyte growth. Treatment of cardiomyocytes with carbonic anhydrase inhibitors showed promise in preventing hypertrophic growth (Alvarez et al. 2007b). While encouraging, pharmacological investigations Published by NRC Research Press

Brown et al.

1605

21

Control PE (10 µmol/L)

ANP *

18

* *

15

12 9 6 3 0 AdGFP

AdCAII-WT AdCAII-V143Y

d 1.6

Control PE (10 µmol/L)

AE3fl

1.4 1.2 1.0

*

0.8

*

0.6 0.4 0.2

AdGFP

AdCAII-WT AdCAII-V143Y

could not establish the target for ETZ’s anti-hypertrophic effects. Here we examined the possibility that cytosolic CAII has a prohypertrophic role and is a target for anti-hypertrophic therapies. CAII over-expression and genetic ablation both support a role for CAII in the cardiomyocyte hypertrophic growth cascade. CAII has now been identified as a promising point for intervention in the cardiac hypertrophic cascade. CAII is required for phenylephrine-induced cardiomyocyte hypertrophy Evidence from adenovirally transduced cardiomyocytes and CAII-deficient mice leads to the conclusion that CAII promotes cardiomyocyte hypertrophy. Over-expression of cata-

Relative BNP Transcript Abundance (Corrected for GAPDH)

b

Relative NHE1 Transcript Abundance (Corrected for GAPDH)

c

Relative AE3 Transcript Abundance (Corrected for GAPDH)

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

a

Relative ANP Transcript Abundance (Corrected for GAPDH)

Fig. 4. Effect of phenylephrine (PE) on hypertrophic marker and transporter transcript abundance in cultured neonatal rat ventricular myocytes. mRNA was harvested from neonatal rat ventricular myocytes transduced with adenoviruses AdGFP, AdCAII-WT, and AdCAII-V143Y, and treated with PE or vehicle (control). Real-time qRT-PCR analysis of (a) atrial natriuretic peptide (ANP), (b) B-type natriuretic peptide (BNP), (c) AE3, and (d) NHE1 mRNA expression in cultured rat neonatal myocytes. Data were corrected for variation using GAPDH expression and results are expressed as transcript expression normalized to GAPDH and relative to control AdGFP. Values are means ⫾ SE, n ⫽ 3 for each treatment group. *. P ⬍ 0.05, compared with control AdGFP.

18

BNP *

15

Control PE (10 µmol/L) *

*

12 9 6 3

0 AdGFP

2.4

NHE1

AdCAII-WT AdCAII-V143Y

Control PE (10 µmol/L)

2.1 1.8 1.5 1.2 0.9 0.6 0.3 0 AdGFP

AdCAII-WT AdCAII-V143Y

lytically inactive CAII-V143Y suppressed the hypertrophic growth response to phenylephrine. This finding parallels results in HEK293 cells, where CAII-V143Y expression suppressed the transport activity of AE3 and NHE1 (Li et al. 2002; Sterling et al. 2001). This observation is explained by a dominant negative effect of CAII-V143Y. Full transport activity of NHE1 and AE3 requires functional CAII localized close to their ion transport sites (Li et al. 2002; Sterling et al. 2001). Inactive CAII-V143Y, expressed at 12-fold higher levels than endogenous CAII, displaces WT CAII from its binding site on NHE1 and AE3. Suppression of the phenylephrine-induced hypertrophic response by CAII-V143Y provides support for the Published by NRC Research Press

1606

Can. J. Physiol. Pharmacol. Vol. 90, 2012

Parameter

WT

Car2

HW, g BW, g HW/ BW Heart rate, beats·min–1 Systolic blood pressure, mm Hg Diastolic blood pressure, mm Hg

0.18⫾0.02 34⫾5 0.0052⫾0.0004 490⫾30 132⫾2

0.19⫾0.01 26⫾2 0.0073⫾0.0004* 600⫾100 135⫾5

73⫾4

81⫾7

Note: Values are expressed as means ⫾ SE (n ⫽ 6 per group), *, P ⬍ 0.05. HW, heart weight; BW, body weight.

Fig. 5. Effect of phenylephrine (PE) on the cell surface area of cultured adult mouse ventricular myocytes from wild-type (WT) and Car2 mice. Cells were treated after 18 h of culture with 10 ␮mol/L of PE or vehicle (control). (a) Images of cultured adult mouse myocytes from WT and Car2 mice 24 h after treatment. Scale bars are 50 ␮m. Black arrows indicate examples of cells used for cell surface area measurements. (b) Cell surface areas were measured and represented as % relative to WT control. Black bars represent untreated groups and blue bars (grey in print) represent PE-treated groups. Values are means ⫾ SE, n ⫽ 3 trials (total cells analyzed in each group, 120 –180). *, P ⬍ 0.05, compared with WT control.

a

Table 3. Echocardiographic analysis of wild-type (WT) and Car2 mice. Parameter

WT

Car2

Ejection fraction, % Fractional shortening, % Left ventricular mass, mg IVSd, mm LVIDd, mm LVPWd, mm IVSs, mm LVIDs, mm LVPWs, mm MV E/A ratio E/E= IVRT, ms

53⫾4 27⫾3 85⫾7 0.74⫾0.03 4.0⫾0.1 0.73⫾0.03 1.0⫾0.1 2.9⫾0.2 1.0⫾0.1 1.6⫾0.1 35⫾4 17⫾1

62⫾4 33⫾3 92⫾7 0.82⫾0.05 3.8⫾0.1 0.84⫾0.05 1.2⫾0.1 2.6⫾0.2 1.2⫾0.1 1.5⫾0.1 25⫾1* 18⫾1

Note: Values are expressed as means ⫾ SE (n ⫽ 6 per group). IVSd, diastolic intraventricularseptal wall thickness; LVIDd, diastolic left ventricular internal diameter; LVPWd, diastolic left ventricular posterior wall thickness; IVSs, systolic intraventricularseptal wall thickness; LVIDs, systolic left ventricular internal diameter; LVPWs, systolic left ventricular posterior wall thickness; MV E/A, ratio of peak E wave mitral valve velocity to peak A wave mitral valve velocity; E/E=, ratio of peak E wave mitral valve velocity to E wave mitral valve tissue motion; IVRT, isovolumic relaxation time. *Significantly different between WT and Car2 mice (P ⬍ 0.05).

role of CAII in cardiomyocyte hypertrophy. The lack of effect upon WT CAII over-expression may arise from sufficient endogenous CAII expression to active NHE1 and AE3 maximally. This interpretation is supported in studies of NHE1 and AE3, expressed in HEK293 cells, in which over-expression of WT CAII did not affect the transport activity of the 2 transporters (Li et al. 2002; Sterling et al. 2001). Overexpression of CAII-V143Y clearly suppressed the phenylephrine-induced increase of cell surface area (Fig. 2), but the effect on the rate of protein synthesis was much less pronounced (Fig. 3). Indeed, while there is no statistical significance between the rate of protein synthesis in the absence and presence of phenylephrine in cardiomyocytes expressing CAII-V143Y, there is a trend toward a difference. We are not sure why there is a divergence in the effects of CAII-V143Y as measured by cell size and rate of protein synthesis, but

WT

Car2

WT+ PE

Car2 + PE

b Cell Surface Area (% Relative to Control)

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

Table 2. Baseline cardiovascular parameters of wild-type (WT) and Car2 mice.

Control PE (10 µmol/L)

140 *

120

*

*

100 80 60 40 20 0

WT

Car2

we consider cell size to be the most important indicator of hypertrophy. Car2 mice provided further support for the role of CAII in cardiomyocyte hypertrophy. The lack of Car2 cardiomyocyte sensitivity to prohypertrophic phenylephrine stimulation was illustrated in measurements of cell surface area. Untreated, Published by NRC Research Press

Brown et al.

1607

Relative AE3fl Transcript Abundance (Corrected for GAPDH)

a

4.2

Control PE (10 µmol/L)

AE3

3.6

*

3.0 2.4

*

1.8

*

1.2 0.6 0 WT

Car2

b Relative NHE1 Transcript Abundance (Corrected for GAPDH)

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

Fig. 6. Effect of phenylephrine on transporter transcript expression in cultured adult mouse ventricular myocytes from wild-type (WT) and Car2 mice. Real-time qRT-PCR analysis of (a) AE3, and (b) NHE1 mRNA expression in cultured adult mouse myocytes treated with phenylephrine (PE) or vehicle (control). Data were corrected for variation using GAPDH expression and results are expressed as transcript expression normalized to GAPDH and relative to WT control. Values are means ⫾ SE, n ⫽ 3–5 for each treatment group. *, P ⬍ 0.05, compared with WT control.

NHE1 1.5

Control PE (10 µmol/L)

1.2 0.9 0.6 0.3 0 WT

Car2

Car2 cardiomyocytes are larger than WT cardiomyocytes, but WT cardiomyocytes increased in cell surface area upon treatment with phenylephrine while Car2 cardiomyocytes did not. Together the cell surface area data in both the adenoviral CAII over-expression model and Car2 mice support a key role of CAII in the hypertrophic cascade. Previously the possibility was considered that the carbonic anhydrase inhibitor, ETZ, attenuates hypertrophy by acting through a target other than CAII (Alvarez et al. 2007b). Overall, our data support CAII as the mediator of ETZ’s anti-hypertrophic effects, strengthening the case to consider CAII as a pharmacological target in treatment of pathological cardiac hypertrophy. Hypertrophic gene expression Changes of transcript abundance in hypertrophicallystimulated cardiomyocytes provided more nuanced support for

the role of CAII in cardiac hypertrophy. Over-expression of WT CAII in neonatal rat ventricular myocytes had no effect on hypertrophic markers (ANP, BNP), which suggests that NHE1 and AE3 are fully activated by endogenous CAII. Although over-expression of CAII-V143Y had significant effects on cardiac growth following treatment with phenylephrine, this was not reflected in expression of hypertrophic markers. Other investigators also have found that inhibition of cardiac growth was not accompanied by a reduction in natriuretic peptide mRNA transcript levels, or the fetal gene program was reactivated without any increase in cardiac growth (Antos et al. 2002; Boluyt et al. 1997; Bueno et al. 2002; Petrich et al. 2004; Shioi et al. 2000). Natriuretic peptide expression may be a more sensitive marker of hypertrophy than are cell surface area and protein synthesis. While over-expression of CAIIV143Y attenuated hypertrophic growth in the time frame of our experiments, natriuretic peptide expression may not respond as rapidly. Phenotype of Car2 mice This is the first analysis of which we are aware of cardiac function in caii null mice. Combined analysis of HW/BW ratios, left ventricular mass, echocardiographic measurements of ventricular wall dimensions, and cell surface areas suggest that the hearts of Car2 mice exhibit baseline hypertrophy. The finding that this hypertrophy is not accompanied by decreased cardiac function is inconsistent with pathophysiological hypertrophy. Instead this hypertrophy may be physiological, as found in trained athletic hearts (Weeks and McMullen 2011). While the Car2 mice did not grow hypertrophically in response to phenylephrine, we cannot rule out the possibility that the ventricular hypertrophy in these mice prevented a hypertrophic response to phenylephrine. The phenotype of the Car2 mice means that effects of CAII ablation on cardiac hypertrophy need to be interpreted with some caution. Indeed, Car2 mice manifest distal renal tubular acidosis (Lewis et al. 1988) and mild respiratory acidosis (Lien and Lai 1998). Moreover, the requirement for CAII in osteoclast-mediated bone reabsorption leads to calcium deposition in tissues in CAII-deficient mice and humans (Sly et al. 1983; Spicer et al. 1989). Car2 mice have noted calcification of muscle and vasculature (Spicer et al. 1989), which may explain the altered cardiac phenotype that we observed in these mice. CAII in the hypertrophic transport metabolon Our data provide support for a role of CAII in promotion of cardiomyocyte hypertrophic growth. We propose that this occurs through the contribution of CAII to “the hypertrophic transport metabolon” formed by CAII, AE3, and NHE1 (Fig. 7). CAII physically interacts with both AE3 and NHE1 and to promote their ion transport functions, but there is no evidence for an AE3/NHE1 CAII complex. We therefore suggest that the hypertrophic transport metabolon represents a pathological co-activation of these proteins that together promotes cardiomyocyte hypertrophy. PKC activation (downstream of hypertrophic agonists, like phenylephrine) stimulates both NHE1 and AE3 (Alvarez et al. 2001; Moor et al. 2001). If coactivated, the respective cytosolic alkalinizing and acidifying functions of these transporters neutralize each other, with the effect of net cell loading with NaCl. In turn the elevated Published by NRC Research Press

1608

Can. J. Physiol. Pharmacol. Vol. 90, 2012

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

Fig. 7. Proposed explanation for prohypertrophic effects of CAII: the hypertrophic transport metabolon. (1) In cardiomyocytes prohypertrophic agonists, including phenylephrine (PE), angiotensin II (AngII), and endothelin I (ET) act upon G-protein-coupled receptors (GPCR). (2) In turn, protein kinase C (PKC) is activated. PKC directly stimulates AE3 and indirectly stimulates NHE1, via the mitogenactivated protein kinase (MAPK) pathway. (3) CAII provides substrate HCO3– and H⫹ for efflux, respectively, by AE3 and NHE1. Combined activation of AE3 and NHE1 accumulates Na⫹ cytosolically, without effect on pH (Cingolani and Camilion De Hurtado 2002; Cingolani and Ennis 2007; Pérez et al. 1995, 2001). (4) This rise in cytosolic Na⫹ compromises or reverses the ability of the Na⫹/Ca2⫹ exchanger (NCX) to efflux Ca2⫹. (5) Elevated Ca2⫹ is prohypertrophic, acting through the calcineurin–nuclear factor of activated T cells (NFAT) transcriptional signalling pathway.

HCO HC CO3-

ClCO2 HCO 3 + H+

Nucleus

cytosolic Na⫹ level decreases the Ca2⫹ efflux efficacy of the plasma membrane Na⫹/Ca2⫹ exchanger, NCX (Pérez et al. 2001). Cytosolic Ca2⫹ then acts as the central signal for hypertrophic growth in cardiomyocytes. There are suggestions of functional linkages between these proteins. In Car2 mice, expression of AE3 was increased in comparison to WT mice. This suggests that the caii null Car2 mice compensate for loss of CAII by increased expression of AE3. Similarly, CAII expression was upregulated in retinas from ae3 null mice (Alvarez et al. 2007a). Together this suggests that AE3 and CAII work in a linked pathway and that cells compensate for loss of 1 protein by increased expression of the other.

Conclusions Earlier investigations suggested that carbonic anhydrase inhibition could be protective against hypertrophic cardiomyocyte growth, but the pharmacological target was uncertain. Here we explored the role of CAII in progression of cardiomyocyte hypertrophy, using adenoviral over-expression of

CAII and CAII-deficient mice. Cardiomyocytes overexpressing CAII-V143Y did not manifest increased cell surface area or protein synthesis in response to hypertrophic stimuli, which suggests that catalytically inactive CAII behaves in a dominant negative fashion to suppress phenylephrine-induced hypertrophy. Car2 mice were protected from phenylephrineinduced increases in cell surface area. Overall, these findings support a role of CAII in promoting cardiomyocyte hypertrophy. CAII stands as a promising target for therapeutic intervention in the hypertrophic cascade that underlies heart failure.

Acknowledgements J.R.C. is a Scientist and J.R.B.D. is a Senior Scholar of the Alberta Heritage Foundation for Medical Research (AHFMR). B.F.B. was supported by an AHFMR Studentship. The Heart and Stroke Foundation of Alberta and the Canadian Institutes of Health Research provided operating support for this work. We thank Daniel Sowah for constructing the adenoviruses. We thank Dr. Bernardo Alvarez and Pamela Bonar for their comments on Published by NRC Research Press

Brown et al.

the manuscript. We also thank Amy Barr, Jamie Boisvenu, and Carrie Soltys for their valuable advice and assistance.

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

References Alvarez, B.V., Fujinaga, J., and Casey, J.R. 2001. Molecular basis for angiotensin II-induced increase of chloride/bicarbonate exchange in the myocardium. Circ. Res. 89(12): 1246 –1253. doi:10.1161/ hh2401.101907. PMID:11739292. Alvarez, B.V., Kieller, D.M., Quon, A.L., Markovich, D., and Casey, J.R. 2004. Slc26a6: A cardiac chloride/hydroxyl exchanger and predominant chloride– bicarbonate exchanger of the mouse heart. J. Physiol. 561(3): 721–734. doi:10.1113/jphysiol.2004.077339. PMID:15498800. Alvarez, B.V., Gilmour, G., Mema, S.C., Martin, B.T., Shull, G.E., Casey, J.R., and Sauvé, Y. 2007a. Blindness Caused by Deficiency in AE3 Chloride/Bicarbonate Exchanger. PLoS ONE, 2(9): e839. doi:10.1371/journal.pone.0000839. PMID:17786210. Alvarez, B.V., Johnson, D.E., Sowah, D., Soliman, D., Light, P., Xia, Y., et al. 2007b. Carbonic anhydrase inhibition prevents and reverts cardiomyocyte hypertrophy. J. Physiol. 579(1): 127–145. doi:10.1113/jphysiol.2006.123638. PMID:17124262. Antos, C.L., McKinsey, T., Frey, N., Kutschke, W., McAnally, J., Shelton, J.M., et al. 2002. Activated glycogen synthase-3 beta suppresses cardiac hypertrophy in vivo. Proc. Natl. Acad. Sci. U.S.A. 99(2): 907–912. doi:10.1073/pnas.231619298. PMID: 11782539. Barry, S.P., Davidson, S.M., and Townsend, P.A. 2008. Molecular regulation of cardiac hypertrophy. Int. J. Biochem. Cell Biol. 40(10): 2023–2039. doi:10.1016/j.biocel.2008.02.020. PMID: 18407781. Bogoyevitch, M.A., Fuller, S.J., and Sugden, P.H. 1993. cAMP and protein synthesis in isolated adult rat heart preparations. Am. J. Physiol. 265(5): C1247–C1257. PMID:7694491. Boluyt, M.O., Zheng, J.S., Younes, A., Long, X., O’Neill, L., Silverman, H., et al. 1997. Rapamycin inhibits alpha 1-adrenergic receptor-stimulated cardiac myocyte hypertrophy but not activation of hypertrophy-associated genes. Evidence for involvement of p70 S6 kinase. Circ. Res. 81(2): 176 –186. doi:10.1161/ 01.RES.81.2.176. PMID:9242178. Bueno, O.F., Wilkins, B.J., Tymitz, K.M., Glascock, B.J., Kimball, T.F., Lorenz, J.N., and Molkentin, J.D. 2002. Impaired cardiac hypertrophic response in Calcineurin A␤ -deficient mice. Proc. Natl. Acad. Sci. U.S.A. 99(7): 4586 – 4591. doi:10.1073/ pnas.072647999. PMID:11904392. Cingolani, H.E., and Camilion De Hurtado, M.C. 2002. Na⫹-H⫹ exchanger inhibition: a new antihypertrophic tool. Circ. Res. 90(7): 751–753. doi:10.1161/01.RES.0000016836.24179.AE. PMID:11964365. Cingolani, H.E., and Ennis, I.L. 2007. Sodium-hydrogen exchanger, cardiac overload, and myocardial hypertrophy. Circulation, 115(9): 1090 –1100. doi:10.1161/CIRCULATIONAHA. 106.626929. PMID:17339567. Cordat, E., and Casey, J.R. 2009. Bicarbonate transport in cell physiology and disease. Biochem. J. 417(2): 423– 439. doi:10.1042/ BJ20081634. PMID:19099540. Counillon, L., and Pouyssegur, J. 2000. The expanding family of eucaryotic Na⫹/H⫹ exchangers. J. Biol. Chem. 275(1): 1– 4. doi: 10.1074/jbc.275.1.1. PMID:10617577. Ennis, I.L., Escudero, E.M., Console, G.M., Camihort, G., Dumm, C.G., Seidler, R.W., et al. 2003. Regression of isoproterenol-induced cardiac hypertrophy by Na⫹/H⫹ exchanger inhibition. Hypertension,

1609 41(6): 1324 –1329. doi:10.1161/01.HYP.0000071180.12012.6E. PMID:12732584. Erhardt, L.R. 1999. GUARD During Ischemia Against Necrosis (GUARDIAN) trial in acute coronary syndromes. Am. J. Cardiol. 83(10 Suppl. 1): 23–25. doi:10.1016/S0002-9149(99)00216-7. PMID:10482177. Fliegel, L. 2008. Molecular biology of the myocardial Na⫹/H⫹ exchanger. J. Mol. Cell. Cardiol. 44(2): 228 –237. doi:10.1016/ j.yjmcc.2007.11.016. PMID:18191941. Fujikawa-Adachi, K., Nishimori, I., Taguchi, T., and Onishi, S. 1999. Human carbonic anhydrase XIV (CA14): cDNA cloning, mRNA expression, and mapping to chromosome 1. Genomics, 61(1): 74 – 81. doi:10.1006/geno.1999.5938. PMID:10512682. Hayasaki-Kajiwara, Y., Kitano, Y., Iwasaki, T., Shimamura, T., Naya, N., Iwaki, K., and Nakajima, M. 1999. Na⫹ influx via Na⫹/H⫹ exchange activates protein kinase C isozymes delta and epsilon in cultured neonatal rat cardiac myocytes. J. Mol. Cell. Cardiol. 31(8): 1559 –1572. doi:10.1006/jmcc.1999.0993. PMID: 10423353. He, T.C., Zhou, S., da Costa, L.T., Yu, J., Kinzler, K.W., and Vogelstein, B. 1998. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. U.S.A. 95(5): 2509 – 2514. doi:10.1073/pnas.95.5.2509. PMID:9482916. Karmazyn, M. 2000. Pharmacology and clinical assessment of cariporide for the treatment coronary artery diseases. Expert Opin. Investig. Drugs, 9(5): 1099 –1108. doi:10.1517/13543784.9.5. 1099. PMID:11060730. Karmazyn, M., Liu, Q., Gan, X.T., Brix, B.J., and Fliegel, L. 2003. Aldosterone increases NHE-1 expression and induces NHE-1dependent hypertrophy in neonatal rat ventricular myocytes. Hypertension, 42(6): 1171–1176. doi:10.1161/01.HYP.0000102863. 23854.0B. PMID:14610099. Kovacic, S., Soltys, C.-L.M., Barr, A.J., Shiojima, I., Walsh, K., and Dyck, J.R.B. 2003. Akt activity negatively regulates phosphorylation of AMP-activated protein kinase in the heart. J. Biol. Chem. 278(41): 39422–39427. doi:10.1074/jbc.M305371200. PMID:12890675. Kusumoto, K., Haist, J.V., and Karmazyn, M. 2001. Na⫹/H⫹ exchange inhibition reduces hypertrophy and heart failure after myocardial infarction in rats. Am. J. Physiol. Heart Circ. Physiol. 280(2): H738 –H745. PMID:11158973. Lewis, S.E., Erickson, R.P., Barnett, L.B., Venta, P.J., and Tashian, R.E. 1988. N-ethyl-N-nitrosourea-induced null mutation at the mouse Car-2 locus: an animal model for human carbonic anhydrase II deficiency syndrome. Proc. Natl. Acad. Sci. U.S.A. 85(6): 1962–1966. doi:10.1073/pnas.85.6.1962. PMID:3126501. Li, X., Alvarez, B., Casey, J.R., Reithmeier, R.A.F., and Fliegel, L. 2002. Carbonic Anhydrase II Binds to and Enhances Activity of the Na⫹/H⫹ Exchanger. J. Biol. Chem. 277(39): 36085–36091. doi:10.1074/jbc.M111952200. PMID:12138085. Lien, Y.H., and Lai, L.W. 1998. Respiratory acidosis in carbonic anhydrase II-deficient mice. Am. J. Physiol. 274(2): L301–L304. PMID:9486217. Link, A.J., and Labaer, J. 2011. Trichloroacetic Acid (TCA) Precipitation of Proteins. Cold Spring Harb. Protoc. 2011(8): 993–994. doi:10.1101/pdb.prot5651. PMID:21807853. Molkentin, J.D., Lu, J.R., Antos, C.L., Markham, B., Richardson, J., Robbins, J., et al. 1998. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell, 93(2): 215–228. doi: 10.1016/S0092-8674(00)81573-1. PMID:9568714. Moor, A.N., and Fliegel, L. 1999. Protein kinase-mediated regulation Published by NRC Research Press

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Alberta on 01/19/15 For personal use only.

1610 of the Na⫹/H⫹ exchanger in the rat myocardium by mitogenactivated protein kinase-dependent pathways. J. Biol. Chem. 274(33): 22985–22992. doi:10.1074/jbc.274.33.22985. PMID: 10438464. Moor, A.N., Gan, X.T., Karmazyn, M., and Fliegel, L. 2001. Activation of Na⫹/H⫹ exchanger-directed protein kinases in the ischemic and ischemic-reperfused rat myocardium. J. Biol. Chem. 276(19): 16113–16122. doi:10.1074/jbc.M100519200. PMID: 11279085. Okuyama, T., Sato, S., Zhu, X.L., Waheed, A., and Sly, W.S. 1992. Human carbonic anhydrase IV: cDNA cloning, sequence comparison, and expression in COS cell membranes. Proc. Natl. Acad. Sci. U.S.A. 89(4): 1315–1319. doi:10.1073/pnas.89.4.1315. PMID:1311094. Pérez, N.G., Alvarez, B.V., Camilión de Hurtado, M.C., and Cingolani, H.E. 1995. pHi regulation in myocardium of the spontaneously hypertensive rat. Compensated enhanced activity of the Na⫹-H⫹ exchanger. Circ. Res. 77(6): 1192–1200. doi:10.1161/01.RES. 77.6.1192. PMID:7586232. Pérez, N.G., de Hurtado, M.C., and Cingolani, H.E. 2001. Reverse mode of the Na⫹-Ca2⫹ exchange after myocardial stretch: underlying mechanism of the slow force response. Circ. Res. 88(4): 376 –382. doi:10.1161/01.RES.88.4.376. PMID:11230103. Petrich, B.G., Eloff, B.C., Lerner, D.L., Kovacs, A., Saffitz, J.E., Rosenbaum, D.S., and Wang, Y. 2004. Targeted activation of c-Jun N-terminal kinase in vivo induces restrictive cardiomyopathy and conduction defects. J. Biol. Chem. 279(15): 15330 –15338. doi:10.1074/jbc.M314142200. PMID:14742426. Sambrano, G.R., Fraser, I., Han, H., Ni, Y., O’Connell, T., Yan, Z., and Stull, J.T. 2002. Navigating the signalling network in mouse cardiac myocytes. Nature, 420(6916): 712–714. doi:10.1038/nature01306. PMID:12478303. Scheibe, R.J., Gros, G., Parkkila, S., Waheed, A., Grubb, J.H., Shah, G.N., et al. 2006. Expression of Membrane-bound Carbonic Anhydrases IV, IX, and XIV in the Mouse Heart. J. Histochem. Cytochem. 54(12): 1379 –1391. doi:10.1369/jhc.6A7003.2006. PMID:16924128.

Can. J. Physiol. Pharmacol. Vol. 90, 2012 Shioi, T., Kang, P.M., Douglas, P.S., Hampe, J., Yballe, C.M., Lawitts, J., et al. 2000. The conserved phosphoinositide 3-kinase pathway determines heart size in mice. EMBO J. 19(11): 2537– 2548. doi:10.1093/emboj/19.11.2537. PMID:10835352. Sly, W.S., Hewett-Emmett, D., Whyte, M.P., Yu, Y.S., and Tashian, R.E. 1983. Carbonic anhydrase II deficiency identified as the primary defect in the autosomal recessive syndrome of osteopetrosis with renal tubular acidosis and cerebral calcification. Proc. Natl. Acad. Sci. U.S.A. 80(9): 2752–2756. doi:10.1073/ pnas.80.9.2752. PMID:6405388. Spicer, S.S., Lewis, S.E., Tashian, R.E., and Schulte, B.A. 1989. Mice carrying a CAR-2 null allele lack carbonic anhydrase II immunohistochemically and show vascular calcification. Am. J. Pathol. 134(4): 947–954. PMID:2495727. Srere, P.A. 1987. Complexes of sequential metabolic enzymes. Annu. Rev. Biochem. 56(1): 89 –124. doi:10.1146/annurev.bi.56.070187. 000513. PMID:2441660. Sterling, D., Reithmeier, R.A., and Casey, J.R. 2001. A Transport Metabolon: Functional Interaction of Carbonic Anhydrase II and Chloride/Bicarbonate Exchangers. J. Biol. Chem. 276(51): 47886 – 47894. PMID:11606574. Théroux, P., Chaitman, B.R., Danchin, N., Erhardt, L., Meinertz, T., Schroeder, J.S., et al. 2000. Inhibition of the sodium-hydrogen exchanger with cariporide to prevent myocardial infarction in high-risk ischemic situations. Main results of the GUARDIAN trial. Guard during ischemia against necrosis (GUARDIAN) Investigators. Circulation, 102(25): 3032–3038. doi:10.1161/ 01.CIR.102.25.3032. PMID:11120691. Weeks, K.L., and McMullen, J.R. 2011. The athlete’s heart vs. the failing heart: can signaling explain the two distinct outcomes? Physiology (Bethesda), 26(2): 97–105. doi:10.1152/physiol.00043. 2010. PMID:21487028. Yoshida, H., and Karmazyn, M. 2000. Na⫹/H⫹ exchange inhibition attenuates hypertrophy and heart failure in 1-week postinfarction rat myocardium. Am. J. Physiol. Heart Circ. Physiol. 278(1): H300 –H304. PMID:10644613.

Published by NRC Research Press