bs_bs_banner
Phycological Research 2013; 61: 98–104
RESEARCH NOTE
Australian Laurencia majuscula (Rhodophyta, Rhodomelaceae) and the Brazilian Laurencia dendroidea are conspecific Yola Metti,1* Alan J.K. Millar,1 Valeria Cassano2 and Mutue T. Fujii3 1
National Herbarium of New South Wales, Royal Botanic Gardens Sydney, Sydney, New South Wales, Australia, Departamento de Botânica, Universidade de São Paulo and 3Instituto de Botânica, São Paulo, Brazil
2
SUMMARY Morphological and molecular studies have been undertaken on two species of the red algal genus Laurencia J.V.Lamouroux: Laurencia majuscula (Harvey) A.H.S. Lucas and Laurencia dendroidea J.Agardh, both from their type localities. The phylogenetic position of these species was inferred by analysis of the chloroplastencoded rbcL gene sequences from 24 taxa. In all phylogenetic analyses, the Australian Laurencia majuscula and the Brazilian L. dendroidea formed a wellsupported monophyletic clade within the Laurencia sensu stricto. This clade was divided into two subclades corresponding to each geographical region; however, the genetic divergence between Australian L. majuscula and Brazilian L. dendroidea was only 0–1.35%. Examination of the type specimens and sequences of freshly collected samples of both Laurencia majuscula and L. dendroidea show the two to be conspecific despite their disjunct type localities. Key words: Australia, Brazil, Laurencia dendroidea, Laurencia majuscula, rbcL, Rhodomelaceae, Rhodophyta.
INTRODUCTION The genus Laurencia J.V. Lamouroux (1813) sensu stricto contains species that are among the most common intertidal and upper subtidal marine algae on most temperate and tropical coasts of the world. With just over 130 species, it also comprises one of the larger genera of the marine red macroalgae. Although the species of Laurencia are readily recognized by their depressed apical pits, from which trichoblasts often protrude, the identification of individual species is often imprecise. Substantial morphological variation exists within a species, particularly between plants growing in various environmental conditions (Cassano et al. 2012).
The type species of the genus Laurencia is L. obtusa (Hudson) J.V. Lamouroux, whose type locality is England (Maggs & Hommersand 1993). This species and its several varieties have been reported from all three major oceans. Recently, we have shown that at least one variety, L. obtusa var. dendroidea (J. Agardh) Yamada is worthy of specific rank, as L. dendroidea, as J. Agardh (1852) had intended (Cassano et al. 2012). In Australia, one of the most widely reported and distributed species is Laurencia majuscula (Harvey) A.H.S. Lucas. This species was first discovered by William Harvey during his travels around Australia in 1854 and 1855 and published in 1863. Harvey (1863) collected specimens from Rottnest Island and King George Sound in Western Australia and was of the opinion that the species was only a variety of Laurencia obtusa, and named it L. obtusa var. majuscula. In 1935, while studying species from Lord Howe island on the eastern side of the Australian continent, Lucas considered L. obtusa var. majuscula to be worthy of recognition at a specific level, as Laurencia majuscula (Harvey) A.H.S. Lucas. The coasts of Australia host a large number of species, but it is those from southern Australia (Saito & Womersley 1974, Womersley 2003) and south eastern Queensland (Cribb 1958, 1983) that have attracted the most research. The New South Wales (NSW) coast has had little attention in comparison; however, about 15 species within the Laurencia complex have been previously documented (Lucas 1935; Millar 1990; Millar & Kraft 1993). Metti and Millar began the revision of the Laurencia complex of the entire NSW coastline including the Islands of Lord Howe and Norfolk, which lie in the Tasman and Coral Seas, respectively. As
*To whom correspondence should be addressed. Email:
[email protected] Communicating Editor: S.-M. Lin. Received 3 July 2012; accepted 19 November 2012. doi: 10.1111/pre.12009
© 2013 Japanese Society of Phycology
Laurencia majuscula is L. dendroidea
a result of these studies, it has been possible to examine the morphology and molecular genetics of several species that are based on Australian type material, including Laurencia majuscula. From molecular evidence resulting from these investigations, two species seemed to be conspecific; L. majuscula and L. dendroidea. Interestingly, in 1876 (Epicrisis, p. 650), J. Agardh stated that his Laurencia dendroidea matched a specimen of Laurencia obtusa var. majuscula in Harvey’s Aust. Alg. Exsicc. no. 236. Both L. dendroidea and L. majuscula have since been well described morphologically, including type location material (Saito & Womersley 1974, Womersley 2003, Cassano et al. 2012). In this study we have examined the type specimens of the two species L. majuscula and L. dendroidea, in addition to sequencing many samples from both Australia and Brazil, in order to resolve their possible conspecificity.
MATERIALS AND METHODS Collections For both Brazilian and Australian collections each plant was dried in silica powder for DNA work, preserved in 4% formalin/seawater, and had a voucher pressed from unpreserved fresh material on herbarium paper. Formalin preserved samples were used for both internal and external observations. Collected specimens are housed in NSW, SP or SPF. Borrowed specimens came from LD. Herbarium abbreviations follow the online Index Herbariorum (http://sciweb.nybg.org/ science2/IndexHerbariorum.asp.)
DNA extraction and amplification For both Australian and Brazilian samples, total genomic DNA was extracted from silica dried material using the DNEasy Plant Mini Kit (Qiagen, Valencia, CA, USA). For the Australian samples, genomic DNA was purified both before and after PCR amplification (W. Freshwater pers. comm., 2007), using the JetQuick PCR Purification Kit (Genomed, Lohne, Germany). The rbcL gene region was amplified in one independent polymerase chain reaction (PCR). Metti (this study) designed and used a reverse primer for the start of the rbcS gene region, specifically for the Laurencia complex, YR_rbcS (GGTAATCTCACTTATCTATACTCC). This was paired with FrbcL_start_ sh (ATGTCTAACTCTGTAGAAG) (W. Freshwater pers. comm., 2005). The Brazilian samples were amplified in three overlapping parts with the primer pairs: FrbcLstart – R753, F492 – R1150 and F993 – RrbcS (Freshwater & Rueness 1994). For the Australian samples, the PCR mixture was made to 20 mL, with the following concentration of reagents: 11.9 mL of dH20, 2 mL of 10¥ reaction buffer © 2013 Japanese Society of Phycology
99
(Bioline, London, England), 1mL of MgCl2 at 25 mM (Promega, Madison, WI, USA), 2 mL of 4¥ dNTPs at 2.5 mM each, 0.1 mL of BioTaq DNA polymerase (Bioline), 0.5 mL of the forward primer at 20 uM, 0.5 mL of the reverse primer at 20 uM, and 2 mL of the genomic DNA. Amplified products were purified using the JetQuick PCR Purification Kit (Genomed). Four microlitres of purified PCR product was run on a gel to visualize DNA concentrations. For the Brazilian samples, the PCR master mix (Promega) was used following the manufacturer’s instructions. The PCR products were purified with the MicroSpinTMS-300 HR Columns (GE Healthcare Life Sciences, Piscataway, NJ, USA).
DNA sequencing Metti (this study) also designed primers for sequencing the rbcL gene region specifically for the Laurencia complex, which were used on the Australian samples. These are YF1 (TATGTCTAAACTCTGTAGAAGAACG) and YF613 (CCTTAAAGATGATGAAAATATTAATTC). Published primers (Freshwater & Rueness 1994) that were modified by Metti (this study) to be Laurencia complex specific were also used. These are F574 (GTAGTATATGAAGGTCTAAAAGG) and F749 (CAATGGAAGATATGTATGAAAGAGC). The reverse primer RrbcS_start_ sh (GTTCCTTGTGTTAATCTCAC) (W. Freshwater pers. comm., 2005), F939 (Freshwater & Rueness 1994) and PCR amplification primers were used as well. For Australian samples the sequencing mixture was made to 20 mL, with the following concentration of reagents: 12 mL of dH20, 2 mL of 5¥ buffer, 2 mL of Big Dye terminator, 2 mL of a single 1.6 mM primer, 2 mL of purified PCR product. The UNSW Ramaciotti Centre sequencing protocol was followed for the Applied Biosystems 3730 Capillary Sequencer. For Brazilian samples the sequencing was carried out with the Big Dye Terminator Cycle Sequencing Reaction Kit (Applied Biosystems, Hammonton, NJ, USA) on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems).
Phylogenetic analysis A total of 24 rbcL sequences were used in this study, including eight newly generated sequences. Additional sequences were downloaded from GenBank (Benson et al. 2004). All sequences are listed in Table 1. To be included in the alignment GenBank sequences for the rbcL gene were required to meet certain criteria which include: (i) sequenced from type locality material; (ii) vouchered; and (iii) published in a journal article. The resulting sequences were aligned visually using Sequencher (Gene Codes, Ann Arbor, MI, USA). Final length of the rbcL alignment was 1417 base pairs (bp). The following genera are used as outgroups: Osmundea
100
Y. Metti et al.
Table 1. Details of samples collected or donated for morphological and molecular work in this study, including selected downloaded GenBank samples Species
Location and collecting data
Chondria succulenta (J. Agardh) Laurencia
Australia, NSW, Batehaven, Observation Point, intertidal, Y. Metti, YM309, NSW879470, 30 May 2005, Australia, NSW, Arrawarra headland, intertidal, Y. Metti, YM075, NSW879475, 28 July 2004, Australia, NSW, Jervis Bay, Plantation Point, subtidal, Y. Metti and A. Millar, YM169, NSW879474, 15 February 2005 Australia, NSW, Batehaven, Observation Point, intertidal, Y. Metti, YM302, NSW879472, 30 May 2005 Australia, Norfolk Island, Little Organ, subtidal, Y. Metti and A. Millar, YM288, NSW879477, 18 March 2005 Australia, Lord Howe Island, Old Gultch, subtidal, Y. Metti and A. Millar, YM322, NSW879478, 25 October 2005 Australia, WA, Little Turtle, J. Huisman, JH03, PERTH08052360, 15 May 2008 Australia, NSW, Kiama Harbour, North side, intertidal, Y. Metti and D. Williams, YM005, NSW879473, 3 April 2004 Brazil, Bahia, Lauro de Freitas, Praia Vilas do Atlântico, A. Oliveira, SP399.927, 08 January 2008 Brazil, Rio de Janeiro, Parati, Praia da Lula, V. Cassano, SP399.804, 25 February 2007 Brazil, Rio de Janeiro, Angra dos Reis, Praia do Velho, V. Cassano and J. C. De-Paula, SP399.883, 20 July 2006 Brazil, Rio de Janeiro, Ilha de Cabo Frio, D.Sudatti, SP399.926, 25 February 2007 Brazil: Rio de Janeiro, Angra dos Reis, Ilha Grande, Ilha dos Macacos, V. Cassano and J. C. De-Paula, SP399.875, 29 July 2005 South Africa: Palm Beach, S. Kwa Zulu-Natal, A. Millar and S. Fredericq, 7 February 2001 South Africa: Palm Beach, S. Kwa Zulu-Natal, A. Millar and S.Fredericq, 7 February 2001 Ireland, Co. Donegal, Fanad Head, C. A. Maggs, 6 July 1998 South Africa: Port Edward, S. Natal, S. Fredericq, O. DeClerck and A. Millar, 8 February 2001 Brazil, Espírito Santo State, Marataízes, M. T. Fujii, LAF 377; SP 356242, 15 April 2001 Ireland, Co. Donegal, St. John’s Point, C. A. Maggs, 12 October 1999 Ireland, Co. Donegal, St. John’s Point, C. A. Maggs, 12 October 1999 USA, California, Orange Co., Crescent Beach, S. Murray, LAF#:680, 28 May 2002 USA, California, San Diego Co., Beach Club Reef (La Jolla Shores), M. Volovsek, 1 July 1996 Australia, Tarcoola Beach, M. H. and F. Hommersand, 21 September 1995 Kiel Bight, Germany
Laurencia majuscula (Harvey) A. H. S. Lucas Laurencia majuscula
Laurencia majuscula
Laurencia majuscula
Laurencia majuscula
Laurencia majuscula Laurencia majuscula
Laurencia dendroidea J. Agardh
Laurencia dendroidea Laurencia dendroidea
Laurencia dendroidea Laurencia dendroidea
Laurencia natalensis Kylin Laurencia flexuosa Kuetzing Laurencia obtusa (Hudson) J. V. Lamouroux Laurencia complanata (Suhr) Kuetzing Laurencia translucida M. T. Fujii & Cordeiro-Marino Osmundea osmunda (S. G. Gmelin) K. W. Nam & Maggs Osmundea pinnatifida (Hudson) Stackhouse Osmundea sinicola (Setchell & N. L. Gardner) K. W. Nam Chondria californica (Collins) Kylin Kallymenia cribrosa Harvey Rhodomela confervoides (Hudson) P. C. Silva
Accession No.
Source This Study
This Study This Study
This Study
This Study
This Study
This Study This Study
GU330228
Cassano et al. (2012)
GU330229
Cassano et al. (2012)
GU330232
Cassano et al. (2012)
GU330236
Cassano et al. (2012)
GU330224
Cassano et al. (2012)
AF465816
Fujii et al. (2006)
AF465815
Fujii et al. (2006)
AF281881
Nam et al. (2000)
AF465813
Fujii et al. (2006)
AY588408
Fujii et al. (2006)
AF281877
Nam et al. (2000)
AF281875
Nam and Choi (2000)
AY588407
Fujii et al. (2006)
AY172578
McIvor et al. (2002)
EU349216
Krayesky et al. (2009)
AF083381
de Jong et al. (1998)
© 2013 Japanese Society of Phycology
Laurencia majuscula is L. dendroidea
Stackhouse, Chondria C. Agardh, Rhodomela C. Agardh and Kallymenia J. Agardh. The maximum parsimony (MP) and maximum likelihood (ML) analyses were performed using the software PAUP for PC (v.4.0 beta10, Swofford 2003). The program MrBayes 3.1 (Huelsenbeck and Ronquist 2001) for PC was used for the Bayesian Inference (BI) analyses. Both the ML and BI analyses used the same evolutionary model that was determined by the program Modeltest 3.7 (Posada and Crandall 1998) for PC using the Akaike information criterion. The MP trees were constructed using the heuristic search option, and the tree-bisection-reconnection branch swapping algorithm. Initial trees were generated with random sequence addition, and 1000 replicates were run. Support for resulting relationships was estimated by 1000 bootstrap replicates. Pairwise distances were calculated using the uncorrected ‘p’ distances in PAUP. For the ML trees the evolutionary model used was a general-time-reversible model of sequence evolution including rate variation among sites (GTR + G), and 1000 replicates were run. Support for resulting relationships was estimated by 1000 bootstrap replicates.
Fig. 1. Maximum Likelihood tree of rbcL sequences, including seven sequences from Australia and five sequences from Brazil, showing a very close and well supported relationship between the Laurencia majuscula and Laurencia dendroidea clades. Bootstrap values reported as maximum parsimony, maximum likelihood and bayesian inference (MP/ML/BI). Values less than 50% (or .50 probabilities) are shown as dash (–).
© 2013 Japanese Society of Phycology
101
The model used in the BI analysis was the same as for the ML analysis. Four chains of the Markov chain Monte Carlo (one hot and three cold) were used, sampling one tree every 100 generations for 2 000 000 generations starting with a random tree. The first 5000 trees were discarded as a 25% burn in, and a 50% majority rule consensus tree computed from the remaining trees. Posterior probabilities were also calculated.
RESULTS Molecular results All tree topologies (ML, MP, BI) are congruent and show Laurencia majuscula and Laurencia dendroidea as closely related sister clades (Fig. 1). The larger clade containing both L. majuscula and L. dendroidea is strongly supported across all three analyses. The Laurencia s.s. clade contains L. obtusa from Ireland, a region near the type locality, therefore taxa nesting with this sequence, which includes L. dendroidea
102
Y. Metti et al.
and L. majuscula, are within the genus Laurencia. The Laurencia sensu stricto clade is moderately supported when L. translucida is included but is strongly supported when excluding L. translucida. However, its inclusion is important since it indicates the extreme limit of the Laurencia genus. Pairwise distances for rbcL are useful indicators of relationships between taxa. In this study pairwise distances between all L. dendroidea and L. majuscula samples are from 0–1.35%, which is within generally accepted species limits for Laurencia (
