System. Appl. Microbiol. 21,450-453 (1998) _©_G_us_ta_v_Fi_sc_he_r\\_e_r1a_g_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
SYSlEI'vl4TIC AND APPLIED MICROBIOLOGY
Application of 23S rONA-targeted Oligonucleotide Probes Specific for Enterococci to Water Hygiene Control EDITH FRAHM, INES HElBER, SANDRA HOFFMANN, CORNELIA KOOB\ HARALD MEIER2, WOLFGANG LUDWIG\ RUDOLF AMANN\ KARL H. SCHLEIFER3, and URSULA OBST WFM Wasserforschung Mainz GmbH, D-55118 Mainz, Germany 1 Biotecon GmbH, D-14473 Potsdam 2 GSF Neuherberg, Ingolstiidter Landstr. 1, D-85767 Neuherberg 3 Technische Universitiit Mlinchen, Lehrstuhl flir Mikrobiologie, Arcisstr. 17, D-80333 Mlinchen 4 Max-Planck-Institut flir marine Mikrobiologie, Celsiusstr. 1, D-28359 Bremen
Received May 27, 1998
Summary Identification of enterococci species by hybridization with recently designed species-specific and groupspecific 23S rDNA-targeted oligonucleotide probes was superior to results obtained with a common biochemical test panel. Considering these findings, a molecular biological procedure for the detection of enterococci in water samples was developed. A short enrichment is followed by an amplification step and a hybridization reaction in micro titer plate format. The detection limit is about 1 CFU/ml, and results are available within 26 h. Key words: water hygiene - enterococci - 23S rDNA-targeted oligonucleotide probes - hybridization
Introduction The control of water hygiene standards generally depends upon the absence of characteristic indicator organisms. Conventional testing is focused primarily on E. coli and fecal coliforms, but detection of fecal streptococci is also used for indicating fecal contamination. Because of their different physiological properties, fecal streptococci are more resistant to disinfection, persist longer, and, in contrast to E. coli have never been reported to multiply in water (SINTON et al., 1993). In recreational and marine waters, presence of fecal streptococci has been significantly related to gastrointestinal illness due to bathing (CABELLI, 1989), and the ratio of E. coli to fecal streptococci together with the presence of certain host specific strains even point to the origin of contamination (POURCHER et al., 1991). However, conventional microbiological test procedures including enrichment, selective subculture and Gram-stain are laborious and time-consuming. The aim of this study was the development of a detection procedure based on enterococci-specific, 23SrDNS oligonucleotide probes and their application in hybridization assays, which are faster and more specific than conventional cultivation techniques. Furthermore, the test should be feasible for regular bacteriological
laboratories with only basic molecular biological equipment. A difficulty resulted from the fact that standard methods traditionally refer to some species with similar physiological characteristics, the so called fecal streptococci, including members of the genera Enterococcus and Streptococcus. Recent analysis of 16S rRNA sequences revealed the taxonomic diversity of these genera (SCHLEIFER, 1987), which include "new" intestinal species as well as some with no hygienical relevance. Conventional cultivation techniques are optimized to support intestinal enterococci and streptococci species and/or to discriminate against hygienically irrelevant enterococci, streptococci, and other interfering microorganism. For physiological reasons, an optimal combination of selectivity and sensitivity is nearly impossible (LECLERC et al., 1996). Therefore in current international standardization activities the term "fecal streptococci" has been abandoned in favor of the detection of enterococci, especially the four major intestinal enterococci species E. faecium, E. faecalis, E. durans, and E. hirae (ANONYMOUS a, 1995). For this molecular biological test, 23S-rDNA probes were developed only for members of the genus Enterococcus.
Oligonucleotide Probes Specific for Enterococci
Specifity of the oligonucleotide probes Oligonucleotide probes directed against 23 S rDNA sequences of 11 enterococci species (Tab. 1) were designed by KOOB et al. (in preparation). Probe specifity was tested in hybridization assays with template DNA from crude cell extracts of stock cultures of all 19 enterococcal and related species like Aerococcus ssp., Lactococcus ssp., and Leuconostoc ssp. (all ATCC strains), as well as 265 environmental isolates from water samples. They were obtained from various German water works (drinking water samples and from conditioning steps) and private wells. The samples were prepared according to the German Drinking Water Regulation (ANONYMOUS b, 1989) by liquid enrichment in Azide-Dextrose-Broth (Merck), subculture on Slanetz & Bartley medium (Difco) and confirmation of presumptive fecal streptococci by Gram-stain. Biochemical identification was done with rapid ID 32 Strep (bioMerieux). Crude DNA was extracted from cultures (ATCC strains or environmental isolates) grown overnight in Brain-Heart-Infusion-Broth (Difco). Cells were harvested by centrifugation (12.000 x g, 10 min), washed in aqua dest., and lysed by boiling. A standard PCR protocol (SAIKI, 1988) with the following temperature profile: 94°C for 1 min, 44 °c for 2 min, and 72 °C for 1 min, 35 cycles, was performed in a final volume of 100 rl, containing 75 pmol of primer 118V and 367R (or 1037R), respectively (table 1). Amplicons were analyzed by gel electrophoresis on 1 % agarose. Denatured DNA strands were blotted onto nylon membrane (SOUTHERN, 1975) and crosslinked by 254 nm UV radiation. SOUTHERN hybridization and detection reactions were executed according to the 'DIG Labeling and Detection Kit' (Boehringer Mannheim) using Digoxigenin (DIG}-Iabeled probes and Anti-DIGAlkaline Phosphatase. Specific hybridization conditions are listed in Table 1. The substrate for the chemolumines-
451
cent detection reaction was CSPD® (Boehringer Mannheim). The hybridization data were compared to identification results by rapid ID 32 Strep (bioMerieux), based on the physiological properties of the isolated strains. Hybridization of the DIG-labeled probes with DNA from reference strains always resulted in a correct identification and cross-reactions were not observed. Concerning the environmental isolates, disagreement between rapid ID 32 Strep and probe identification occurred in 57 cases (21 %) (Table 2), probably caused by failure of the biochemical typing. This assumption was confirmed by 16SrRNA sequence analysis in three exemplary cases which justified the hybridization results (KooB et aI., in preparation). Each environmental isolate was recognized as Enterococci by hybridizing with the group-specific probe Enc38a and further identified by reaction with one of the species-specific probes.
Development of a test protocol Based on the described probes a working scheme for the detection of enterococci in water samples was developed. As mandated by the German Drinking Water Regulation (ANONYMOUS b, 1989), 1 CFU/ 100 mL water was to be detected. However, no PCR products were achieved from aliquots of low contaminated native or filtrated samples, using a pair of Eubacteria-specific primers (118V and 1037R). This lack of sensitivity may be caused by presence of inhibitors of the PCR in the water samples (WILSON, 1997). Hence enrichment in the liquid selective medium Chromocult®-EnterococcusBroth (Merck) was tested with different incubation times. Chromocult®-Enterococcus-Broth supported growth of enterococci and streptococci better than Azide-Dextrose-Broth, as indicated in a recent study
Table 1. Oligonucleotide probes/primers and specific hybridization conditions (Hybr.: Hybridization, Y = CIT, N = A/G/C/T). Probe
Target Organism
Sequence (5'-3')
Position II
Hybr. Conditions Formamide (%)
DB6 21 DB8 21 DB9 21
Eduhi9b Ega9b Ecafl9b Enc38a 118V 367R 1037R 11 Position 21
E. faecium E. faecalis E. aviuml E. malodoratusl E. pseudoaviuml E. raffinosus E. duransl E. hirae E. gallina rum E. casselif/avusl E. f/aveszenz Enterococci Eubacteria Eubacteria Eubacteria
CACACAATCGTAACATCCTA TAGGTGTTGTTAGCATTTCG
140-158 342-361
TAGGTGCCAGTCAAATTTTG CACGCAAACGTAACATCC CACAACTGTGTAACATCC
342-361 148-165 148-165
CACGCAGACGTAACATCC CTCTACCTCCATCATTCT TCYGAATGGGGNAAC CACGTGTYCCGCCGTACTC GGAATTTCGCTACC
148-165 1214-1232 121-136 374-394 1940-1953
according to BROSIUS et ai., 1981 BETZL et ai, 1990
Hybr. Temp. ( °C) 42 42
30 10 30 20
42 37 37 37 42 42 42 42
452
E.
FRAHM
et al.
Table 2. Physiological identification of environmental enterococci isolates by rapid ID 32 Strep compared to hybridization results with specific probes. Agreement: Hybridization results confirm rapid ID 32 Strep results; Disagreement: Hybridization results identify different species than rapid ID 32 Strep. Physiological identification
Hybridization results with specific probes Disagreement
Agreement 73 x 38 x 1x 88 x 21 x 38 x 1x
1x 1x 3x
1 xDB8 1 x Eduhi9b
70 x DB6 37 xDB8 1 xDB9 69 x Eduhi9b 18 x DB6 28 x Ecaf19b
E. faecium E. faecalis E. avium E. duranslE. hirae E. gallina rum E. casseliflavus Lactococcus ssp. Leuconostoc ssp. Aerococcus ssp. not identified
18 x DB6 3 x Ega9b 9xDB6 1 xDB6 1 x Eduhi9b 1 x Eduhi9b 1 xDB6
(HElBER et aI., submitted for publication). When incubated for 16h (overnight), initial sample inocula of 1 to 10 CFUI ml were detected (Fig. 1). Based upon these findings, a test protocol was developed for the detection of enterococci in water samples by reverse hybridization in microtiter plates. As enrichment step, 100 ml water sample are prepared with 100 ml double-concentrated Chromocult®-Enterococcus-Broth and incubated overnight (at least 16 h) at 36 ± 1 0c. Aliquots of 1 ml are pelle ted (12.000 x g, 10 min), washed, and resuspended in 100 )11 deionized water. 10 )11 of the suspensions are transferred into the PCR mixture (see above) and cell lysis is achieved by heating the samples at 94°C for 3 min prior to PCR (PCR protocol as previous described). By partly substitution of the nucleotide dTTP by DIG-dUTP in the PCR mixture, DIG-labeled amplicons are produced. The following detection reaction is
18 16 14 E:12 Q)
~ 10 c 0
~ 8 .c ::J () 6 .EO
1 x Eduhi9b
1 x Ecaf19b
1 xDB8 1 xDB8
1 xDB8
1 x Eduhi9b
performed in microtiter-plate format. Phosphorylated probes are bound covalently to the microtiter-plate surface by carbodiimide condensation according to the manufacturer (NucleoLink, Nunc). Hybridization and detection steps are performed according to the "DIG Labeling and Detection Kit" (Boehringer Mannheim). After pre-hybridization for 1 h, 10 )11 aliquots of heat denatured PCR-products are transferred into 100 )11 hybridization solution, containing 5x SSC (Ix SSC is 0.15 M NaCI plus 0.015 M sodium citrate), 1 % (wt/vol) blocking agent (Boehringer Mannheim), 0.1 % (wt/vol) N-Lauroylsarcosin, and 0.02 % (wt/vol) sodium dodecyl sulfate (SDS) and hybridized for 1 h at the specific temperature (Table 1). Stringent washing is done twice for 5 min in 100)11 washing solution (2 x SSC, 0.1 % SDS) at hybridization temperature and once for 5 min at 42°C. Concerning the following reaction steps, solution volumina are always 100 )11. After washing with phosphate buffered saline (PBS) and incubation with PBSI 1 % (wt/vol) blocking agent for 30 min, the immobilized hybrids are incubated for 30 min with Anti-DIG-Peroxidase-Conjugate1:1000 in PBS/1 % (wt/vol) blocking agent. After washing twice with PBS and once with ABTS®-buffer (ABTS® and ABTS®-reagents Boehringer Mannheim), 100 )11 ABTS®-solution (chromogenic substrate) is pipetted and incubated for 1 h in the dark at room temperature. A positive reaction results in a green color development and is measured at 405 nm in a microtiter-plate photometer.
4 2
Conclusion
0 10 9
lO B
10 7
10 6
10 5
10 4
10 3
10 2
10 1
10°
Detection limit [CFU E. faecium/ml]
Fig. 1. Detection limit for E. faecium in decimal dilutions after different incubation times. Two different PCR-assays are shown: Polymerase 1: Expand™HighFidelity System (Boehringer Mannheim), a system intended for maximum yield at low concentration of target DNA; 2: Taq-Polymerase (Promega), a common PCR reagent; Polymerase.
The described test protocol is aimed at the rapid and specific detection of enterococci in water samples. Including enrichment, peR, and hybridization assay, results are available within 26 hours after reception of the sample. In most cases, hybridization with the group-specific probe Enc38a, which gives evidence for the presence of members of the genus Enterococcus, will be adequate. This is consistent with the scope of the microbiological
Oligonucleotide Probes Specific for Enterococci
methods recently proposed by the International Standardization Organization (ANONYMOUS a, 1995). But in some cases further information may be of interest, e. g. if there is doubt concerning the hygienical relevance of the detected enterococci. Thus, the set of probes enables the user to choose the range of identification and, if required, verification of individual strains by species-specific probes is feasible. The microbiological precultivation step on the one hand side seems to be disadvantageous, because the variety of detectable bacteria is limited by the selectivity of the enrichment broth. On the other hand, this assures viability of the detected bacteria, and the selected species are those which are favored by international standards. Investigations are being conducted concerning a further improvement of the procedure, especially concerning the length of the incubation interval. Since in laboratory scale the test appears to be practicable and specific, the next step has to be an extensive evaluation with native water samples. Acknowledgement This work was supported by the Bundesministerium fiir Bildung und Forschung (BMBF 02-WU9209) and the Deutsche Verein des Gas- und Wasserfaches e. V. (DVGW).
References ANONYMOUS a: ISO TC147 I SC4 I WG 7899/2: Water Quality - Detection and Enumeration of Fecal Enterococci by Membrane Filtration. Working Document - Draft Revision 1995 ANONYMOUS b: Verordnung iiber Trinkwasser und iiber Wasser fiir Lebensmittelbetriebe (Trinkwasserverordnung - TrinkwV) vom 6. Dezember 1989. Bundesgesetzblatt Nr. 66, Teil 1 1990 BROSIUS, J., DULL, T. J., SLEETER, D. D., NOLLER, H. E: Gene organization and primary structure of a ribosomal RNA operon from Escherichia coli.]. Mo!. Bio!. 148,107-127 (1981) BETZL, D., LUDWIG, B., SCHLEIFER, K.-H.: Identification of Lactococci and Enterococci by colony hybridization with 23S rRNA-targeted oligonucleotide probes. App!. Environ. Microbio!' 56, 2927-2929 (1990)
453
CASELLI, V. ] .. Swimming associated illness and recreational water quality criteria. Wat. Sci. Tech. 21,13-21 (1989) HElBER, 1., FRAHM, E., OSST, U.: Comparison of four Methods for the Detection of Fecal Streptococci in Water. Zb!. Bacterio!. Hyg. (submitted for publication) Koos, C., MEIER, H., FRAHM, E., HOFFMANN, S., OSST, U., AMANN, R., LUDWIG, W., SCHLEIFER, K. H.: An array of nested and multiple rRNA targeted probes for the detection and identification of enterococci. Syst. App!. Bacterio!', in preparation. LECLERC, H., DEVRIESE, L S., MOSSEL, D. A. A.: A review: Taxonomical changes in intestinal (faecal) enterococci and streptococci: consequences on their use as indicators of faecal contamination in drinking water. J. App!. Bacterio!' 81: 459-466 (1996) POURCHER, A. M., DEVRIESE, L. A., HERNANDEZ, J. F.. DELATTRE, ]. M.: Enumeration by a miniaturized method of Escherichia coli, Streptococcus bovis and enterococci as indicators of the origin of fecal pollution of waters. J. App!. Bacterio!' 70: 525-530 (1991) SAIKI, R.K., GElfAND, D. H., STOFFEL, S., SCHARF, S. ]., HIGUCHI, R., HORN, G. T., MULLIS, K. B., ERLICH, H. A.: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 233: 487-491 (1988) SCHLEIFER, K. H.: Molecular and chemotaxonomic approaches to the classification of streptococci, enterococci and lactococci. System. App!. Microbio!. lOll: 1-10 (1987) SINTON, L. W., DONNISON , A. M., HASTIE, C. M.: Fecal streptococci as fecal pollution indicators: a review. Part II: sanitary significance, survival, and use. New Zealand J. Marine Freshwater Res. 27: 101-115 (1993) SOUTHERN, E.: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mo!. Bio!. 98, 503-517 (1975) WILSON, 1. G.: Minireview - Inhibition and facilitation of nucleic acid amplification. App!. Environ. Microbio!. 6311 0, 3741-3751 (1997)
Corresponding author: EDITH FRAHM, WFM Wasserforschung Mainz GmbH, Rheinallee 41, D-55118 Mainz, Germany, Te!.: (49) 6131-126174. Fax: (49) 6131-126693 E-mail:
[email protected]
