Journal of Ethnopharmacology 135 (2011) 338–343
Contents lists available at ScienceDirect
Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jethpharm
Anti-obesity potential of Clerodendron glandulosum.Coleb leaf aqueous extract Ravirajsinh N. Jadeja a , Menaka C. Thounaojam a , Umed V. Ramani b , Ranjitsinh V. Devkar a,∗ , A.V. Ramachandran a a b
Division of Phytotherapeutics and Metabolic Endocrinology, Department of Zoology, The M.S. University of Baroda, Gujarat, India Department of Animal Biotechnology, College of Veterinary Science and Animal Husbandry, Anand Agriculture University, Anand, Gujarat, India
a r t i c l e
i n f o
Article history: Received 17 October 2010 Received in revised form 16 February 2011 Accepted 7 March 2011 Available online 11 March 2011 Keywords: Clerodendron glandulosum.Coleb Obesity 3T3L1 cells PPAR␥ Leptin
a b s t r a c t Ethnopharmacological relevance: Clerodendron glandulosum.Coleb leaf aqueous extract (CG) is traditionally used by people of North-East India to alleviate symptoms of diabetes, obesity and hypertension. Previous study from our laboratory have documented anti-diabetic and anti-hypertensive properties of CG extract but, till date there are no pharmacological studies available on its anti-obesity potential. This inventory investigates the underlining molecular mechanism/s of CG induced regulation of in vivo HFD induced obesity and in vitro adipocyte differentiation. Aim: To evaluate effects of CG extract on (i) expression of genes regulating visceral adiposity and (ii) in vitro adipocyte differentiation and LEP release. Materials and methods: Body weight, lee index, plasma lipids and LEP, mRNA expression of PPAR␥-2, SREBP1c, FAS, CPT-1 and LEP in epididymal adipose tissue of control and experimental groups were evaluated. Also, potential of CG extract on in vitro adipocyte differentiation and LEP release was assessed. Results: Supplementation of CG extract to HFD fed mice significantly prevented HFD induced increment in bodyweight, lee index, plasma lipids and LEP, visceral adiposity and adipocyte hypertrophy. Also, CG extract supplementation resulted in down regulation of PPAR␥-2, SREBP1c, FAS and LEP expression along with up-regulation of CPT-1 in epididymal adipose tissue compared to HFD fed mice. In vitro study recorded significant anti-adipogenic effect of CG extract that resulted in decreased adipogenesis, TG accumulation, LEP release, G3PDH activity along with higher glycerol release without significantly altering viability of 3T3L1 pre-adipocytes. Conclusions: Clerodendron glandulosum.Coleb extract prevents adipocyte differentiation and visceral adiposity by down regulation of PPAR␥-2 related genes and Lep expression thus validating its traditional therapeutic use in controlling obesity. © 2011 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Obesity has attained grave proportion worldwide (WHO, 2003) and is a causative factor for several life threatening diseases such as diabetes, hypertension and cardiovascular ailments (Aronne and Isoldi, 2007; Shah et al., 2008). Due to undesirable side effects of synthetic anti-obesity drugs use of traditional herbal medicines for controlling weight gain is in vogue.
Abbreviations: LEP, leptin; PPAR␥-2, peroxisome proliferator-activated receptor gamma isoform 2; SREBP1c, sterol regulatory element binding proteins isoform 1c; FAS, fatty acid synthase; CPT-1, carnitine parmitoyltransferase 1; HFD, high fat diet; G3PDH, glyceraldehyde 3-phosphate dehydrogenase; EDTA, ethylenediaminetetraacetic acid; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PBS, phosphate buffer saline; DMSO, dimethyl sulphoxide. ∗ Corresponding author. Tel.: +91 9825935445. E-mail address: phyto
[email protected] (R.V. Devkar). 0378-8741/$ – see front matter © 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2011.03.020
Clerodendron glandulosum.Coleb (CG; Fam: Verbenacea) is an herb endemic to North-Eastern region of India and commonly known as “Kuthab laba”. Leaves of CG are used by Apatani and Nyishi tribes of North-East India as a therapeutic agent against hypertension (Kala, 2005; Deb et al., 2009). Rural and urban people of Manipur (India) grow CG in kitchen garden and the leaves are sold in the market. Traditionally, cross sections of people across Manipur consume decoction of CG leaves for treating diabetes, obesity and hypertension (Jadeja et al., 2009). Recent studies from our laboratory have shown that, CG aqueous extract can improve fructose induced insulin resistance and hypertension (Jadeja et al., 2010a), regulate high fat diet induced hyperlipidemia in rats (Jadeja et al., 2010b) and prevent HFD induced hepatic steatosis (Jadeja et al., 2010c). In addition, safety evaluation of CG aqueous extract in Swiss albino mice has revealed its LD50 indices to be higher than 3000 mg/kg (Jadeja et al., 2011). Since, there are no pharmacological reports on anti-obesity potential of CG extract to date and due to promising preliminary results obtained in our laboratory, the present work was undertaken to decipher the influence of CG extract on the expression
R.N. Jadeja et al. / Journal of Ethnopharmacology 135 (2011) 338–343
339
of key regulatory genes in HFD fed C57BL/6J mice and in vitro adipocyte differentiation and, LEP release.
as per the instructions of the manufacturer (Krishgen Biosystems, Ltd.).
2. Materials and methods
2.4.2. Gene expression by quantitative RT-PCR (qPCR) Total RNA was isolated from the epididymal fat pad of control and experimental mice using Tri-reagent (Sigma–Aldrich, USA). Quantity and quality of isolated RNA were assessed using nanodrop spectrophotometer (Thermo scientific, Ltd.) and samples with a ration of A260 /A280 > 1.9 was processed for cDNA synthesis using Omniscript cDNA synthesis kit (Qiagen, USA). A reaction mixture of 20 l contained, 2 g total RNA, 10× RT buffer, dNTP mixture (5 mm each), 10× random hexamer, RNase inhibitor (10 U/l), Omniscript RT (4 U/rxn) and RNase free water. The cDNA synthesis was carried out at 37 ◦ C for 1 h using a Veriti 96 well thermal cycler (Applied Biosystems, USA). Real-time PCR assays were performed in 96-well plates in ABI 7500 Fast real-time PCR machine (Applied Biosystems, USA). Primer sequences for qPCR analysis were as follow: PPAR␥-2 (sense) TCACAAGAGCTGACCCAATG, (antisense) GCATCCTTCACAAGCATGAA, SREBP1c (sense) GATCAAAGAGGAGCCAGTGC, (anti-sense) TAGATGGTGGCTGCTGAGTG, FAS (sense) GGGTCTATGCCACGATT, (anti-sense) CACAGGGACCGAGTAATG, CPT-1 (sense) CTCAGTGGGAGCGACTCTTCA, (anti-sense) GGCCTCTGTG GTACACGAC AA, LEP (sense) GACACCAAAACCCTCAT, (anti-sense) CAGAGTCTGGTCCATCT, GAPDH (sense) AGGCCGGTGCTGAGTATGT, (anti-sense) GTGGTTCACACCCATCACAA. Syber Green reaction mixture of 20 l contained 10 l Quantifast Syber green master mix (Qiagen, USA), 2-l template, 1 l of each primer and 6 l nuclease free water. The following two steps thermal cycling profile was used for qPCR analysis, Step I (cycling step): 95 ◦ C for 10 min, 95 ◦ C for 15 s, 60 ◦ C for 1 min and 95 ◦ C for 15 s for 40 cycles. Step II (Melt Curve step): 60 ◦ C for 15 s, 60 ◦ C 1 min and 95 ◦ C for 30 s. The data obtained was analyzed by comparative cycle threshold method, normalized by the GAPDH expression value and expressed as fold change. Melting curves for each PCR reaction were generated to ensure the purity of amplified product.
2.1. Plant The leaves of CG were collected from Imphal district India in the month of June and were identified by Dr. Hemchand Singh, Taxonomist, Department of Botany, D.M. College of Science, Manipur, Imphal, and a sample (voucher specimen No. 405) was deposited at the herbarium of the Department of Botany. 2.2. Preparation of extract The leaves of CG were shade dried, crushed manually and ground in an electric grinder to obtain a fine powder. Hundred grams of powdered leaves were boiled in 1000 ml of distilled water at 100 ◦ C for 3 h and filtered using a sterilized muslin cloth. Resulting filtrate was collected in petri plates and concentrated by heating at 100 ◦ C to form a semisolid paste. The net yield obtained at the final step of extract preparation was 28% w/w. A preliminary phytochemical analysis was done to assess presence/absence of various groups of phytochemicals (Trease and Evans, 1987). 2.3. Experimental animals Male C57BL/6J mice (6–8 weeks of age) were purchased from National Centre for Laboratory Animal Sciences (NCLAS), National Institute of Nutrition (NIN), Hyderabad, India. They were housed and maintained in clean polypropylene cages and fed with either low fat diet or high fat diet and water ad libitum. The experimental protocol was carried out according to the guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), India and approved by the animal ethical committee of Department of Zoology, The M.S. University of Baroda, Vadodara (Approval No. 827/ac/04/CPCSEA). 2.4. High fat diet induced obesity in C57BL/6J mice A total of 18 mice were randomly allocated into 3 groups of 6 animals each Group I (Lean; LN) consisted of mice fed with low fat diet (regular fat diet). Group II (Obese; OB) was fed with high fat diet (Jadeja et al., 2010c; Thounaojam et al., 2010). Group III (OB + CG) consisted of mice fed with high fat diet containing 1% CG extract (Jadeja et al., 2010c). All animals were fed with their respective diets for 20 weeks. In the present study, selection of dose (1% w/w in HFD) was based on our previous report on efficacy of CG extract in ameliorating HFD induced non-alcoholic steatohepatitis in C57BL/6J mice (Jadeja et al., 2010c). At the end of the experimental period, overnight fasted animals were given mild ether anaesthesia and, blood was collected by retro orbital sinus puncture in EDTA coated vials. Plasma was obtained by cold centrifugation (4 ◦ C) of the vials for 10 min at 3000 rpm. Later animals were sacrificed by cervical dislocation under mild ether anaesthesia and abdominal, renal and epididymal fat pads were excised. Epididymal fat pad was stored in RNAlater solution (Ambion, Applied Biosystems, USA) at −80 ◦ C (Cryo Scientific Ltd., India) until analysis. 2.4.1. Plasma lipids and leptin assay Plasma TG was assayed using commercially available kits (Reckon Diagnostics, Ltd., Baroda, India) whereas, plasma FFA was assayed by the method of Itaya and Ui (1965). LEP was assayed using anti-mouse monoclonal antibody coated 96-microtiter plate
2.4.3. Microscopic and morphometric evaluation of epididymal fat pad Epididymal fat pad was excised from control and experimental mice, fixed in 4% buffered paraformaldehyde, dehydrated in graded alcohol series and embedded in paraffin wax using automated tissue processor. Five micrometers of sections were cut and stained with hematoxyline and eosin and examined under Leica microscope. Photographs of adipocyte were taken with Canon power shot S70 digital Camera at 400×. Adipocyte diameter, surface area and number were calculated by Leica image analysis software. 2.5. Maintenance of 3T3L1 cells 3T3-L1 mouse pre-adipocytes (Obtained from National Centre for Cell Sciences, Pune, India) were maintained in DMEM containing 10% FBS (Himedia Pvt Ltd., Mumbai, India) and 1% antibiotic–antimycotic solution (10×; Himedia Pvt Ltd., Mumbai, India) and sub-cultured every 3rd day using 0.25% trypsin–EDTA solution (Himedia Pvt Ltd., Mumbai, India). All the reagents were sterilized by filtering through 0.22 m syringe filter (Laxbro BioMedical Aids Pvt Ltd.). 2.5.1. In vitro cytotoxicity assay Pre-confluent pre-adipocytes (5.0 × 103 cells/well) were maintained in 96 well culture plate (Tarson India Pvt Ltd.) for 72 h in presence of CG extract (10–1000 g/ml) or vehicle (0.9% NaCl). At the end of incubation period, 10 l of MTT (5 mg/ml in PBS) was added to wells and the plate was incubated at 37 ◦ C for 4 h. At the end of incubation, culture media was discarded and the wells were
R.N. Jadeja et al. / Journal of Ethnopharmacology 135 (2011) 338–343
washed with PBS (Himedia Pvt Ltd., Mumbai, India). Later, 150 l of DMSO was added to all the wells and, were incubated for 30 min at room temperature with constant shaking. Absorbance was read at 540 nm using ELX800 Universal Microplate Reader (Bio-Tek instruments, Inc., Winooski, VT) and subsequently percentage (%) cell viability was calculated (Jadeja et al., 2010c).
2.5.2. In vitro adipocyte differentiation protocol In vitro adipocyte differentiation was carried out as per the protocol of Hata et al. (2008) with minor modifications. Freshly sub-cultured 3T3L1 cells were seeded on a 12 well cell culture plate (1.0 × 105 cell/well) in DMEM containing 10% FBS. Cells were maintained for 48 h to achieve total confluence. These cells were allowed to stay for another 48 h to ensure total arrest of cell division. These cells (day 0) were used for adipocyte differentiation protocol wherein, culture media was replaced with DMEM containing 0.5 mM 3-isobutyl-1-methylxanthine (Sigma–Aldrich, USA), 0.25 M dexamethosone (Sigma–Aldrich, USA), and 10 g/ml insulin (Sigma–Aldrich, USA). At the end of 4 days, culture media was replaced with maturation media containing complete DMEM and 10 g/ml insulin. Cells were subsequently maintained for another 8 days; with replacement of media at every 2nd day until the end of the experiment (day 12).
2.5.3. Qualitative and quantitative analysis of adipocyte differentiation 3T3-L1 pre-adipocytes were differentiated as describe above in presence of CG extract (10–200 g/ml) or vehicle (0.9% NaCl). Oil Red-O staining for adipocyte lipid accumulation was performed as per Jadeja et al. (2010c). At the end of incubation (day 12), cells were washed twice with PBS and, fixed in 4% buffered paraformaldehyde solution for 10 min, washed twice with Milli Q water (Millipore India Pvt Ltd.) and then stained with 0.5% Oil Red-O stain for 15 min at room temperature. Excess Oil Red-O dye was washed with Milli Q water and photographs were taken in Leica DMIL inverted microscope using Canon power shot S70 digital camera. In another set of experiment, the stained adipocytes were treated with 100% isopropanol (to extract intracellular Oil red O stain) and the absorbance (Optical density; OD) was read at 490 nm. Percentage adipogenesis was calculated as OD of treated cells/OD of untreated cells × 100.
2.5.4. Leptin release and triglyceride accumulation assays 3T3-L1 pre-adipocytes were differentiated as described above in presence of CG extract (10–200 g/ml) or vehicle (0.9% NaCl) and LEP and TG contents were assayed in supernatant and cells respectively. On day 12, supernatants from each well were collected and LEP content was analyzed using mouse specific LEP ELISA kit (Krishgen, Biosystems) as per the instructions of the manufacturer. After removal of supernatants, cells were washed twice with PBS and solublized in 100 l of 1% Triton × 100 (in PBS) and, assayed for total TG using commercially available enzymatic kit (Reckon Diagnostics, Baroda, India) using Merck Micro lab L300 Semi-autoanalyzer. Results were expressed as percentage TG.
2.5.6. Glycerol-3-phosphate dehydrogenase (G3PDH) activity assay 3T3-L1 pre-adipocytes were differentiated as described above in presence of CG extract (10–200 g/ml) or vehicle (0.9% NaCl). On day 12 after removal of supernatants, cells were washed twice with ice-cold PBS on and lysed in Tris–EDTA buffer (25 mM Tris/1 mM EDTA, pH 7.5) and G3PDH activity was determined according to the procedure of Wise and Green (1979). Protein content in the cell lysate was determined by the method of Lowry et al. (1951). 2.6. Statistical analysis Statistical evaluation of the data was done by one way ANOVA followed by Bonferroni’s multiple comparison test .The results were expressed as mean ± S.E.M using Graph Pad Prism version 3.0 for Windows, Graph Pad Software, San Diego, CA, USA. 3. Results 3.1. Phytochemical analysis The qualitative phytochemical screening of CG extract showed presence of phenols, steroids, flavanoids, and saponins while tannins and terpenoids were absent. 3.2. Bodyweight gain, lee index and, food and water intake High fat diet fed OB mice recorded significant weight gain (Fig. 1) and higher lee index (5.50 ± 0.07 vs. 2.94 ± 0.07) at the end of 20 weeks compared to the LEAN mice. However, HFD induced weight gain (Fig. 1) and higher lee index were significantly controlled by CG extract supplementation to HFD fed mice (3.01 ± 0.03 vs. 5.50 ± 0.07). There were no significant alterations in the food and water intake between control and experimental groups during study periods (data not shown). 3.3. Plasma lipids, leptin and fat pad weights In the present study, OB mice recorded significant increment (p < 0.05) in plasma TG (191.0 ± 8.47 vs. 46.80 ± 3.31 mg/dl), FFA (125.0 ± 8.11 vs. 46.75 ± 2.50 mg/dl) and LEP (43.33 ± 2.69 vs. 11.83 ± 1.44 ng/l) compared to LEAN mice. Whereas, CG supplementation to HFD fed mice resulted in significant decrement (p < 0.05) in plasma TG (52.00 ± 5.35 vs. 191.0 ± 8.47 mg/dl), FFA 50
LEAN
OB
OB+CG
45
### ###
40
###
35
###
###
###
###
30
g
340
###
25
#
*
4
6
**
***
***
***
12
14
***
***
16
18
***
20 15 10 5
2.5.5. Glycerol release 3T3-L1 pre-adipocytes were differentiated as described above for 12 days. For glycerol release assay, differentiated adipocytes were incubated with CG extract (10–200 g/ml) or vehicle (0.9% NaCl) for 48 h. At the end of incubation, supernatant was collected from each well and glycerol content was determined by the method of Sturgeon et al. (1979).
0
0
2
8
10
Weeks
20
Fig. 1. Effect of Clerodendron glandulosum.Coleb extract on body weight. Results are expressed as means ± S.E.M, n = 6. Where, # p < 0.05, ## p < 0.01, ### p < 0.001 and NS non-significant compared with LEAN, * p < 0.05, ** p < 0.01 and *** p < 0.001 and ns non-significant compared with OB.
R.N. Jadeja et al. / Journal of Ethnopharmacology 135 (2011) 338–343
341
3.5. Microscopic and morphometric evaluation of epididymal fat pad
Fig. 2. Effect of Clerodendron glandulosum.Coleb extract on real time qPCR analysis of PPAR␥, SREBP1c, leptin, FAS and CPT-1 mRNA expression. Results are expressed as means ± S.E.M, n = 6. Where, # p < 0.05, ## p < 0.01, ### p < 0.001 and NS non-significant compared with LEAN, * p < 0.05, ** p < 0.01 and **** p < 0.001 and ns non-significant compared with OB.
Microscopic evaluation of epididymal fat pad of OB mice recorded adipocyte hypertrophy characterized by significant increase (p < 0.05) in adipocyte diameter (98.09 ± 5.65 vs. 44.53 ± 3.43 m) and surface area (6000 ± 115 vs. 1200 ± 100 m2 ) along with reduction in the adipocyte number (120 ± 12 vs. 270 ± 100 cells/1 × 106 mm2 ) compared to LEAN mice. However, OB + CG mice recorded significant decrement (p < 0.05) in adipocyte diameter (53.03 ± 3.43 vs. 98.09 ± 5.65 m) and surface area (1700 ± 145 vs. 6000 ± 115 m2 ) along with higher number of adipocytes (175 ± 15 vs. 120 ± 12 cells/1 × 106 mm2 ) compared to OB mice. 3.6. Cytotoxicity assay in 3T3L1 pre-adipocytes
(64.75 ± 2.72 vs. 125.0 ± 8.11 mg/dl) and LEP (20.00 ± 0.96 vs. 43.33 ± 2.69 ng/l) compared to OB mice. Visceral adiposity in OB mice was evident in the form of significant increment (p < 0.05) in the weights of abdominal (0.25 ± 0.06 vs. 0.05 ± 0.006 g), epididymal (0.85 ± 0.09 vs. 0.23 ± 0.04 g) and perirenal (0.20 ± 0.03 vs. 0.04 ± 0.004 g) fat pad after 20 weeks of HFD feeding compared to LEAN mice. However, OB mice supplemented with CG extract showed significant attenuation (p < 0.05) in weights of abdominal (0.16 ± 0.05 vs. 0.25 ± 0.06 g), epididymal (0.47 ± 0.05 vs. 0.85 ± 0.09 g) and perirenal (0.11 ± 0.05 vs. 0.20 ± 0.03 g) fat pad weights compared to OB mice.
3.4. Quantitative RT-PCR (qPCR) analysis High fat diet fed OB mice recorded significant increment (p < 0.05) in mRNA expression of PPAR␥, SREBP1c, FAS and LEP while; CPT-1 was significantly decreased compared to lean mice. HFD feeding induced increment in the mRNA expression of PPAR␥, SREBP1c, FAS and LEP and decrement (p < 0.05) in the expression of CPT-1, were significantly prevented by CG extract supplementation to OB mice (Fig. 2).
Cytotoxicity analysis of CG extract in pre adipocyte cells revealed non-significant alteration in cell viability at the dose range of 10–1000 g/ml (data not shown). 3.7. Qualitative and quantitative analysis of adipocyte differentiation Oil red O staining of differentiated adipocytes at the end of 12 days revealed significant cytoplasmic lipid accumulation in the untreated differentiated adipocytes while, CG extract supplementation to differentiating 3T3L1 pre-adipocytes significantly reduced adipocyte differentiation, characterized by lesser cytoplasmic lipid accumulation. Quantitative analysis of Oil red O staining revealed a 30–70% reduction in adipogenesis compared to untreated differentiated adipocytes. 3.8. Triglyceride accumulation and, leptin release from differentiated adipocytes Fig. 3A and B shows LEP release and, TG accumulation from un-supplemented and CG supplemented differentiated adipocytes
Fig. 3. Effect of Clerodendron glandulosum.Coleb extract on in vitro (A) leptin release, (B) triglyceride accumulation, (C) glycerol release and (D) G3PDH activity. Results are expressed as means ± S.E.M, n = 3. Where, * p < 0.05, ** p < 0.01 and *** p < 0.001 and ns non-significant compared 0 g/ml CG.
342
R.N. Jadeja et al. / Journal of Ethnopharmacology 135 (2011) 338–343
at the end of 12 days. CG extract supplementation to differentiating adipocytes recorded significant decrement (p < 0.05) in cellular TG accumulation and LEP release compared to differentiated unsupplemented adipocytes (Fig. 3A and B). 3.9. Glycerol release and G3PDH activity assay CG extract supplementation to differentiating pre-adipocytes resulted in higher indices (p < 0.05) of glycerol release and lowered cellular G3PDH activity compared to untreated differentiated adipocytes (Fig. 3C and D). 4. Discussion In the present study, CG supplementation to OB mice prevented HFD induced increment in body weight, lee index (obesity index) and circulating levels of plasma TG and FFA without significantly altering food and fluid intake. These results are in tune with a previous study from our laboratory reporting reduced absorption of lipids through intestine and excretion of the same through faeces in CG treated hyperlipidemic rats (Jadeja et al., 2010b). In addition, HFD fed OB mice recorded significant increment in size and mass of abdominal, renal and epididymal fat pads while, this increment was prevented in CG supplemented OB mice. Development of visceral adiposity in HFD fed OB mice was very much evident from the noted adipocyte hypertrophy, decrease in adipocyte number and increase in surface area. CG supplementation of OB mice reversed these set of changes in the histoarchitecture of adipocytes, thus further justifying the role of CG in controlling HFD induced visceral adiposity. LEP secretion by adipose tissue is directly correlated to adipocyte TG accumulation and hence, circulating LEP level is an ideal indicator of assessing obesity in both experimental animals and humans (Maffei et al., 1995; Wang et al., 2010). TG accumulation and adipocyte hypertrophy are synonymous with increment in plasma LEP titres in OB mice (Kim et al., 2008a) and our observations are in accordance with this report. In this context, lower plasma LEP titre recorded in CG supplemented OB mice is attributable to lowered TG accumulation and prevention of adipocyte hypertrophy. In the past few decades, the role of PPAR␥-2 and SERBP1c in regulation of obesity and adipocyte differentiation (Chien et al., 2005; Brown and Goldstein, 1997; Kim et al., 2008b; Oben et al., 2008) has been highlighted and hence, PPAR␥-2 agonists and antagonists of synthetic or herbal origin have gained wide commercial popularity as therapeutic agents (Nerurkar et al., 2010; Watanabe et al., 2010). Significant up regulation of PPAR␥-2 and SERBP1c mRNA expressions in the present study are in accordance with the previous reports (Lee et al., 2008; Watanabe et al., 2010). The upregulation of these genes are significantly attenuated by CG extract as seen by the levels of their transcripts in OB mice supplemented with CG. 3T3L1 pre-adipocyte differentiation, TG accumulation, LEP release and G3PDH activity were significantly reduced by exposure of differentiating adipocytes to CG extract. Effective prevention of obesity in vivo and differentiation of pre-adipocytes in vitro by CG extract can be attributed to active phytochemical principle(s) present in CG extract that can antagonise PPAR␥-2 and LEP gene expressions, necessitating further in depth analysis. PPAR␥-2 also plays a key role in lipid metabolism via pronounced expressions of lipoprotein lipase and fatty acid binding protein (Schoonjans et al., 1996; Way et al., 2001). Further, PPAR␥2 mediated up-regulation of FAS and down regulation of CPT-1 expression in adipose tissue indicates PPAR␥-2 induced shift of lipid metabolism towards anabolism (Lee et al., 2008). Significant down regulation of PPAR␥-2 and FAS along with up-regulation of
CPT-1 expressions seen in CG supplemented mice herein provide ample testimony to the potential of the extract to abrogate the HFD induced metabolic alteration leading to obesity. Further, substantiation to the inferred efficacy of CG extract is provided by the noted increment in glycerol release from CG extract exposed adipocytes in vitro. 5. Conclusion Overall, it can be concluded from the present study that, antiobesity potential of Clerodendron glandulosum.Coleb is mediated via down-regulation of PPAR␥-2 expression and its downstream pathway. This study is the first scientific report that provides convincing ethnopharmacological evidence for the relevance of CG as a herb with anti-obesity properties; thus providing scientific validity to its traditional consumption by the local populace of North East India. Acknowledgements The authors (R.N.J and M.C.T) are grateful to University Grants Commission, New Delhi for providing Financial Assistance in the form of RFSMS scholarship. Thanks are also due to research staff of Department of Animal Biotechnology and Department of Animal Genetics and Breeding, College of Veterinary Science and Animal Husbandry, Anand Agriculture University, Anand, Gujarat, India for their kind support and expert guidance during real time PCR analysis work. References Aronne, L.J., Isoldi, K.K., 2007. Overweight and obesity: key components of cardiometabolic risk. Clinical Cornerstone 8, 29–37. Brown, M.S., Goldstein, J.L., 1997. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331–340. Chien, P.J., Chen, Y.C., Lu, S.C., Sheu, F., 2005. Dietary flavonoids suppress adipogenesis in 3T3-L1 preadipocytes. Journal of Food and Drug Analysis 13, 168–175. Deb, S., Arunachalam, A., Das, A.K., 2009. Indigenous knowledge of Nyishi tribes on traditional agroforestry systems. Indian Journal of Traditional Knowledge 8, 41–46. Hata, K., Hiwatashi, K., Itoh, M., Suzuki, N., Watanabe, T., Takahashi, J., Sasaki, H., 2008. Inhibitory effects of lupeol on 3T3-L1 preadipocyte differentiation. Phytochemistry Letters 1, 191–194. Itaya, K., Ui, M., 1965. Colorimetric determination of free fatty acids in biological fluids. Journal of Lipid Research 6, 16–20. Jadeja, R.N., Thounaojam, M.C., Ansarullah, Devkar, R.V., Ramachandran, A.V., 2009. A preliminary study on hypolipidemic effect of aqueous leaf extract of Clerodendron glandulosum.Coleb. International Journal of Green pharmacy 3, 285–289. Jadeja, R.N., Thounaojam, M.C., Ansarullah, Patel, V.B., Devkar, R.V., Ramachandran, A.V., 2010a. Protective effect of Clerodendron glandulosum. extract against experimentally induced metabolic syndrome in rats. Pharmaceutical Biology 48, 1312–1319. Jadeja, R.N., Thounaojam, M.C., Ansarullah, Devkar, R.V., Ramachandran, A.V., 2010b. Clerodendron glandulosum.Coleb., Verbenaceae, ameliorates high fat dietinduced alteration in lipid and cholesterol metabolism in rats. Revista Brasileira De Farmacognosia 20, 117–123. Jadeja, R.N., Thounaojam, M.C., Dandekar, D.S., Devkar, R.V., Ramachandran, A.V., 2010c. Clerodendron glandulosum.Coleb extract ameliorates high fat diet/fatty acid induced lipotoxicity in experimental models of non-alcoholic steatohepatitis. Food and Chemical Toxicology 48, 3424–3431. Jadeja, R.N., Thounaojam, M.C., Ansarullah, Jadav, S.V., Patel, M.D., Patel, D.K., Salunke, S.P., Padate, G.S., Devkar, R.V., Ramachandran, A.V., 2011. Toxicological evaluation and hepatoprotective potential of Clerodendron glandulosum.Coleb leaf extract. Human and Experimental Toxicology 30, 63–70. Kala, C.P., 2005. Ethnomedicinal botany of the Apatani in the eastern Himalayan region of India. Journal of Ethnobiology and Ethnomedicine 1, 11. Kim, K.Y., Lee, H.N., Kim, Y.J., Park, T., 2008a. Garcinia cambogia extract ameliorates visceral adiposity in C57BL/6J mice fed on a high-fat diet. Bioscience, Biotechnology, and Biochemistry 72, 1772–1780. Kim, Y.J., Kim, K.Y., Kim, M.S., Lee, J.H., Lee, H.P., Park, T., 2008b. A mixture of the aqueous extract of Garcinia cambogia, soy peptide and l-carnitine reduces the accumulation of visceral fat mass in rats rendered obese by a high fat diet. Genes and Nutrition 2, 353–358. Lee, M.S., Kwun, I.S., Kim, Y., 2008. Eicosapentaenoic acid increases lipolysis through up-regulation of the lipolytic gene expression and down-regulation of the
R.N. Jadeja et al. / Journal of Ethnopharmacology 135 (2011) 338–343 adipogenic gene expression in 3T3-L1 adipocytes. Genes and Nutrition 2, 327–330. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. Journal of Biological Chemistry 193, 265–275. Maffei, M., Halaas, J., Ravussin, E., Pratley, R.E., Lee, G.H., Zhang, Y., Fei, H., Kim, S., Lallone, R., Ranganathan, S., 1995. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Natural Medicine 1, 1155–1161. Nerurkar, P.V., Lee, Y.K., Nerurkar, V.R., 2010. Momordica charantia (bitter melon) inhibits primary human adipocyte differentiation by modulating adipogenic genes. BMC Complementary and Alternative Medicine 10, 34. Oben, J.E., Ngondi, J.L., Blum, K., 2008. Inhibition of Irvingia gabonensis seed extract (OB131) on adipogenesis as mediated via down regulation of the PPARgamma and leptin genes and up-regulation of the adiponectin gene. Lipids in Health and Disease 7, 44. Schoonjans, K., Peinado-Onsurbe, J., Lefebvre, A.M., Heyman, R.A., Briggs, M., Deeb, S., Staels, B., Auwerx, J., 1996. PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO Journal 15, 5336–5348. Shah, A., Mehta, N., Reilly, M.P., 2008. Adipose inflammation, insulin resistance, and cardiovascular disease. Journal of Parenteral and Enteral Nutrition 32, 638–644. Sturgeon, R.J., Deamer, R.L., Harbison, H.A., 1979. Improved spectrophotometric determination of glycerol and its comparison with an enzymatic method. Journal of Pharmaceutical Sciences 68, 1064–1066. Thounaojam, M.C., Jadeja, R.N., Dandekar, D.S., Devkar, R.V., Ramachandran, A.V., 2010. Sida rhomboidea.Roxb extract alleviates pathophysiological changes
343
in experimental in vivo and in vitro models of high fat diet/fatty acid induced non-alcoholic steatohepatitis. Experimental and Toxicologic Pathology, doi:10.1016/j.etp.2010.08.009. Trease, G.E., Evans, W.C., 1987. A Text Book of Pharmacognosy. ELSB Baillere Tindal, Oxford, p. 1055. Wang, G., Liu, X., Christoffel, K.K., Zhang, S., Wang, B., Liu, R., Li, Z., Liu, X., Brickman, W.L., Zimmerman, D., Xu, X., Wang, X., 2010. Prediabetes is not all about obesity: association between plasma leptin and prediabetes in lean rural Chinese adults. European Journal of Endocrinology 163, 243–249. Watanabe, T., Hata, K., Hiwatashi, K., Hori, K., Suzuki, N., Itoh, H., 2010. Suppression of murine preadipocyte differentiation and reduction of visceral fat accumulation by a Petasites japonicus ethanol extract in mice fed a high-fat diet. Bioscience Biotechnology and Biochemistry 74, 499–503. Way, J.M., Harrington, W.W., Brown, K.K., Gottschalk, W.K., Sundseth, S.S., Mansfield, T.A., Ramachandran, R.K., Willson, T.M., Kliewer, S.A., 2001. Comprehensive messenger ribonucleic acid profiling reveals that peroxisome proliferator-activated receptor gamma activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142, 1269–1277. WHO, 2003. Obesity and Overweight. Global Strategy on Diet, Physical Activity and Health. WHO, Geneva. Wise, L.S., Green, H., 1979. Participation of one isozyme of cytosolic glycerophosphate dehydrogenase in the adipose conversion of 3T3 cells. Journal of Biological Chemistry 254, 273–275.
