PLEASE SUPPLY SHORT TITLE
HINTS AND TIPS
201
An Efficient Bipartite PCR Technique to Introduce Specific Changes in Large Plasmids Kevin Davis,1 Graham Ladds,2 Anamika Das,2 Alan Goddard,2 and John Davey*,2 Abstract Amplifying an entire double-stranded plasmid by an inverse polymerase chain reaction (PCR) using a pair of tail-to-tail primers is a particularly efficient approach for introducing changes into DNA sequences. However, the approach generally works best for plasmids less than 5 Kb and it can be difficult to amplify the large multicomponent vectors that are used for protein expression in various eukaryotic cells. We have therefore adopted an alternative approach in which two smaller PCR products are generated and then ligated to produce the complete plasmid. A mutagenic primer is used to introduce the desired change and each reaction includes one of a pair of tail-to-tail primers from within an antibiotic resistance gene contained on the plasmid so that the two PCR products contain complementing parts of the complete gene. Ligating the two products generates various combinations but only the correctly ligated molecules recreate the antibiotic resistance gene and are able to replicate in Escherichia coli. When combined with methods to minimize the carryover of template plasmid, this can be an efficient way of introducing mutations into large plasmids. Index Entries: Site-directed mutagenesis; PCR; large plasmid; antibiotic resistance.
Site-directed mutagenesis is a powerful approach for exploring protein structure and function, and many different techniques have been developed to introduce specific changes in the amino acid residues of a wild-type protein (1). Most approaches involve a polymerase chain reaction (PCR) in which a mutagenic primer is used to amplify a particular section of DNA. The product, incorporating the changes directed by the mutagenic primer, is then used to generate a mutated construct. For target sequences available in plasmids, a particularly efficient method is to use inverse PCR (2,3). In this approach a pair of tailto-tail primers is made from the site of the desired mutation and used to amplify the entire double-stranded plasmid containing the desired gene. To introduce mutations, one of the two primers used is mutagenic. The resulting linear double-stranded PCR product is then circularized
by ligating the two blunt ends and introduced into Escherichia coli for propagation and analysis. Inverse PCR is simple and effective and has been used to generate mutant plasmids as large as 11 Kb (2). However, it generally works best for plasmids less than 5 Kb and it can be difficult to amplify large plasmids. The technique is therefore unsuitable for many of the multicomponent vectors used for protein expression in various systems. For example, yeast expression vectors contain elements that allow replication and selection in both bacteria and yeast, as well as the transcriptional and translational elements required for expression of the cloned gene. Plant and mammalian expression vectors contain the equivalent elements. Because inverse PCR can be very inefficient on such large templates, we have developed an alternative approach in which two smaller PCR products are generated and then ligated to produce the complete
*Author to whom all correspondence and reprint requests should be addressed. 1Wellcome Trust Biocentre, University of Dundee, Dow Street, Dundee DD1 5EH, UK; 2 Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK. E-mail:
[email protected]. Molecular Biotechnology © 2004 Humana Press Inc. All rights of any nature whatsoever reserved. 1073–6085/2004/28:3/201–204/$25.00
MOLECULAR BIOTECHNOLOGY
201
Volume 28, 2004
202 plasmid. Using a mutagenic primer allows the introduction of specific changes and each reaction includes one of a pair of tail-to-tail primers from within an antibiotic gene present on the plasmid. The two PCR products therefore contain complementing parts of the antibiotic resistance gene. Ligating the two products generates various combinations, but only the correctly ligated molecules recreate the antibiotic resistance gene and are able to replicate in E. coli. We routinely use this approach to introduce single nucleotide changes into a variety of G protein-coupled receptors cloned into the pREP expression vector for the fission yeast Schizosaccharomyces pombe. An example of the approach is illustrated in Fig. 1. The pREP series of Sz. pombe vectors allows expression of genes under the control of the thiamine-repressible nmt1 promoter (4). They replicate in both bacteria and yeast and have AmpR for selection in E. coli and LEU2 or Ura4 selection in Sz. pombe. Their large size (8.8 Kb) and the limited number of unique cloning sites available for introducing DNA fragments downstream of the nmt1 promoter can complicate cloning projects. As a consequence, introducing changes into the cloned fragment by inverse PCR or by subcloning PCR products is often inefficient. We therefore designed a pair of tail-to-tail primers complementary to a region within the AmpR gene of the plasmid. Separate PCR reactions are carried out to produce the two complementing parts of the plasmid, which are then purified, ligated together, and used to transform E. coli. Although several ligation products are possible, only the correctly ligated construct generates a self-replicating plasmid that confers resistance to ampicillin. Precise experimental details will depend on the properties of the plasmid and the desired mutation, but a few general points should be considered. The PCR amplification should be with a DNA polymerase that has proofreading activity to minimize the introduction of undesirable mutations. Several options are available, we routinely use Pwo DNA polymerase from Pyrococcus woesei (Roche, UK). The PCR products should be purified before
MOLECULAR BIOTECHNOLOGY
Davis et al. ligation. Agarose gel electrophoresis followed by purification with gel extraction columns (QIAGEN Limited, UK) is preferred as this reduces carryover of template DNA. Ligations are performed with equimolar amounts of the two PCR products but varying the total concentration of DNA can influence the efficiency of the process, too low a concentration may favor intramolecular rather than intermolecular ligations, whereas too high a concentration could produce multimers. For our constructs, a total of about 200 ng of DNA in a 10-µL ligation is usually appropriate. Of course, ligations require phosphates at the 5' terminus of the PCR products and this can be achieved by phosphorylating either the primers in advance or the PCR products afterward. Despite purifying the PCR products the carryover of template DNA can be a problem, resulting in a lower mutagenesis efficiency. Using the wild-type template at a low concentration minimizes the carryover but proactive steps can also be taken to remove the template DNA. Preparing the template from a Dam+ strain of E. coli so that it is extensively methylated and then treating the PCR reactions with DpnI, a methylation-dependent restriction enzyme, will degrade the template (2). The mutant strand synthesized in vitro is not methylated and not degraded by DpnI. An alternative is to use alkali-denatured plasmid DNA templates, which makes the template less efficient in bacterial transformations (5), but this can also reduce its efficiency as a PCR template. In conclusion, we find this to be an efficient and routinely successful technique for introducing changes into genes within large plasmids. The technique can be adapted for any selected marker and would be suitable for most large plasmids.
Acknowledgments This work was supported by Cancer Research UK (K. D.) and PhD studentships from the Biotechnology and Biological Sciences Research Council (A. D., A. G.). G. L. is a Research Fellow of the University Hospitals of Coventry and Warwickshire NHS Trust.
Volume 28, 2004
PLEASE SUPPLY SHORT TITLE
203
Fig. 1. Bipartite PCR to introduce specific changes in large plasmids. The example illustrated uses bipartite PCR to introduce a change in a DNA sequence encoding a GPCR that has been cloned into the fission yeast pREP expression vector. Inverse PCR using primer P1 (includes an introduced base change, indicated by *) and primer P2 failed to amplify the complete plasmid (approx 10.9 Kb). The tail-to-tail primers JO1357 (TCAGAAGTAAGTTGGCCGCAGTG) and JO1358 (CAACGATCGGAGGACCGAAGGAGC) anneal to adjacent sequences within the AmpR gene in the pREP vector. PCR (annealing temperature of 50oC, 6-min extension at 72oC, 30 cycles) using primer P1 with JO1357 (expected product approx 4.9 Kb) and primer P2 with JO1358 (expected product approx 6.0 Kb) gave products of the expected size. The reactions were treated with DpnI to degrade the template plasmid and the two PCR products purified from the agarose gel using QIAGEN gel extraction columns. Ligating the two products generates a number of possible combinations but only the complete mutagenized plasmid correctly regenerates the AmpR gene and can be replicated in E. coli.
MOLECULAR BIOTECHNOLOGY
203
Volume 28, 2004
204
Davis et al. References
1. 1 Ling, M. M. and Robinson, B. H. (1997) Approaches to DNA mutagenesis: an overview. Anal. Biochem. 254, 157–178. 2. 2 Gatlin, J., Campbell, L. H., Schmidt, M. G., and Arrigo, S. J. (1995) Direct-rapid (DR) mutagenesis of large plasmids using PCR. BioTechniques 19, 559– 564.
MOLECULAR BIOTECHNOLOGY
3. 3 Rabhi, I., Guedel, N., Chouk, I., et al. (2004) A novel simple and rapid PCR-based site-directed mutagenesis method. Mol. Biotechnol. 26, 27–34. 4. 4 Maundrell, K. (1993) Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123, 127–130. 5. Dorrell, N., Gyselman, V. G., Foynes, S., Li, S-R., and Wren, B. W. (1996) Improved efficiency of inverse PCR mutagenesis. BioTechniques 21, 604–606.
Volume 28, 2004
