Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180
Contents lists available at ScienceDirect
Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb
Amino acid discrimination by the nuclear encoded mitochondrial arginyl-tRNA synthetase of the larva of a bruchid beetle (Caryedes brasiliensis) from northwestern Costa Rica Anne-Katrin Leisinger a, Daniel H. Janzen b, Winnie Hallwachs b, Gabor L. Igloi a, * a b
Institute of Biology, University of Freiburg, Schaenzlestr. 1, 79104 Freiburg, Germany Biology Department, University of Pennsylvania, Philadelphia, PA 19104-6313, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 14 August 2013 Received in revised form 9 October 2013 Accepted 11 October 2013
L-canavanine,
Keywords: Mitochondrial arginyl-tRNA synthetase L-canavanine Caryedes brasiliensis Amino acid discrimination
the toxic guanidinooxy analogue of L-arginine, is the product of plant secondary metabolism. The need for a detoxifying mechanism for the producer plant is self-evident but the larvae of the bruchid beetle Caryedes brasiliensis, that is itself a non-producer, have specialized in feeding on the Lcanavanine-containing seeds of Dioclea megacarpa. The evolution of a seed predator that can imitate the enzymatic abilities of the host permits us to address the question of whether the same problem of amino acid recognition in two different kingdoms has been solved by the same mechanism. A discriminating arginyl-tRNA synthetase, detected in a crude C. brasiliensis larval extract, was proposed to be responsible for insect’s ability to survive the diet of L-canavanine (Rosenthal, G. A., Dahlman, D. L., and Janzen, D. H. (1976) A novel means for dealing with L-canavanine, a toxic metabolite. Science 192, 256e258). Since the arginyl-tRNA synthetase of at least three genetic compartments (insect cytoplasmic, insect mitochondrial and insect gut microflora) may participate in conferring L-canavanine resistance, we investigated whether the nuclear-encoded C. brasiliensis mitochondrial arginyl-tRNA synthetase plays a role in this discrimination. Steady state kinetics of the cloned, recombinant enzyme have revealed and quantified an amino acid discriminating potential of the mitochondrial enzyme that is sufficient to account for the overall L-canavanine misincorporation rate observed in vivo. As in the cytoplasmic enzyme of the Lcanavanine producer plant, the mitochondrial arginyl-tRNA synthetases from a specialist seed predator relies on a kinetic discrimination that prevents L-canavanine misincorporation into proteins. Ó 2013 Elsevier Ltd. All rights reserved.
1. Introduction The ability of the larvae of the bruchid beetle Caryedes brasiliensis (Bruchidae) to feed and develop on the L-canavanine-rich content of the seeds of Dioclea megacarpa (Rosenthal et al., 1976) (sometimes incorrectly called Dioclea violacea (Kalacska et al., 2004) is considered to be the classic and text book example of predator e host co-evolution (Rausher, 2001; Rodgers and Shiozawa, 2008). D. megacarpa seeds contain as much as 13% (dry weight) of the generally toxic secondary metabolite L-canavanine (L-2-amino-4-(guanidinooxy)butyric acid). This uncommon amino acid is a structural analogue of L-arginine. However, C. brasiliensis larvae do not incorporate it into proteins, which would render them * Corresponding author. Tel.: þ49 7612032722. E-mail addresses:
[email protected] (A.-K. Leisinger),
[email protected] (D.H. Janzen),
[email protected] (W. Hallwachs),
[email protected] (G.L. Igloi). 0965-1748/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.ibmb.2013.10.004
non-functional (Rosenthal, 1991), because the bruchid’s arginyltRNA synthetase can discriminate between the two amino acids (Rosenthal et al., 1976). This specialist beetle larvae use the L-canavanine as a dietary source of nitrogen (Rosenthal et al., 1977). Within the family of aminoacyl-tRNA synthetases, arginyl-tRNA synthetases belong to the group of non-proofreading enzymes that maintain the fidelity that is crucial for accurate protein biosynthesis, by, for example, induced fit type mechanisms (Uter et al., 2005). We have previously performed analyses of recombinant arginyl-tRNA synthetases from jack bean, Canavalia ensiformis, (which contains L-canavanine) and soybean, Glycine max, (which contains no L-canavanine) (Igloi and Schiefermayr, 2009) and have demonstrated a modest kinetic discrimination between L-arginine and L-canavanine for the jack bean enzyme in vitro. The evolution of a seed predator that possesses an enzyme with similar properties to that of the host permits us to address the question of whether the same problem of amino acid recognition in two different kingdoms has been solved by the same mechanism.
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180
The use of Caryedes larval extracts to establish the substrate specificity of the arginyl-tRNA synthetase was pioneered by Rosenthal et al. (1976). Whereas there is no basis for questioning the discrimination found between L-arginine and L-canavanine, the form of publication required an abridged description of the experimental procedure so that a number of details of relevance to the interpretation of the results are lacking. In addition no distinction was made as to whether the discrimination ability was achieved by the beetle larva or its gut microflora or both. In the decades following the original examination of crude C. brasiliensis extracts (Rosenthal et al., 1976), advances in genetics and molecular biology have revealed complexities of which there was no awareness. Specifically, insects were referred to as having a single arginyltRNA synthetase but we now realize that metazoan mitochondrionencoded tRNAs have idiosyncratic structures (Watanabe, 2010) requiring their own nuclear coded cognate mitochondrial aminoacyl-tRNA synthetases. This complicates original interpretations since components from three discrete genetic systems e the insect’s nucleus, mitochondria and gut microbes e may participate in the L-canavanine tolerance/utilization by C. brasiliensis. L-canavanine has been implicated in mitochondrial protein synthesis in rat liver (Winston and Bosmann, 1971) and can, thus, be imported into the mitochondria to become a component of the mitochondrial amino acid pool. The enzymatic properties of a metazoan mitochondrial arginyl-tRNA synthetase has not been documented for any organism. We have focused our attention on the substrate properties of the C. brasiliensis mitochondrial arginyltRNA synthetase that was cloned and expressed in E. coli. We have performed steady state kinetic studies that show that the mitochondrial arginyl-tRNA synthetase possess a kinetic discriminatory capacity between L-arginine and L-canavanine. We have thus established that a kinetic mechanism that prevents the incorporation of L-canavanine into plant proteins (Igloi and Schiefermayr, 2009) has been replicated in the mitochondrial arginyl-tRNA synthetase of C. brasiliensis. 2. Material and methods C. brasiliensis larvae were obtained in late February 2004 by harvesting infested D. megacarpa seeds in Sector Santa Rosa of the Àrea de Conservaciòn Guanacaste (ACG), northwestern Costa Rica (http://www.acguanacaste.ac) under the terms of a mutual Material Transfer Agreement between DHJ and ACG. A Costa Rican export license (DGVS-102-2004) permitted their transfer to Germany. The larvae were transported in the seeds to the laboratory because they die soon after being extracted from the seed. Seeds were cut open and the larvae (several dozen per seed) removed with forceps and either used directly or frozen in liquid nitrogen and stored at 80 C until required. Recombinant E. coli arginyltRNA synthetase was prepared, as published (Aldinger et al., 2012b). The sources of amino acid analogues were given in a previous publication (Igloi and Schiefermayr, 2009). The E. coli strain overexpressing its tRNA nucleotidyl transferase was kindly provided by Dr Alan Weiner (Seattle). Aminoacylation with [14C]labelled amino acids was carried out at 30 C in 50 ml reactions in the presence of 50 mM Hepes, pH7.5, 10 mM MgCl2, 4 mM ATP, 17.5 mM [14C]-L-arginine (300 mCi/mmol; Perkin Elmer) and 10 mg tRNA. 10 ml aliquots were removed and spotted onto 5% TCA-pretreated Whatman 3 MM discs, washed twice with 5% TCA and once with ethanol before drying and quantification by liquid scintillation counting. Unless otherwise stated, results are representative of at least duplicate determinations, with different enzyme and in vitro transcript preparations. [32P]-pyrophosphate exchange was performed as described previously (Igloi and Schiefermayr, 2009)
1173
using charcoal-impregnated filters (Simlot and Pfaender, 1973) (Munktell). Arginyladenylate formation was followed in a 10-ml reaction containing 0.1 mM a-[32P]-ATP (Hartmann Analytic), 50 mM Hepes pH 7.5, 10 mM MgCl2, 0.1 U/ml inorganic pyrophosphatase (Sigma) in the presence or absence of amino acid (1 mM L-arginine or 10 mM L-canavanine) and mitochondrial tRNAArgUCG transcript (18 mg). After 15 min at 30 C, 3 ml 3 M NaOAc, pH 4.9 was added and 1 ml was applied to PEI-cellulose plates (Merck) (which had been prewashed). AMP and arginyladenylate standards were obtained by treating either charged or uncharged 30 -terminally a-[32P]-AMP labelled E. coli tRNAArgACG with nuclease P1 (Wolfson and Uhlenbeck, 2002). The 30 -arginyladenylate generated is expected to have chromatographic properties indistinguishable from the potential 50 -arginyladenylate intermediate (Gruic-Sovulj et al., 2005). The TLC plates were developed in 0.1 M NH4OAc/5% AcOH. 2.1. In vitro transcription For efficient in vitro transcription of the mitochondrial tRNAArgene, position A1 was replaced by G (Puglisi et al., 1993). In vitro transcription was performed with double stranded tDNA obtained by a Klenow fill-in-reaction using Exo-Minus Klenow DNA Polymerase (Epicenter) and an appropriate 87-mer oligonucleotide template bearing a T7 promoter extension (12040, Table 1). 1 nmol of single stranded template was incubated in a 1 ml reaction volume containing 10 mM TriseHCl pH7.5, 5 mM MgCl2, 2.5 mM dNTPs, 0.75 M betaine, and 3 nmol 30 -terminal-specific 20-mer primer (12041, 50 -terminal 20 OMe nucleotides enhance the quality of the transcript (Francklyn et al., 2008)) for 5 min at 95 C. After cooling in ice for 5 min, 2.5 ml 1 M DTT and 100 U Klenow DNA polymerase were added. Incubation for 1 h at 37 C was followed by ethanol precipitation. A 0.5 ml in vitro transcription contained 1 X T7 RNA polymerase buffer [4% poly(ethyleneglycol)8000, 40 mM TriseHCl, pH 8.0, 12 mM MgCl2, 5 mM dithiothreitol, 1 mM spermidine-HCl, 0.002% Triton X-100], 5 mM NTP, 20 mM GMP, 0.1 U of inorganic pyrophosphatase, 0.7 nmol template DNA and 52 nM T7 RNA polymerase prepared from the recombinant pAR1219 expression plasmid (Davanloo et al., 1984). The reaction mixture was incubated for 4 h at 42 C, purified over NAP-5 gel filtration column (GE Healthcare). DNase digestion was performed in a 0.5 ml reaction with 1X DNase buffer and 1 U DNase (Fermentas) for 30 min at 37 C. The reaction mixture was phenol extracted and ethanol precipitated. Confirmation that the homogeneity of the tRNA transcript was greater than 90%, was obtained by electrophoresis on 10% denaturing polyacrylamide gels. The tRNA was refolded by heating the solution for 5 min to 70 C, followed by slow cooling in the presence of 25 mM TriseHCl, pH 7.5 and 5 mM MgCl2. The cytoplasmic C. brasiliensis tRNAArgACG transcript was prepared analogously.
g UCG
2.2. C. brasiliensis total RNA Total C. brasiliensis RNA was isolated from 4 larvae (ca. 300 mg), ground in liquid N2. Using the RNeasy protocol (Qiagen) they yielded approximately 14 mg RNA. 2.3. C. brasiliensis total tRNA 10 g of frozen C. brasiliensis larvae were thawed on ice in 15 ml 10 mM TriseHCl, pH7.4, 10 mM MgCl2. The tissue was disrupted by four treatments with an Ultraturrax (IKA). The extract was centrifuged for 30 min at 10 000 g resulting in three phases; a solid fawn coloured pellet and a brownish clear supernatant covered by a lipid layer. By piercing through the lipid layer, the brown
1174
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180 Table 1 Primers used. The orientation of the sequences is 50 to 30 . Lower case g denotes the þ1 position after the T7 promoter sequence. Tm and Gm are 20 O-methyl T and G, respectively. p, r and d denote phosphate, ribo and desoxyribo, repectively. The 30 -terminal rA of 930669 was periodate oxidized to prevent self-ligation. 011185 993473 930669 09006 10009 10012 10022 10023 10024 10026 10027 10035 10036 11008 11011 12040 12041
GGTGACTGGGGAACACAGTTTGG GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTTTTTT p(rCC)d(CCTCCTTTTATTCACTGGCCGTCGTTTTACTC)(rA)ox GGCATGAGTACNAGRAAAGG ACGAAGACAAAAGGATTACG TGCATTCATCCAGAATATCTTTA Biotin-TTGCTTCGCTCTGTTTAGTA ACAGCAGTGTCAAAGGGTCT GGTATTGCTGAAAGTTCTGG CATGCCATGGCAACTAAACTAAAATTGTACCT GCGGATCCTCACATTGCTTGTAAGGGCTGAAGA CCTCAGGAAACAGATAGACG GCTGAAACTCTATTCATGCTG TCAGGATATTCGTTTTATGGG CCNTTTGAATGTGGRTTTGATCC TTTAATACGACTCACTATAgAATAAGAAGCAAAATTTGCAATTAGTTTCGACCTAAAAGTCTGATGATTTATCATCCTTATTTTCCA TmGmGAAAATAAGGATGATAAATCA
supernatant was removed to 20 ml phenol/chloroform and 4 ml 10% SDS. The mixture was stirred vigorously for 30 min at room temperature and then centrifuged for 15 min at 10 000 g, 4 C. The clear supernatant was removed and 1/10th volume of 20% KOAc, pH 5 was added. Nucleic acids were precipitated by the addition of 2.5 volumes EtOH at 20 C for 2 h. Centrifugation at 10 000 g for 20 min was followed by a wash with 80% EtOH and recentrifugation. The grey pellet, dissolved in 1.5 ml water, produced a brown solution. Selective isolation of tRNA was accomplished by chromatography over DEAE-cellulose (DE52, Whatman) equilibrated in 0.14 M NaOAc, pH 4.5. Application of the tRNA was followed by washing with equilibration buffer followed by a wash with 0.3 M NaCl in equilibration buffer. Elution was achieved with 1 M NaCl in 0.14 M NaOAc, pH 4.5. The tRNA was recovered by EtOH precipitation and was redissolved in water to yield a total of 1.2 mg bulk C. brasiliensis tRNA.
Potter homogenizer. The extract was transferred to a 1.5 ml reaction vessel and the homogenizer rinsed with 0.3 ml 0.1 M HCl. The extracts were mixed by rotation overnight at room temperature. After removal of cell debris by centrifugation, the supernatants were brought to 1 ml with 0.1 M HCl and centrifuged for 10 min at 14 000 g. 100 ml of supernatant was neutralized with 100 ml 0.1 M NaOH and aliquots were taken for colourimetric determination of Lcanavanine content by a micro-procedure (Igloi and Schiefermayr, 2009) adapted from Rosenthal (Rosenthal, 1977). The colour was allowed to develop for 40 min at room temperature and then quantified using a Nanodrop 1000 (Thermo) at 530 nm. A standard curve permitted the estimation of the L-canavanine content in the C. brasiliensis extracts. In this way and in other replicate measurements we determined an average L-canavanine content of approximately 0.5 0.2 mmoles L-canavanine per larva. 2.6. Cytoplasmic arginyl-tRNA synthetase sequence
2.4. Cytoplasmic C. brasiliensis tRNAArgACG The sequence of the cytoplasmic tRNAArgACG was obtained from bulk insect tRNA by an RT/PCR protocol using a 30 -ligated target sequence (930669) (Aldinger et al., 2012a). In view of the high sequence conservation for this tRNA between insect species (not shown) it was expected that a PCR primer encompassing the 20 50 terminal bases of the Drosophila melanogaster (Accession No. V00241) sequence would provide the required product. Sequence determination, in combination with standard base-pairing rules to establish the acceptor stem sequence, and taking universally conserved positions into account, confirmed that the sequence of the C. brasiliensis tRNA has an essentially identical sequence to that of D. melanogaster. Position U16, which occurs as U or C in insects was defined by the PCR primer and may not correspond to the native C. brasiliensis structure. It should be noted, that the sequence derived from the reverse transcribed tRNA revealed the presence of a non-deaminated A34 at the wobble position of the anticodon. As in the case of plants (Aldinger et al., 2012a), inosine is, therefore, not a requirement for decoding CGC codons. 2.5. L-Canavanine content of Caryedes larvae Four individual larvae (total 0.35 g) in one sample and a replicate of 6 individual larvae (total 0.66 g) in another, that had been stored frozen at 80 C for 3 years were thawed in 0.5 ml 0.1 M HCl. A further 1 ml 0.1 M HCl was added to each, mixed and the total surface rinse liquid removed. The two samples were each extensively homogenized in 0.5 ml 0.1 M HCl with several strokes of a
The coding sequence of the cytoplasmic enzyme originated from C. brasiliensis total RNA, of which 1.5 mg had been reverse transcribed using an oligo(dT17V) primer. A gene-specific non-degenerate primer was designed (011185) (Table 1) that corresponds to the sequence GDWGTQF which is highly conserved in all higher eukaryotic arginyl-tRNA synthetases (e.g. position 180 in jack bean Acc. No. AM950325 (Hogg et al., 2008)). Subsequently, this sequence was found to have 3 nt mismatches to the target C. brasiliensis gene. A touch-down PCR procedure in combination with 993473, targeting the T17 tail introduced during cDNA synthesis generated a product of approximately 1300 bp. This was cloned into pCR 2.1-TOPO vector (Life Technologies) and the colony PCR products that were obtained by screening with T7 and T3 primers were sequenced. A clone identified by BLAST analysis as harbouring a fragment of a potential arginyl-tRNA synthetase gene was sequenced in its entirety by primer walking, yielding the 30 -terminal 1300 bp of the C. brasiliensis gene. The sequence of the residual 50 portion was obtained progressively from the cDNA using confirmed C. brasiliensis genespecific primers in combination with degenerate primers from partly conserved regions. The sequence was completed by a 50 RACE method (Sørensen et al., 1996). Sequences were compiled using GAP4 (Bonfield et al., 1995) (Accession No. KF419295). 2.7. Mitochondrial arginyl-tRNA synthetase cloning and recombinant protein expression For the de novo establishment of the C. brasiliensis mitochondrial gene sequence, derived protein sequences from all known
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180
putative insect cytoplasmic and mitochondrial arginyl-tRNA synthetases were aligned (Supplementary Fig. 1A, Supplementary Fig. 2). Targets for mitochondria-specific amplification primers were selected. Attention was focused in particular on the conserved region in the cytoplasmic sequence EDRKKFKTRSG (Position 460e 470 in C. brasiliensis, Supplementary Fig. 1A) for which a characteristic pentapeptide deletion is evident in all higher metazoan mitochondrial sequences (Supplementary Fig. 1B). A combination of an appropriate degenerate primer at this site (09006) with a degenerate primer derived from the frequently observed QYTH motif (D. melanogaster mitochondrial 475) gave, using a touchdown PCR protocol, a 262 bp fragment, whose sequence was identified as originating from the mitochondrial arginyl-tRNA synthetase gene. This formed the nucleus for extending the sequence towards the 30 end, using a gene-specific primer (10009) in combination with an oligo dT17 primer. The 50 end was approached in steps combining the mitochondrial gene-specific primer (10012) with a primer covering the universally conserved GDWGTQ region (C. brasiliensis cytoplasmic 251). Completion was achieved by the 50 RACE procedure of Sørensen et al. (Sørensen et al., 1996) with the gene-specific primers 10022 (biotin labelled) and 10023. Sequences were compiled in GAP4 (Bonfield et al., 1995) (Accession No. KF419296). The coding region for the mitochondrial enzyme was ligated into pET32a (Navogen) using NcoI/BamHI restriction sites. This resulted in a Ser to Ala mutation at position 2. The expression vector generates a fusion protein with thioredoxin and provides a thrombin-removable His-tag. The sequence of clones obtained by transformation of TOP10 E. coli (Life Technologies) cells were confirmed and the plasmid transformed into BL21 CodonPlus RIL cells (Promega). Expression and NiNTA-matrix purification was performed as described (Hogg et al., 2008). To determine the effective arginyl-tRNA synthetase concentration of the partially purified recombinant protein, active site titration (Francklyn et al., 2008) using [a32P]-labelled ATP was performed. The incubation contained 50 mM Hepes pH 7.5, 10 mM MgCl2, 2 mM ATP, 2 mCi [a32P]-ATP, 1 mM Arg, 11 mM mitochondrial tRNAArgUCG transcript, and 3 ml of enzyme in a total volume of 10 ml. 1 ml-aliquots were removed at 30 s intervals for the first two minutes, and after 5 and 10 min incubation times and mixed with 2 ml 1 M NaOAc pH 4.9 at 0 C. Samples of 1 ml were applied to prewashed 10 cm PEI-cellulose TLC plates (Merck) and developed in 0.1 M NH4OAc/5% acetic acid for 15 min. Radioactivity was quantified using a phosphorimager (BioRad). The concentration of the active enzyme is given by the amplitude of the initial burst of AMP formation (Francklyn et al., 2008). 3. Results At the time this study was initiated, no arginyl-tRNA synthetase from any Coleopteran species existed. To ensure that the enzyme activity that was to be investigated originated from the gene coding for the mitochondrial enzyme, the gene for the cytoplasmic enzyme e identifiable by characteristic eukaryotic domains of high sequence similarity e was also sequenced.
predict a cytoplasmic localisation. There is no apparent N-terminal similarity even when comparing C. brasiliensis with either of the only two other coleopteran species for which there is data (Dendroctonus and Tribolium), despite being in the same infraorder (Cucujiformia) (but in different superfamilies). Similarity is recognizable from position 53 onward, beginning with a conserved N, followed by a species-specific domain of heterogeneous length before reaching the GDYQCN(N,S,A)AM motif (123e128) which is an as-yet functionally undefined but conserved domain in all higher eukaryote (insect, plant, vertebrate) sequences (not shown). Extensive stretches of identity cover the conserved arginine binding site sequence (208e264) (Cavarelli et al., 1998) and beyond but identical stretches are reduced to isolated patches after position 559. 3.2. Mitochondrial arginyl-tRNA synthetase Analysis of the PCR products from genomic C. brasiliensis DNA (Primers 10026e10023; 10024e10027; 10035e10036; Table 1), together with cDNA sequence fragments permitted the compilation of the complete coding sequence for the mitochondrial enzyme. The nuclear encoded mitochondrial enzyme, despite its requirement of a targeting sequence, is more than 100 amino acids shorter than the cytoplasmic enzyme, having 563 amino acids with a calculated molecular mass of 64.7 kDa and pI 8.78. The alignment with 27 insect sequences predicted from genomic information (Supplementary Fig. 2) reveals a lower degree of identity than in the cytoplasmic collection; frequently below 35%. The derived N-terminal sequences are highly diverse preventing precise alignment and, in the absence of EST or proteomic data, the identification of the translational start may be misleading. An analysis of the subcellular localization (Small et al., 2004) does not detect mitochondrial targeting signals for all compared sequences (Table 2). This prediction also fails for some proteins derived from EST data. This then may reflect the idiosyncratic nature of insect mitochondrial targeting sequences rather than inaccuracies in gene predictions. Following this heterogeneous region, the first convincing similarity is found at the arginyl-tRNA synthetase signature sequence, FSSPNIAK (C. brasiliensis 119) and is then maintained in short segments for the remaining protein. Bacterial expression resulted in the production of small amounts of soluble enzyme in addition to non-specifically NiNTATable 2 Prediction (Small et al., 2004) of intracellular localization of putative insect mitochondrial arginyl-tRNA synthetase protein sequences. Species are grouped in their respective orders. Those marked with # correspond to sequences for which at least the N-terminus can be derived from EST information. Order
Species
PREDOTAR score for mitochondrial targeting
Hemiptera
Acyrthosiphon pisum#
0.56
Diptera
Aedes aegypti Culex pipiens Anopheles gambiae Drosophila melanogaster Apis mellifera# Bombus terrestris# Atta cephalotes Pogonomyrmex barbatus Camponotus floridanus Nasonia vitripennis# Pediculus humanus Bombyx mori Manduca sexta# Heliconius melpomene Caryedes brasiliensis# Tribolium castaneum
0.24 0.01 0.1 0.03 0.14 0.52 0.09 0.38 0.57 0.01 0.78 0.4 0.06 0 0.54 0.09
Hymenoptera
3.1. Cytoplasmic arginyl-tRNA synthetase The C. brasiliensis genome encodes a cytoplasmic protein of a molecular mass of 76.7 kDa with a calculated pI of 6.38, having 672 amino acids that are readily aligned to the total of 30 complete insect cytoplasmic arginyl-tRNA synthetases whose sequences could be compiled from various databases (Supplementary Fig. 1A). There is a 50% overall identity among the species. When subjected to sub-cellular targeting analysis, the highly variable N-termini
1175
Phthiraptera Lepidoptera
Coleoptera
1176
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180
bound endogenous E. coli protein. Furthermore, the vector-encoded thrombin site was inaccessible to cleavage so that the option of enrichment via a second NiNTA selection was not possible. Removal of the N-terminal thrombin fusion (by NdeI digestion of the pET32a construct, followed by re-ligation) did not improve the soluble expression and had no effect on the enzymatic properties. As in the case of human mitochondrial aspartyl-tRNA synthetase, the soluble fraction of the C. brasiliensis mitochondrial arginyl-tRNA synthetase could be purified to homogeneity by anion exchange chromatography using S15Q resin (GE Healthcare) but on subsequent concentration lost all activity, presumably through aggregation (Gaudry et al., 2012). 3.3. Structural comparison The two arginyl-tRNA synthetases of different evolutionary origins within C. brasiliensis share a 19% sequence identity to each other, as compared with 33% identity of the mitochondrial enzyme with yeast cytoplasmic arginyl-tRNA synthetase (Fig. 1). A comparison of the functional domains defined for the yeast enzyme with the insect arginyl-tRNA synthetases (Supplementary Table 1), shows that the residues involved in L-arginine binding are well conserved. Nevertheless, there are individual substitutions at sites where lethal replacements have been observed in yeast. These
substitutions also occur at corresponding positions in either or both C. brasiliensis structures. For example, G202 (superscripts refer to yeast numbering) is present in all insect mitochondrial sequences but occurs as H in all insect cytoplasmic structures. Similar shifts occur at R350 (mt ¼ R, cy ¼ S), A372 (mt ¼ D, cy ¼ D), S409 (mt ¼ S, cy ¼ K), Y488 (mt ¼ R/K, cy ¼ Y) and S494 (mt ¼ C, cy ¼ T). Interactions with tRNA are governed by features that may not be reflected in a sequence conservation in yeast. A region within the Nterminal domain in yeast(106e109e111) has been associated with recognition of the D-loop of tRNA (Delagoutte et al., 2000). It has been emphasized (Delagoutte et al., 2000) that in other organisms, where tRNAArg Ade20 acts as a major identity element (Aldinger et al., 2012b), N at position 106 in yeast is replaced by a small amino acid to accommodate Ade20. Similarly, in the few insect species whose corresponding gene sequence has been documented, this position in the cytoplasmic enzyme is occupied by A170 for >80% of the species. On the other hand, those N-terminally abbreviated insect mitochondrial enzymes available for analysis have highly variable N-terminal sequences, which may reflect distinct import signals. Binding of the tRNA anticodon is an essential feature for the recognition of tRNA in the arginine system. Binding of the third base of the anticodon (Gua36) in yeast occurs at K439, Y491, R495, R501, Y565 and M607. Of these, the corresponding K439400, Y491450,
Fig. 1. Alignment of C. brasiliensis cytoplasmic (Cyto), mitochondrial (Mito) and Saccharomyces cerevisiae (yeast) cytoplasmic (Accession No. EDV07986) arginyl-tRNA synthetase sequences. Sequences are given as aligned by CLUSTAL OMEGA. Identity of 100% is shown in red; blue denotes greater than 60% identity.
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180
3.4. Mitochondrial tRNAArgUCG Metazoan mitochondrial tRNAs are characterized by idiosyncratic structures (Watanabe, 2010) that are recognized by their cognate aminoacyl-tRNA synthetases. In order to study the C. brasiliensis mitochondrial arginyl-tRNA synthetase, it was necessary to establish the structure of the tRNAArg encoded in its mitochondrial genome. A single insect mitochondrial tRNAArg sequence exists in the database (Accession No. L76674) that of Aedes albopictus (HsuChen et al., 1983), conveying the impression of a limited set of modified bases (m1A9, J28, J32 and J68), as is observed for certain Drosophila mitochondrial tRNAs (Tomita et al., 1999). When compared to the gene sequence from other insects it becomes apparent that these mitochondrial tRNAArg sequences are much more variable than those of their cytoplasmic counterparts for which the C. brasiliensis tRNAArgACG gene has an identical sequence to that of D. melanogaster (Accession No. V00241). Even limiting the comparison to a number of other Coleoptera rather than with the whole insect kingdom, shows that considerable sequence variation in the D- and T-stem/loops and in overall length (60e67 nt) exists (Supplementary Fig. 3) and that only part of the acceptor stem but most of the anticodon stem/loop are highly conserved. Although there is some rearrangement in the order of tRNA genes on the Coleopteran mitochondrial genome (Timmermans and Vogler, 2012), the gene for the single arginine isoacceptor, tRNAArgUCG, is always located between ND3 and ND5. The characterization of this short region of several hundred base pairs was readily achieved by PCR using primers from conserved regions from the flanking protein genes (Primers 11008e11011; Table 1). Performing the analysis on total C. brasiliensis DNA yielded the required ND3 e ND5 fragment, from which sequences for the cluster tRNAAlaUGC, tRNAArgUCG and tRNAAsnGUU (Accession No. KF419299) could be derived using tRNAscan-SE (Schattner et al., 2005). The genes are contiguous to each other and, as is the case in mammalian mitochondria (Levinger et al., 2004), do not encode the 30 -terminal eCCA sequence. A transcript corresponding to mitochondrial tRNAArgUCG-CC was not a substrate for the addition of a 30 -terminal AMP by E. coli nucleotidyl transferase (data not shown). Previous work on bovine mitochondrial tRNAs revealed a charging unilaterality by which eubacterial aminoacyl-tRNA synthetases were unable to charge mitochondrial tRNAs, whereas mitochondrial aminoacyl-tRNA synthetases efficiently accepted bacterial tRNAs (Kumazawa et al., 1991; Fender et al., 2012). An exception is that E. coli arginyl-tRNA synthetase can weakly aminoacylate bovine mitochondrial tRNA. In view of the potential background of E. coli aminoacyl-tRNA synthetases in our recombinant C. brasiliensis mitochondrial arginyl-tRNA synthetase preparation, it was of importance to establish the inability of purified E. coli arginyl-tRNA synthetase to recognize C. brasiliensis mitochondrial tRNAArgUCG (Fig. 2). The purified E. coli enzyme does
however efficiently charge C. brasiliensis cytoplasmic tRNAArgACG whose sequence includes all the major identity elements required for recognition by the bacterial enzyme (Liu et al., 1999). 3.5. Amino acid selection by the recombinant mitochondrial arginyl-tRNA synthetase The use of in vitro transcripts corresponding to tRNA sequences has become a standard procedure since its introduction in the late 1980’s (Sampson and Uhlenbeck, 1988). The level of charging of such tRNAs may be high (Sampson et al., 1989) but especially in the case of metazoan mitochondrial transcripts can be less than 5% (Sissler et al., 2004). The mitochondrial tRNAArgUCG transcript is another example of a substrate whose aminoacylation capacity lies in the low % range. This poor charging level and the low radioactive specific activity of amino acid substrates hindered an accurate determination of the discrimination factor by the conventional aminoacylation assay using [14C]-amino acids. The highly sensitive procedure using [32P]-labelled tRNA (Wolfson and Uhlenbeck, 2002) proved to be impracticable since mitochondrial tRNA is not a substrate for the addition of a 30 -terminal [32P]AMP by E. coli nucleotidyl transferase. Amino acid specificity could be monitored by the pyrophosphate exchange assay. Arginyl-tRNA synthetase is one of a group of enzymes that has an absolute requirement for tRNA in this reaction (Perona and Hadd, 2012). Metazoan mitochondrial arginyl-tRNA synthetase has not been previously examined for this requirement. Despite the structural dissimilarity to the cytoplasmic system, the evolution of the mitochondrial synthetase/tRNA pair has retained the mechanism that demands the tRNA-dependence of this process (Fig. 3), and no detectable arginyladenylate formation is detected in the absence of tRNA. In the presence of tRNA, AMP accumulates as a consequence of aminoacylation. We used the pyrophosphate exchange assay to examine the amino acid specificity of the C. brasiliensis mitochondrial arginyl-tRNA synthetase. LCanavanine activation was detected but none of the natural potential L-arginine analogues proved to be significant substrates (Fig. 4). The inability to accept D-arginine, L-homoarginine, Lcitrulline, L-homocitrulline, L-thiocitrulline, L-lysine and L-albizziine parallels the activity shown for these analogues by the E. coli (Mitra and Mehler, 1967), and cytoplasmic rat (Allende and Allende, 1964), and Neurospora (Nazario and Evans, 1974) enzymes although the arginyl-tRNA synthetase from these organisms readily attach Lcanavanine to their cognate tRNA.
[14C]-Arginyl-tRNA formed (pmol/pmol tRNA)
R495454 (which in yeast also interacts with Ade37) and M607563 are present in the C. brasiliensis mitochondrial enzyme (and at their equivalent cytoplasmic positions). As mutations in yeast at R501 and Y565 are viable, amino acid substitutions at the corresponding insect mitochondrial sites, appear to be under less selective pressure than the other amino acids involved in tRNA binding. Y565 and W569 which interact with Cyt35 in yeast have been found only in the cytoplasmic C. brasiliensis enzyme as Y625 (100% conserved in other insects) and the stacking W569 interaction is replaced by Y629 (nearly 100% conserved). The interactions in yeast that correspond to Ade14, Gua23 and Cyt40 are not clearly defined in the insect structures.
1177
3' A C 5' C G GC GU U A C G CG U A GC UCA U GGUCC G UAAC G CCAGGU C GCG G U UU G A AUAACGC G AG UA CG U A GC A U C A U G 3' ACG A C 5' C U A U A U A U U A A U A U G C C U AC UA U A GA UGAUU A A A C GA U A C U UUGC U A G A AA U A 30 U A A U G C U C U A UCG
a
0.10
0.08
0.06
0.04
b
0.02
0.00
0
10
20
Time (min)
Fig. 2. Heterologous aminoacylation of insect tRNA by E. coli arginyl-tRNA synthetase. Transcripts corresponding to C. brasiliensis cytoplasmic tRNAArgACG (inset a) (circles) and mitochondrial tRNAArgUCG (inset b) (triangles) were assayed for arginine acceptance using E. coli arginyl tRNA synthetase.
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180
80
60
40
20
L-Canavanine
L-Albizziine
L-Lysine
L-Thiocitrulline
L-Homocitrulline
L-Citrulline
0
L-Homoarginine
The specificity of amino acid recognition by aminoacyl-tRNA synthetases forms the basis for the accurate conversion of genetic information into functional proteins. The molecular mechanism involved in this fundamental process of quality control has been the subject of intense study for decades (Yadavalli and Ibba, 2012). Many systems involving discrimination between the common proteinaceous amino acids are now understood to an atomic resolution (Perona and Hadd, 2012). On the other hand, the numerous non-protein amino acids found in, for instance, plants (Vranova et al., 2010) pose a challenge both to the aminoacyl-tRNA synthetases of the plants themselves as well as to those of potential predators. The larvae of the bruchid beetle C. brasiliensis is noted for its ability to thrive on the L-canavanine-rich seeds of D. megacarpa (Janzen, 1971) and has long been viewed as a paradigm of seed predator e food plant chemistry-based co-evolution (Rausher, 2001; Rodgers and Shiozawa, 2008). Parenthetically, this is an incorrect application of the word “co-evolution” (Janzen, 1980), given that there is no logic to suggest that the presence or amounts of L-canavanine in the seed are a response to predation by this species of seed predator, an animal that is not susceptible to Lcanavanine toxicity. In a much-cited study Rosenthal et al. (1976) compared a larval extract from this L-canavanine-tolerant beetle with that from the canavanine-sensitive Lepidopteran, Manduca sexta, in their relative ability to incorporate L-arginine or L-canavanine into tRNA. It was concluded that in this assay the extract from C. brasiliensis was able to distinguish between the two amino acids whereas that from M. sexta could not. Hence, the C. brasiliensis larvae possessed an arginyl-tRNA synthetase that prevents the
100
D-Arginine
4. Discussion
120
L-Arginine
To quantify the discrimination attained between L-arginine and steady state kinetic constants were determined. On the basis of a higher velocity and a tighter binding of L-arginine by the C. brasiliensis enzyme (Table 3), a kinetic discrimination factor at saturating amino acid concentrations of less than 100 was revealed. This is substantially lower than that observed for the jack bean arginyl-tRNA synthetase (factor of 480) but greater than that of the non-canavanine producing soybean enzyme (factor of approximately 40) (Igloi and Schiefermayr, 2009). L-canavanine,
[32P-ATP] formed in 20 min (%)
1178
Fig. 4. Amino acid recognition by C. brasiliensis mitochondrial arginyl-tRNA synthetase as determined by pyrophosphate exchange in the presence of mitochondrial tRNA and a 4 mM concentration of each amino acid.
misincorporation of L-canavanine into proteins. A number of questions remained unanswered. The authors stressed that the bruchid beetle larvae can tolerate and use an appreciable in vivo level of L-canavanine. This fact is of relevance when considering the preparation of cell-free extract which was obtained by mechanical cell lysis of entire larvae and removal of debris. The derived S100 supernatant was used as a source of enzyme activity. Neither an elimination of endogenous tRNA of the plant tissue in the larval gut nor of the larvae themselves was documented. Thus, in the enzyme assay that measures the incorporation of radioactively labelled amino acid into tRNA, the extract contributes not only the enzyme but also an undefined amount of tRNA. Since the two organisms examined are phylogenetically only distantly related the possibility exists that different amounts of tRNA are introduced into the assay. This endogenous tRNA was supplemented with an undefined amount of exogenous tRNA. The organism used as a source for the
Fig. 3. ATP/[32P]-pyrophosphate exchange and adenylate formation by the C. brasiliensis mitochondrial arginyl-tRNA synthetase is tRNA-dependent. Pyrophosphate exchange (A) was assayed using [32P]-pyrophosphate in the presence (triangles) or absence (circles) of mitochondrial tRNAArgUCG. In the absence of L-arginine endogenous exchange was observed neither in the presence (rhomboid) nor absence (squares) of tRNA. Adenylate and AMP formation (B) was followed by TLC using various substrate omissions (Arg ¼ L-arginine, Cav ¼ L-canavanine), as indicated. AMP and arginyladenylate standards are marked by arrows.
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180 Table 3 Kinetic parameters for the discrimination between L-arginine and L-canavanine by the C. brasiliensis mitochondrial arginyl-tRNA synthetase during tRNA-dependent pyrophosphate exchange. Values were obtained in triplicate using identical enzyme and tRNA transcript preparations. L-Arginine
L-Canavanine
1
255.7 26 kcat (min1) 65.0 5.6 kcat (min ) 0.09 0.023 Km (mM) 2.06 0.47 Km (mM) 1 1 1 1 kcat/Km (mM min ) 2841 kcat/Km (mM min ) 31.6 Kinetic discrimination at saturating substrate concentration 89.9.
tRNA was not specified and its purity, given by an A260 nm/A280 nm absorption ratio of 1.2, does not instil confidence in the functionality of the tRNA. There was also no mention of a dialysis step (to remove amino acids released by the mechanical treatment of the larvae). Having quantified the L-canavanine content of the insect larvae (see 2.5), we would estimate that the 100 individuals from which an extract was made by Rosenthal et al. (1976) would, contribute at least 30 mmoles of L-canavanine to give 1.5 mM Lcanavanine in the 20 ml extract volume. If this was not removed, it would compete with the 0.1 mM [14C]-labelled L-canavanine in the charging assay using the C. brasiliensis extract. Finally, the potential influence of C. brasiliensis gut microbes was ignored. During the years following the work of Rosenthal et al., it was discovered that metazoan mitochondrial DNA encodes tRNAs with idiosyncratic, non-canonical structures that require the import of distinct nuclear encoded aminoacyl-tRNA synthetases to support mitochondrial protein synthesis (Watanabe, 2010). Since L-canavanine has been implicated in mitochondrial protein synthesis in rat liver (Winston and Bosmann, 1971) it was of interest to investigate if the C. brasiliensis mitochondrial arginyl-tRNA synthetase could distinguish L-canavanine from L-arginine. Although the recombinant mitochondrial arginyl-tRNA synthetase could be obtained in a highly purified form this proved to be impractical since, as has been observed for another mitochondrial aminoacyl-tRNA synthetase (Gaudry et al., 2012), concentration of the chromatographic fraction led to complete loss of activity. It was, therefore, convenient to retain the residual stabilizing E. coli protein background since any trace of co-purified endogenous E. coli arginyl-tRNA synthetase was shown not to aminoacylate the insect mitochondrial tRNA. The concentration of functional C. brasiliensis arginyl-tRNA synthetase was quantified by an active site titration procedure (Francklyn et al., 2008) that determines ATP consumption during single turn-over conditions. This permitted a quantitative characterisation of the amino acid discrimination by the protein. The strictly tRNA-dependent pyrophosphate exchange, parallels that of other arginyl-tRNA synthetases, although it has not been previously described for the metazoan mitochondrial enzyme. Amino acid recognition, as monitored by this reaction shows that, of the naturally occurring L-arginine analogues, only L-canavanine is appreciably activated. Nevertheless, the C. brasiliensis mitochondrial arginyl-tRNA synthetase could distinguish L-canavanine from L-arginine via a kinetic discrimination. Steady state kinetics reveal a contribution of a factor of about 100 in favor of Larginine at saturating substrate concentrations. However, it is unlikely that with a Km of 2 mM, saturating L-canavanine concentrations are attained within the mitochondria. In rat liver mitochondria, an L-arginine concentration of approximately 0.4 mM has been documented (Freedland et al., 1984). Based on a hypothetical similar L-canavanine concentration one derives a mM] relationship of k[0.4 /Km for L-canavanine in this case of 5.4, cat resulting in a kinetic discrimination in favour of L-arginine of 526. In comparing the observed discrimination factor to the 104 generally expected from systems performing active amino acid editing (Ataide and Ibba, 2006) one should recall that for the L-canavanine
1179
producing jack bean, a value of 480 was obtained (Igloi and Schiefermayr, 2009). A distinction between leucine and isoleucine of similarly modest magnitude (approximately 600) has been described for leucyl-tRNA synthetase from E. coli (Lue and Kelley, 2007). This may be compared with in vivo studies where feeding with radioactive amino acids and analysis of proteins leads to an overall incorporation discrimination of 365:1 in favor of arginine in C. brasiliensis. The canavanine-sensitive tobacco hookworm (Manduca sexta) larvae have an incorporation ratio of 3.3:1 (Rosenthal et al., 1987). Previously, a reduced or modulated translational quality control has been observed in mitochondrial aminoacyltRNA synthetases whose cytoplasmic form possess a hydrolytic proofreading function (Roy et al., 2005; Lue and Kelley, 2005; Karkhanis et al., 2006; Reynolds et al., 2010). Furthermore, a low selectivity in vivo might be compensated by an active proteolytic system (Anand et al., 2013). Yeast arginyl-tRNA synthetase has been the subject of extensive studies and as such is the only eukaryotic arginyl-tRNA synthetase whose crystal structure has been resolved. Analysis of ligand binding has provided evidence for an induced fit type of conformational change (Delagoutte et al., 2000; Geslain et al., 2003; Guigou and Mirande, 2005). Additionally, the related glutaminyltRNA synthetase has been shown to discriminate between glutamine and glutamate by an induced fit process (Uter et al., 2005). The C. brasiliensis mitochondrial arginiyl-tRNA synthetase is more similar to the yeast cytoplasmic enzyme than to the insect’s cytoplasmic form but functionally relevant structural elements have been conserved in both insect enzymes. One may, therefore surmise that the induced fit type of mechanism is also be shared by the insect arginyl-tRNA synthetases. The evolution of such a kinetic mechanism that was also observed in plants that produce L-canavanine to prevent its incorporation into proteins (Igloi and Schiefermayr, 2009), has thus been replicated in insects, at least as far as the mitochondrial arginyl-tRNA synthetase of C. brasiliensis is concerned. Comparison of the available insect cytoplasmic and mitochondrial enzymes with a compilation 75 completed plant arginyl-tRNA synthetase sequences (unpublished results) provides no evidence for a horizontal gene transfer from the host plant (D. megacarpa; arginyl-tRNA synthetase, Accession No. KF419297) to this seed predator nor is such a flow of genetic information anticipated for another L-canavanine-consuming insect, Sternechus tuberculatus (Curculionidae) (Bleiler et al., 1988), feeding on the seeds of Canavalia brasiliensis (whose arginyl-tRNA synthetase sequence has been determined, Accession No. KF419298). Selective pressure for the L-canavanine resistance and use by the specialist seed predator has not created a kingdom-specific mechanism but relies on subtle changes in the interaction with substrates that prevents amino acid misincorporation into proteins. The contribution by the gut microflora to the resistance of C. brasiliensis larvae to their diet of Lcanavanine remains to be determined. Acknowledgements This work was supported through the individual grants program of the German Research Foundation (DFG) to GLI (Ig9/4). We are grateful to the scientific staff of the ACG, Costa Rica for providing laboratory accommodation and to the team of enthusiastic parataxonomists who collected the Dioclea megacarpa seeds. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.ibmb.2013.10.004.
1180
A.-K. Leisinger et al. / Insect Biochemistry and Molecular Biology 43 (2013) 1172e1180
References Aldinger, C.A., Leisinger, A.-K., Gaston, K.W., Limbach, P.A., Igloi, G.L., 2012a. The absence of A-to-I editing in the anticodon of plant cytoplasmic tRNAArgACG demands a relaxation of the wobble decoding rules. RNA Biol. 9, 1239e1246. Aldinger, C.A., Leisinger, A.-K., Igloi, G.L., 2012b. The influence of identity elements on the aminoacylation of tRNA(Arg) by plant and E. coli arginyl-tRNA synthetases. FEBS J. 279, 3622e3638. Allende, C.C., Allende, J.E., 1964. Purification and substrate specificity of arginylribonucleic acid synthetase from rat liver. J. Biol. Chem. 239, 1102e1106. Anand, R., Langer, T., Baker, M.J., 2013. Proteolytic control of mitochondrial function and morphogenesis. Biochim. Biophys. Acta 1833, 195e204. Ataide, S.F., Ibba, M., 2006. Small molecules: big players in the evolution of protein synthesis. ACS Chem. Biol. 1, 285e297. Bleiler, J.A., Rosenthal, G.A., Janzen, D.H., 1988. Biochemical ecology of canavanineeating seed predators. Ecology 69, 427e433. Bonfield, J.K., Smith, K.F., Staden, R., 1995. A new DNA sequence assembly program. Nucl. Acids Res. 23, 4992e4999. Cavarelli, J., Delagoutte, B., Eriani, G., Gangloff, J., Moras, D., 1998. L-arginine recognition by yeast arginyl-tRNA synthetase. EMBO J. 17, 5438e5448. Davanloo, P., Rosenberg, A.H., Dunn, J.J., Studier, F.W., 1984. Cloning and expression of the gene for bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 81, 2035e2039. Delagoutte, B., Moras, D., Cavarelli, J., 2000. tRNA aminoacylation by arginyl-tRNA synthetase: induced conformations during substrates binding. EMBO J. 19, 5599e5610. Fender, A., Gaudry, A., Jühling, F., Sissler, M., Florentz, C., 2012. Adaptation of aminoacylation identity rules to mammalian mitochondria. Biochimie 94, 1090e 1097. Francklyn, C.S., First, E.A., Perona, J.J., Hou, Y.-M., 2008. Methods for kinetic and thermodynamic analysis of aminoacyl-tRNA synthetases. Methods 44, 100e118. Freedland, R., Crozier, G., Hicks, B., Meijer, A., 1984. Arginine uptake by isolated rat liver mitochondria. Biochim. Biophys. Acta 802, 407e412. Gaudry, A., Lorber, B., Neuenfeldt, A., Sauter, C., Florentz, C., Sissler, M., 2012. Redesigned N-terminus enhances expression, solubility and crystallizability of mitochondrial protein. Protein Eng. Des. Sel. 25, 473e481. Geslain, R., Bey, G., Cavarelli, J., Eriani, G., 2003. Limited set of amino acid residues in a class Ia aminoacyl-tRNA synthetase is crucial for tRNA binding. Biochemistry 42, 15092e15101. Gruic-Sovulj, I., Uter, N., Bullock, T., Perona, J.J., 2005. tRNA-dependent aminoacyladenylate hydrolysis by a nonediting class I aminoacyl-tRNA synthetase. J. Biol. Chem. 280, 23978e23986. Guigou, L., Mirande, M., 2005. Determinants in tRNA for activation of arginyl-tRNA synthetase: evidence that tRNA flexibility is required for the induced-fit mechanism. Biochemistry 44, 16540e16548. Hogg, J., Schiefermayr, E., Schiltz, E., Igloi, G.L., 2008. Expression and properties of arginyl-tRNA synthetase from jack bean (Canavalia ensiformis). Prot. Expr. Purif. 61, 163e167. HsuChen, C.C., Cleaves, G.R., Dubin, D.T., 1983. Sequences of three transfer RNAs from mosquito mitochondria. Plasmid 10, 55e65. Igloi, G.L., Schiefermayr, E., 2009. Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants. FEBS J. 276, 1307e1318. Janzen, D.H., 1971. Escape of juvenile Dioclea megacarpa (Leguminosae) vines from predators in a deciduous tropical forest. Am. Nat. 105, 97e112. Janzen, D.H., 1980. When is it coevolution. Evolution (N. Y) 34, 611e612. Kalacska, M., Sanchezazofeifa, G.A., Calvoalvarado, J.C., Quesada, M., Rivard, B., Janzen, D.H., 2004. Species composition, similarity and diversity in three successional stages of a seasonally dry tropical forest. For. Ecol. Manag. 200, 227e 247. Karkhanis, V.A., Boniecki, M.T., Poruri, K., Martinis, S.A., 2006. A viable amino acid editing activity in the leucyl-tRNA synthetase CP1-splicing domain is not required in the yeast mitochondria. J. Biol. Chem. 281, 33217e33225. Kumazawa, Y., Himeno, H., Miura, K., Watanabe, K., 1991. Unilateral aminoacylation specificity between bovine mitochondria and eubacteria. J. Biochem. 109, 421e 427. Levinger, L., Mörl, M., Florentz, C., 2004. Mitochondrial tRNA 3’ end metabolism and human disease. Nucl. Acids Res. 32, 5430e5441. Liu, W., Huang, Y., Eriani, G., Gangloff, J., Wang, E., Wang, Y., 1999. A single base substitution in the variable pocket of yeast tRNA(Arg) eliminates speciesspecific aminoacylation. Biochim. Biophys. Acta 1473, 356e362. Lue, S.W., Kelley, S.O., 2005. An aminoacyl-tRNA synthetase with a defunct editing site. Biochemistry 44, 3010e3016. Lue, S.W., Kelley, S.O., 2007. A single residue in leucyl-tRNA synthetase affecting amino acid specificity and tRNA aminoacylation. Biochemistry 46, 4466e4472.
Mitra, S.K., Mehler, A.H., 1967. The arginyl transfer ribonucleic acid synthetase of E. coli. J. Biol. Chem. 242, 5490e5494. Nazario, M., Evans, J.A., 1974. Physical and kinetic studies of arginyl transfer ribonucleic acid ligase of Neurospora. A sequential ordered mechanism. J. Biol. Chem. 249, 4934e4936. Perona, J.J., Hadd, A., 2012. Structural diversity and protein engineering of the aminoacyl-tRNA synthetases. Biochemistry 51, 8705e8729. Puglisi, J.D., Pütz, J., Florentz, C., Giegé, R., 1993. Influence of tRNA tertiary structure and stability on aminoacylation by yeast aspartyl-tRNA synthetase. Nucl. Acids Res. 21, 41e49. Rausher, M.D., 2001. Co-evolution and plant resistance to natural enemies. Nature 411, 857e864. Reynolds, N.M., Ling, J., Roy, H., Banerjee, R., Repasky, S.E., Hamel, P., Ibba, M., 2010. Cell-specific differences in the requirements for translation quality control. Proc. Natl. Acad. Sci. U. S. A 107, 4063e4068. Rodgers, K.J., Shiozawa, N., 2008. Misincorporation of amino acid analogues into proteins by biosynthesis. Int. J. Biochem. Cell Biol. 40, 1452e1466. Rosenthal, G., 1977. preparation and colorimetric analysis of l-canavanine. Anal. Biochem. 77, 147e151. Rosenthal, G.A., 1991. The biochemical basis for the deleterious effects of L-canavanine. Phytochemistry 30, 1055e1058. Rosenthal, G.A., Berge, M.A., Bleiler, J.A., Rudd, T.P., 1987. Aberrant, canavanyl protein formation and the ability to tolerate or utilize L-canavanine. Experientia 43, 558e561. Rosenthal, G.A., Dahlman, D.L., Janzen, D.H., 1976. A novel means for dealing with Lcanavanine, a toxic metabolite. Science 192, 256e258. Rosenthal, G.A., Janzen, D.H., Dahlman, D.L., 1977. Degradation and detoxification of canavanine by a specialized seed predator. Science 196, 658e660. Roy, H., Ling, J., Alfonzo, J.D., Ibba, M., 2005. Loss of editing activity during the evolution of mitochondrial phenylalanyl-tRNA synthetase. J. Biol. Chem. 280, 38186e38192. Sampson, J.R., DiRenzo, A.B., Behlen, L.S., Uhlenbeck, O.C., 1989. Nucleotides in yeast tRNAPhe required for the specific recognition by its cognate synthetase. Science 243, 1363e1366. Sampson, J.R., Uhlenbeck, O.C., 1988. Biochemical and physical characterization of an unmodified yeast phenylalanine transfer RNA transcribed in vitro. Proc. Natl. Acad. Sci. USA 85, 1033e1037. Schattner, P., Brooks, A.N., Lowe, T.M., 2005. The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucl. Acids Res. 33, W686eW689. Simlot, M.M., Pfaender, P., 1973. Amino acid dependent ATP-32PPi exchange measurement. A filter paper disk method. FEBS Lett. 35, 201e203. Sissler, M., Helm, M., Frugier, M., Giege, R., Florentz, C., 2004. Aminoacylation properties of pathology-related human mitochondrial tRNA(Lys) variants. RNA 10, 841e853. Small, I., Peeters, N., Legeai, F., Lurin, C., 2004. Predotar: a tool for rapidly screening proteomes for N-terminal targeting sequences. Proteomics 4, 1581e1590. Sørensen, A.B., Duch, M., Amtoft, H.W., Jørgensen, P., Pedersen, F.S., 1996. Sequence tags of provirus integration sites in DNAs of tumors induced by the murine retrovirus SL3-3. J. Virol. 70, 4063e4070. Timmermans, M.J.T.N., Vogler, A.P., 2012. Phylogenetically informative rearrangements in mitochondrial genomes of Coleoptera, and monophyly of aquatic elateriform beetles (Dryopoidea). Mol. Phylogen. Evol. 63, 299e304. Tomita, K., Ueda, T., Ishiwa, S., Crain, P.F., McCloskey, J.A., Watanabe, K., 1999. Codon reading patterns in Drosophila melanogaster mitochondria based on their tRNA sequences: a unique wobble rule in animal mitochondria. Nucl. Acids Res. 27, 4291e4297. Uter, N.T., Gruic-Sovulj, I., Perona, J.J., 2005. Amino acid-dependent transfer RNA affinity in a class I aminoacyl-tRNA synthetase. J. Biol. Chem. 280, 23966e 23977. Vranova, V., Rejsek, K., Skene, K.R., Formanek, P., 2010. Non-protein amino acids: plant, soil and ecosystem interactions. Plant Soil 342, 31e48. Watanabe, K., 2010. Unique features of animal mitochondrial translation systems. The non-universal genetic code, unusual features of the translational apparatus and their relevance to human mitochondrial diseases. Proc. Jap. Acad. B 86, 11e 39. Winston, R.A., Bosmann, H.B., 1971. Protein and glycoprotein synthesis in rat liver mitochondria and rat intraneural mitochondria and protein synthesis in rat liver microsomes in the presence of L-canavanine. Chem. Biol. Interact. 3, 131e 139. Wolfson, A.D., Uhlenbeck, O.C., 2002. Modulation of tRNAAla identity by inorganic pyrophosphatase. Proc. Natl. Acad. Sci. U S A 99, 5965e5970. Yadavalli, S.S., Ibba, M., 2012. Quality control in aminoacyl-tRNA synthesis Its role in translational fidelity. Adv. Prot. Chem. 86C, 1e43.
