Alcanivorax borkumensis produces an extracellular siderophore in iron-limitation condition maintaining the hydrocarbon-degradation efficiency

Marine Genomics 17 (2014) 43–52

Contents lists available at ScienceDirect

Marine Genomics CIESM 2013

Method paper

Alcanivorax borkumensis produces an extracellular siderophore in iron-limitation condition maintaining the hydrocarbon-degradation efficiency R. Denaro a,⁎,1, F. Crisafi a,1, D. Russo a, M. Genovese a, E. Messina a, L. Genovese a, M. Carbone b, M.L. Ciavatta b, M. Ferrer c, P. Golyshin d, M.M. Yakimov a a

Institute for Coastal Marine Environment CNR, Sp.tA S. Raineri 86, 98122 Messina Italy Institute of Biomolecular Chemistry CNR, Via Campi Flegrei, 34, 80078 Pozzuoli, Napoli, Italy c CSIC, Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain d School of Biological Sciences, Bangor University, Gwynedd LL57 2UW, United Kingdom b

a r t i c l e

i n f o

Article history: Received 21 May 2014 Received in revised form 20 July 2014 Accepted 21 July 2014 Available online 31 July 2014 Keywords: Marine oil-pollution Bacterial iron uptake Real time Q-PCR Non-ribosomal peptide synthetase

a b s t r a c t Obligate marine hydrocarbonoclastic bacteria possess genetic and physiological features to use hydrocarbons as sole source of carbon and to compete for the uptake of nutrients in usually nutrient-depleted marine habitats. In the present work we have studied the siderophore-based iron uptake systems in Alcanivorax borkumensis SK2 and their functioning during biodegradation of an aliphatic hydrocarbon, tetradecane, under iron limitation conditions. The antiSMASH analysis of SK2 genome revealed the presence of two different putative operons of siderophore synthetases. Search for the predicted core structures indicated that one siderophore is clearly affiliated to the family of complex oligopeptidic siderophores possessing an Orn-Ser-Orn carboxyl motif whereas the second one is likely to belong to the family of SA (salicylic acid)–based siderophores. Analyzing the supernatant of SK2 culture, an extracellular siderophore was identified and its structure was resolved. Thus, along with the recently described membrane-associated amphiphilic tetrapeptidic siderophore amphibactin, strain SK2 additionally produces an extracellular type of iron-chelating molecule with structural similarity to pseudomonins. Comparative Q-PCR analysis of siderophore synthetases demonstrated their significant up-regulation in iron-depleted medium. Different expression patterns were recorded for two operons during the early and late exponential phases of growth, suggesting a different function of these two siderophores under iron-depleted conditions. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Iron limitation is one of the major constraints in microbial life. Virtually all microorganisms, with the exception of certain lactobacilli (Archibald, 1983), require iron, employed as a cofactor by many metabolic enzymes and regulatory proteins, participating in vital metabolic pathways, such as the tricarboxylic acid cycle, electron transport, amino acid and pyrimidine biosynthesis, DNA synthesis (Earhart, 1996). Iron behaves as a micronutrient since the typical concentration needed for optimal bacterial growth is 0.3 to 1.8 μM (Vasil and Ochsner, 1999; Shuler and Kargi, 2002). In marine pelagic environments iron is usually depleted due to formation under aerobic conditions and at slightly alkaline pH of insoluble ferric hydroxide complexes, thus imposing severe restrictions on its availability in the water column ⁎ Corresponding author. E-mail address: [email protected] (R. Denaro). 1 Contributed equally to this work.

http://dx.doi.org/10.1016/j.margen.2014.07.004 1874-7787/© 2014 Elsevier B.V. All rights reserved.

(Xuewu and Millero, 2002). In fact, the dissolved Fe concentrations in offshore waters of the Pacific, Atlantic, and Southern Oceans average 0.04 ± 0.04 nM at the surface (b 200 m) and 0.76 ± 0.25 nM at mesoand bathypelagic depths (N 500 m) (Johnson et al., 1997; Tortell et al., 1999). Several studies put in evidence that the iron availability in marine environment impacts directly and/or indirectly the bacterial growth efficiency, i.e., the ratio between growth and carbon uptake (Tortell et al., 1996; Church et al., 2000; Kirchman et al., 2003). In the Mediterranean sea, the dissolved iron shows a “nutrient-like” profile, as Bonnet and Guieu (2006) observed in a one-year time series, during the spring the minimal amount of dissolved iron was detected (0.2 nM), and the ratio Fe:P was superimposed. During the winter and fall the concentration of dissolved iron was not a limiting condition (0.8 nM). Very few data on the bioavailable pool of the dissolved iron have been reported. Recent results show that the amount (and quality) of dissolved organic matter controls the dissolution of atmospheric iron and the kinetic rates of the reaction. Parts of DOC are Fe–L induced by bacterial activity (Wagner

44

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

et al., 2010). The imbalance of Fe/C ratio becomes a limiting factor and results in a low bacterial biodegradation performance (Dibble and Bartha, 1976; Hugo et al., 1998; Dinkla and Janssen, 2003; Becquevort et al., 2007) carried out by marine bacterial communities. Addition of iron can significantly meliorate the organic degradation processes. As an example, Ziervogel et al. (2012) have demonstrated that DOC increased twofold in experiment where oil and iron were added to Deep Water Horizon samples, resulting in significantly higher concentrations compared with uncontaminated bottles. At the same time an increase of patterns and rates of enzymatic activities was also observed (Ziervogel et al., 2012). Indeed, many studies have shown that the requirement of iron increases during the over-expression of the alkane hydroxylase of Pseudomonas oleovorans in the presence of hydrocarbons as growth substrate (Staijen et al., 1999). Strains belonging to the same genus have been shown to reduce the efficiency of the degradation of toluene under iron limiting conditions (Dinkla et al., 2001) and report a higher demand for iron in Pseudomonas aeruginosa during growth in cultures containing benzoate as the sole carbon source, compared to the cultures in the presence of glucose. Metabolic pathways which bacteria use to degrade hydrocarbons include iron-containing oxygenases such as, the alkane monooxygenase, AlkB2, and cytochrome P450 (CYP). AlkB2 is a non-heme Fe–Fe alkane monooxygenase. Moreover, capability to uptake iron appears to be an important requirement for Alcanivorax borkumensis to protect itself from UV stress, which may be associated with an enhanced need for ironcontaining heme, a major component of many electron transport systems that protect the cells against oxidative stress (Sabirova et al., 2011). The enhanced requirement of iron during hydrocarbon degradation is supported by the activation of an efficient ironuptake system. In fact, to acquire a sufficient amount of this essential element, marine bacteria have evolved the specialized Fe-specific high affinity transport systems. Most of them possess capability to produce and secrete complex macromolecules designated siderophores to fulfill their iron requirements. Siderophore are special iron-chelating agents that facilitate the solubilization and uptake of iron. They are water-soluble medium-molecularweight (500–1500 Da) compounds that bind iron with very high affinity (1025–1050) for ferric iron (Fe3+) (Kanoh et al., 2003). The ability to utilize siderophores is associated with the presence of transport systems that can recognize and mediate transport of the ferric-siderophore complexes into the cytoplasm. Such receptors can frequently recognize various siderophores allowing the organism to survive using a low-cost energy strategy. Once in the cytoplasm, the ferrisiderophore complex is degraded leaving the iron chelator (apo-siderophore) intact, allowing for re-cycling. Among hydrocarbon degrading bacteria, strains belonging to the genus Marinobacter produce an amphiphilic siderophore marinobactin, whose structure was found only in few marine bacteria (Martinez et al., 2000). Recently, Kem et al. (2014) have isolated an amphiphilic siderophore amphibactin from the cellular membranes of A. borkumensis SK2, one of the most important alkane-degrading marine bacteria (Yakimov et al., 1998). Kem et al. (2014) have also associated the expression of the operon ABO_2087-2112, which shows a typical structure of a non-ribosomal peptide synthetase (NRPS) related to the secondary metabolite production. A. borkumensis SK2 belongs to a special group of obligate marine hydrocarbon-degrading marine bacteria (OMHCB), exhibiting both genetic and physiological features to use hydrocarbons as sole source of carbon and energy and to compete for the uptake of nutrients (Yakimov et al., 2007). Several studies have demonstrated that OMHCB play a crucial role during petroleum hydrocarbon degradation in marine environments. They become the dominant fraction of microbial communities thriving in oil polluted marine areas and exhibit a very intense activity during the bioremediation processes (Yakimov et al., 2005; Denaro et al., 2005; Schneiker et al., 2006). Despite of OMHCB importance, very few studies have been currently carried out on their capability to compete with other marine microorganisms in scavenging marine oligonutrients, in particular the iron. The aim of our study was to explore the siderophore production by A. borkumensis SK2 and to evaluate the in vitro expression of the key genes involved in this process.

Our findings help to clarify the role of siderophores in the metabolic activity of OMHCB during the biodegradation processes. 2. Materials and methods 2.1. Analysis of siderophore biosynthesis genes from A. borkumensis SK2 The siderophore biosynthesis clusters were identified using a combination of annotation text search software and the online available tool antiSMASH (Medema et al., 2011; Blin et al., 2013), developed specifically to identify biosynthetic clusters of secondary metabolites. This tool was run on the full genome of A. borkumensis SK2, publicly available in the National Center for Biotechnology Information (NCBI). To find the corresponding genes, we focused the search on the “NRPS” (non-ribosomal peptide synthase) metabolite clusters identified by antiSMASH. These matched well with the annotation text searches that were concurrently performed on the original GenBank genome text file using the following word keys: “siderophore”, “actin” (encompassing many of the names of known siderophores), “ferrin”, “pyoverdin”, “chelin”, “ferrichrome”, “heme”, “hydroxamate”, and “catechol”. The presence of these genes in the siderophore synthesis clusters was further confirmed by a BLASTX search against the NCBI non-redundant protein database, and accepting hits with a minimum bitscore of 40 or an e-value of less than 1e−05. 2.2. Strains and culture conditions The bacterial strain used in this study was A. borkumensis SK2 (ATCC 700651 — Yakimov et al., 1998). Strain was routinely grown on ONR7a (Dyksterhouse et al., 1995) agar plate or ONR7a liquid medium supplemented with 0.5% (w/v) of sodium acetate or 0.1% (w/v) of n-tetradecane. Iron-restricted bacterial growth was performed in ONR7a in the absence of iron. All glassware used were previously treated with HCl 1 M to remove iron traces and then rinsed with bi-distilled water pH 7.0. To obtain cultures under iron depletion conditions, cells were grown in complete ONR7a medium for 8 days, then harvested and washed four times with ONR7a (without Fe) medium, pelleted by centrifugation (5000 ×g) and finally inoculated in ONR7a (−Fe) medium. To test the effect of iron depletion and siderophore production in A. borkumensis, growth parameters, estimated by using the fourparameter Gompertz model (Zwietering et al., 1990; Juàrez Tomàs et al., 2002), were determined under the conditions tested. All experiments were carried out in triplicate using biological replicates and technical replicates. 2.3. Siderophore assay 2.3.1. Chrome azurol S agar plate assay For the Chrome Azurol S agar plate assay (Schwyn and Neilands, 1987), 60.5 mg of CAS was dissolved in 50 ml of ultrapure water; 72.9 mg of HDTMA (hexadecyl(trimethyl)azanium chloride) was dissolved in 40 ml of ultrapure water and finally added to a solution of 10 ml defined iron solution (1 mM FeCl3 in 10 mM HCl). The resultant dark blue solution was autoclaved (20 min, 121 °C), cooled down and mixed with 900 ml of hot sterile ONR7a (−Fe) medium supplemented with 1.5% of agar (w/v). This medium was poured on sterile Petri dishes, cooled down, then spotted with 10 μl of each bacterial strain and incubated 7 days at 28 °C. This type of medium visually highlights the ability of organisms to iron uptake and positive results were scored by the formation of an orange halo around the colonies. 2.3.2. Chrome Azurol S liquid assay The CAS solution assay (Schwyn and Neilands, 1987) was used to quantify siderophore activity in culture supernatant extracts by measuring the decrease in the absorbance of blue color at 630 nm. It was

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

45

Table 1 Primers used in this study. Gene/primers

Sequence forward (5′–3′)

Sequence reverse (5′–3′)

Amplification efficiency (%)

Melting temperature (°C)⁎

Source of reference

alkB2 iucB ABO1782 tonB fhuE gyrB⁎⁎ recA⁎⁎ 16S⁎⁎

CGCCGTGTGAATGACAAGGG CAATTATGTCGGGCCGCTTG AATTTGTCCGCGCAGCTTTT ATGGGGGGCGTGGTCAACATTATC AACGGTTTGGGCAATCCTTC GCGTTGTCTGAACTCTACATTGTGG CGCCAATACACTGGTGGTCT AGGGGGATAACCTGGGGAAA

CGACGCTTGGCGTAAGCATG GCCATGCTGTCTGGTTCTCT GCACCCAGCTAATGACGGTA ATCGGGAATCGTCCTGGATG ACTTCAACACGGCGGTTATCC ACCCTTGAGCGGCAAAATCG ACTTCAGGGCATTACCACCG CTAATCCGACGCGAGCTCAT

93 96 94 95 97 96 94 98

81 81 78 82 81 82 80 79

McKew et al. (2007) In this study In this study In this study In this study In this study In this study In this study

⁎ Melting temperature is calculated by Primer Express software, version 2.0. ⁎⁎ Genes used as reference genes in this study.

prepared as follows: 6 ml of HDTMA 10 mM was diluted with water and mixed with 1.5 ml of iron(III) solution (1 mM FeCl3 × 6H2O in HCl 10 mM) and 7.5 ml 2 mM aqueous CAS solution under stirring conditions. Separately, 4.307 g of PIPES was dissolved in water and 6.75 ml of 12 M HCl was added. This buffer solution (pH 5.6) was slowly mixed with CAS solution and completed up to 100 ml with bidistilled water. To quantify the siderophore activity, the fraction containing siderophores was added to CAS assay solution (1:1), after 1 h of exposition at room temperature the absorbance (A630) was measured. The percentage of siderophore units was estimated as the proportion of CAS color shift using the formula [(Ar − As) / Ar] × 100 (Martínez et al., 2006), where Ar is the A630 of the reference sample (medium plus CAS assay solution) and As is the A630 of the sample (supernatant plus CAS assay solution).

2.4. Isolation of A. borkumensis SK2 siderophore The siderophore was isolated from the supernatant collected by centrifugation (30 min, 5.000 xg) of a A. borkumensis culture, incubated in ONR7a (−Fe) supplemented with n-tetradecane (0.1%) at 28 °C for 8 days. The siderophore production was monitored by liquid CAS assay during the bacterial growth at OD 0.2, 0.4, 1 and 1.2. When the percentage of siderophore units showed the maximum value the 1 l culture was centrifuged at 10,000 rpm for 15 min. The collected supernatant was adsorbed onto Amberlite XAD-2 resin (Sayyed and Chincholkar, 2006) packed into a glass column (30 × 6 Ø cm) to a height of 8 cm. The resin was previously cleaned with three bed volumes of methanol, and equilibrated with four bed volumes of ddH2O. The supernatant was passed slowly through the column at a rate of 5 ml min−1. A first elution was performed with approximately 300 ml of 50% methanol and after washing with ddH2O, a second elution was carried out with the same volume of 100% methanol. The flow-through from each of these steps was collected in separated fractions of 5 ml. An elution profile was then designed based on the liquid CAS assay of each fraction. We were able to distinguish two peaks, the first within the fraction collected with 50% methanol, the second showing a very high activity within the 100% methanol elution fractions; the volume of each peak was about 30 ml. Positive fractions

Table 2 Estimation of growth parameters of A. borkumensis SK2 under different growth conditions of application of the Gompertz model. Growth conditions Log cfu−ml T0 Log cfu−ml Tf A (log cfu−ml) μ (h - 1) λ (h) ONR 7a + tet 0.1% ONR7a (−Fe) + tet 0.1%

5.6 5.3

10.8 10.6

5.2 5.3

0.25 0.19

12 24

Parameters of the Gompertz model (±SE): log CFU/ml T0, initial biomass; log CFU/ml Tf, final biomass reached; A, increase between initial and final biomass; μm growth rate; and λlag phase.

for each peak were pooled and concentrated under vacuum. The dry pellet from the 100% methanol elution was resuspended in methanol 100% and used for further analyses. 2.5. Mass spectrometry Electrospray ionization mass spectrometry (ESI-MS) was carried out on a Q-Tof-micro mass spectrometer (Waters) equipped with an ESI source and a Lock-Spray apparatus for accurate mass measurements. 2.6. Nuclear-magnetic resonance (NMR) spectroscopy NMR experiments were recorded at ICB-NMR Service Centre. 1D and 2D NMR spectra were acquired in CD3OD on a Bruker Avance DRX 600 equipped with a cryoprobe operating at 600 MHz for proton and at 150 MHz for carbon. Chemical shift values are reported in ppm (δ) and referenced to internal signals of residual protons (MeOD 1H δ 3.34, 13C δ 49.0 ppm). NMR values of pseudomonine isolated from A. borkumensis were compared to previously published data (Mercado-Blanco et al., 2001; Anthoni et al., 1995). 2.7. DAPI counting Bacterial batch cultures were performed in triplicate and monitored using a biophotometer (Eppendorf BioPhotometer) and the bacterial abundance was measured by direct counting in epifluorescence microscope following the methodology reported by Porter and Feig (1980). In detail, an aliquot of culture was collected at established time and fixed with formaldehyde (2% final concentration). The cell counts were performed by 4′.6′-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich S.r.L., Milan, Italy) staining. Samples were prepared using a mixture consisting of glycerol-phosphate-buffered-saline AF1 (Molecular Probes, Eugene, Oregon USA), Vectashield (Vector Laboratories, Inc., Burlingame, CA), 1× PBS (phosphate buffer saline) and DAPI (final concentration 1 μg ml−1) (Porter and Feig, 1980). Slides were examined by epifluorescence with an Axioplan 2 Imaging (Zeiss; Carl Zeiss Inc., Thornwood, N.Y.) microscope. All results were expressed as number of cells ml−1. At OD600 values of 0.2, 0.4 and 1 corresponding to the early exponential, exponential and early stationary phases of growth, aliquots of the broth cultures were collected for DAPI staining and real time Q-PCR analysis. 2.8. Extraction of RNA from bacterial cells RNA was extracted from 2 ml of A.borkumensis SK2 pure culture, at selected time and under described conditions, using a Masterpure Complete DNA and RNA purification kit (Epicentre). The cells were harvested by centrifugation at 3000–5000 ×g at 4 °C. Extraction was carried out according to the manufacturer's instructions. RNA was stored in isopropanol at −20 °C before precipitation. RNA was resuspended in 50 μl of RNase-

46

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

free water. Extracted RNA was treated with a TURBO DNA-free kit (Ambion) to eliminate any residual DNA from the final elution. cDNA was synthesized using the SuperScript II Reverse Transcriptase (Invitrogen). Each reaction mixture (final volume 20 μl) contained 4 μl of 5× First-Strand Buffer, 3 μl of template RNA, 1 μl (10 μM) of Random Primers, dNTPs (10 mM each), and 1 μl of SuperScript II RT (200 units). cDNA synthesis was carried out at 42 °C for 50 min. The reaction was stopped by heating to 70 °C for 15 min. cDNA was used as the template for real-time Q-PCR amplification. RNA quality and concentration were determined using a NanoDrop® ND-1000 Spectrophotometer (Celbio). 2.9. Quantification using real-time Q-PCR Q-PCR approach was used to evaluate the relative change in the mRNA expression levels of a gene under multiple conditions. The technique used in the present work was the comparative Ct or 2−ΔΔCt method (Livak and Schmittgen, 2001; Pfaffl, 2001; Mikesovà et al., 2006). We monitored the differential expression of target genes during growth under iron depletion condition using the ‘optimal growth conditions’ for calibration and comparison. The optimal growth conditions consisted of A. borkumensis cells grown at 28 °C in complete ONR7a supplemented with 0.1% of tetradecane. Expression of each target gene, normalized to an endogenous reference and relative to a calibration standard, is given by 2−ΔΔCt as described by Crisafi et al. (2013). All experiments were carried out using biological replicates and technical replicates, and the mean values of triplicate samples and triplicate experiments were used for graphical representation. 2.10. Primers and specificity Primer sets specific to the A. borkumensis SK2 target genes were designed using the Primer Express software (Primer Express software, version 2.0, Applied Biosystems, Foster City, California) with reference to the sequence of A. borkumensis SK2 published in GenBank. Amplification specificity was determined through dissociation curve analysis. The sequences of fragments obtained by PCR amplification of the template cDNA from A. borkumensis strain were sequenced and checked by a BLAST search against the GenBank database (http://www.ncbi.nml.nih. gov). Table 1 shows the list of primers used in this study. 2.11. Analysis of housekeeping gene stability The stability of expression of referent housekeeping genes was monitored by real-time PCR analysis using as template 0.1 μg of total RNA extracted from A. borkumensis SK2 strain grown under the experimental conditions during the exponential phase of growth. Real-time PCR data were exported to an Excel datasheet and analyzed using three reference gene stability analysis software packages: geNorm (Vandesompele et al., 2002), BestKeeper© (Pfaffl et al., 2004) and NormFinder (Andersen et al., 2004) as described by Crisafi et al. (2013). 2.12. Design of standard curves A 10-fold dilution series, ranging from 10−2 to 103 ng of cDNA per reaction, was used to plot a standard curve. The concentration of cDNA was measured using a NanoDrop_ND-1000 Spectrophotometer (Celbio). Standard dilutions were analyzed in triplicate. The Ct values were plotted against the logarithm of their initial template concentration. Standard curves were drawn by linear regression of the plotted points. The slope of each curve was measured for the validation test for the relative quantification, and from the slope of each curve, PCR amplification efficiency (E) was calculated according to the following equation: E = 10− 1/slope − 1. If the slope of the lines falls between − 3.3 and − 3.4, the validation test is valid, indicating that the amplification efficiencies of the target genes are similar to

the amplification efficiency of the endogenous control, the curves are parallel and it is possible to continue the experiment. 2.13. n-Tetradecane degradation analysis Residual n-tetradecane was extracted from 50 ml of A. borkumenis SK2 pure cultures incubated at 28 °C for 8 days as described above, analyzed by high-resolution GC–MS and quantified according to previously described protocols (Ehrhardt et al., 1991; Wang et al., 1998; Dutta and Harayama, 2001) and modified as reported by Denaro et al. (2005). Three-repeated measurements performed with each sample showed that precision was within 10%. 3. Results 3.1. Analysis of siderophore biosynthesis genes from A. borkumensis SK2 The antiSMASH analysis on A. borkumensis SK2 genome revealed only two clusters harboring the putative NRPS enzymes (Fig. 1a–b). The antiSMASH search for predicted core structures confirmed the presence of an amphiphilic siderophore (Fig. 1a) which consists of four amino acid residues and is clearly affiliated to the family of complex oligopeptidic siderophores possessing an Orn-Ser-Orn carboxyl motif. It perfectly matches with the structure of membrane-associated amphiphilic tetrapeptidic siderophore amphibactin recently found and characterized in SK2 by Kem et al. (2014). The same analysis revealed that the newly identified siderophore (Fig. 1b) is likely to belong to the family of SA-based siderophores, a pseudomonine containing a cyclothreonine moiety. The predicted functions of the ORFs present in the gene cluster ABO_1782-1806, which shows the second typical structure of a non-ribosomal peptide synthetase (NRPS), are summarized in Table 4. Among the analyzed ORFs we observed a putative 2.3dihydroxybenzoate-Amp ligase (ABO_1806) that shows similarities with 2.3-dihydroxybenzoate-AMP ligases from different species. This enzyme activates the carboxylate group of 2.3-dihydroxybenzoic acid (2.3-DHB) via an ATP-dependent PPi-exchange reaction and could be a precursor of 2.3-DHB containing siderophores (Matthijs et al., 2009). The NRPS ABO_1782 belongs to the family of 4′-phosphopantetheinyl transferases. This superfamily of proteins participates in the transfer of a 4′-phosphopanteheine (4′-PP) moiety from coenzyme A (CoA) to an invariant serine residue present in an acyl carrier protein (ACP), a small protein responsible for activation of acyl group in fatty acid biosynthesis. The NRPS ABO_1784 composes of four domains typically found in all currently known NRPSs, e.g. condensation, adenylation and thiolation domains (peptide carrier protein, PCP) with terminal thio-esterase domain (Fig. 1b). 3.2. Comparison of growth curves of A. borkumensis SK2 under optimal and iron limitation conditions To test the influence of iron depletion on the growth efficiency, the strain SK2 was grown in both complete ONR7a and in iron-depleted medium (ONR7a–Fe). In both conditions tested, sodium acetate and n-tetradecane were used as substrates. The growth curves have shown that A. borkumensis SK2 is affected by iron deficiency independently of the utilized substrate (data not shown). Considering the growth curves obtained using n-tetradecane as sole carbon source, the strain shows a lower growth performance in ironlimiting conditions, both in terms of lag phase duration (24 h compared to 12 h recorded during the optimal growth conditions) and growth rates (0.19 compared to 0.25 obtained during the optimal growth conditions) (Table 2). CFU (colony-forming unit)/ml values were almost the same in both experimental conditions at the end of experiments (Fig. 2).

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

47

Fig. 1. a–b Two non-ribosomal peptide-synthetase (NRPS) clusters found on genome Alcanivorax borkumensis SK2 using the antiSMASH online analysis shell, associated respectively to amphiphilic (a) and pseudomonines (b) siderophores. Domains inside gene locus were showed in detailed annotations as: ACPS (holo-Acyl Carrier protein synthase); A (AMP-binding); C(condensation); E (epimerization); KR (PKS, polyketide synthase); TE (thioesterase); and blue (PCP, peptidyl carrier protein).

3.3. Siderophore activity in A. borkumenesis SK2 We measured the siderophore production in liquid medium using the in vitro CAS assay (Schwyn and Neilands, 1987). We found that A. borkumensis SK2 produced CAS-positive metabolites when it was grown only under iron-depleted conditions. The siderophore

activity was detected after 24 h of incubation (13%) corresponding to the early exponential phase of growth. The percentage of activity increased up to 30% after 48 h and reached the highest value when the density of cells was maximum (63%) (Fig. 3). The trend of the activity was not linear but exhibited a wavy, up and down behavior.

48

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

Table 3 Expression stability values of the candidate housekeeping genes calculated by the geNorm, NormFinder and BestKeeper algorithms in A. borkumensis SK2 during the growth conditions tested. Gene

Stability value geNorm

Stability value NormFinder

Stability value NormFinder

gyrB 16S recA

0.761 1.690 0.758

0.520 2.833 0.674

0.491 2.001 0.703

3.4. Isolation and characterization of siderophores from A. borkumensis SK2 In order to characterize the structure of siderophores produced by A. borkumensis, the strain was cultured under iron-limitation conditions; the selected peaks after absorption in Amberlite XAD-2 were analyzed by magnetic resonance (NMR) spectroscopy and mass spectrometry. No significant results were obtained from the 50% elution peak. On the contrary the methanol 100% CAS positive fractions showed the following results. The structural study initiated from a preliminary 1H NMR analysis of the active methanolic fraction which indicated the presence of a main metabolite in a mixture of fatty acids (Fig. 4). The LR-ESI mass spectrum, recorded in the positive-ion mode, confirmed the occurrence of a predominant metabolite responsible for the three peaks observed at m/z 331 (M + H)+, 353 (M + Na)+ and 683 (2 M + Na)+ (Fig. 5). Accurate mass determination revealed a peak at m/z 353.1235 indicating the molecular formula C16H18N4O4Na (calculated m/z 353.1220 for C16H18N4O4Na). The subsequent analysis of COSY spectrum combined with HSQC and HMBC data allowed us to recognize the structure characteristic for salicylate-containing pseudomonine (Mercado-Blanco et al., 2001; Anthoni et al., 1995). This kind of secondary metabolites with siderophore, i.e. iron-chelating activity, was first isolated from the iron-

Table 4 Predicted function of the ORFs present in the operon ABO_1782-1806. Locus tag

ORF predicted function

ABO_1782 Siderophore biosynthesis protein ABO_1783 Glycosyl transferase ABO_1784 NRPS ABO_1785 Transposase ABO_1786 Transposase ABO_1787 Transposase ABO_1788 Hypothetical protein ABO_1789 Hypothetical protein ABO_1790 Hypothetical protein ABO_1791 Acetyl-CoA hydrolase/ transferase family protein ABO_1792 Small multidrug resistance protein ABO_1793 Cobalamin synthesis protein/P47K family protein ABO_1794 Dihydroorotase ABO_1795 Hypothetical protein ABO_1796 Carbon storage regulator ABO_1797 Aspartokinase ABO_1798 Alanyl-tRNA synthetase ABO_1799 Permease ABO_1800 Regulatory protein ABO_1801 RecA protein ABO_1802 CinA domain-containing protein ABO_1803 Hypothetical protein ABO_1804 Acyltransferase AB0_1805 Nuclease ABO_1806 AMP-binding protein/ 2.3-dihydroxybenzoateAMP ligase

COG

Gene Accession annotation number

COG2977

YP_693502.1

COG1819 COG3319 bactNOG03349 COG2801 NOG119118 OrfA

NOG283690 COG0427

YP_693503.1 YP_693504.1 YP_693505.1 YP_693506.1 YP_693507.1 YP_693508.1 YP_693509.1 YP_693510.1 YP_693511.1

COG2076

YP_693512.1

COG0523

YP_693513.1

COG0418 COG1551 COG0527 COG0013 COG0730 COG2137 COG0468 COG1546 COG0217 NOG09285 COG1432 COG1021

pyrC csrA lysC alarS recX recA cinA

atfA2

YP_693514.1 YP_693515.1 YP_693516.1 YP_693517.1 YP_693518.1 YP_693519.1 YP_693520.1 YP_693521.1 YP_693522.1 YP_693523.1 YP_693524.1 YP_693525.1 YP_693526.1

depleted culture supernatant of a Pseudomonas fluorescens (Anthoni et al., 1995). 3.5. Differential expression of target genes under iron limitation conditions To evaluate the stability of expression of reference genes, RNA transcription levels for all samples were measured for each condition tested. When ranking the reference genes by different methods (Table 3), we found that gyrB appears as the best reference gene in geNorm, NormFinder and BestKeeper. The relative real-time PCR was further performed to evaluate the effect of iron-depletion on the expression of genes involved in both iron metabolism and hydrocarbon degradation. Relative expression of target genes was monitored during the early exponential, exponential and early stationary phases of growth using the optimal growth condition as reference. The results obtained are shown in Fig. 3. In detail, alkB2 gene, involved in the hydrocarbon degradation, didn't show any significant differences in the expression level during all growth phases tested. Moreover, it exhibited the expression patterns comparable with those of the cells grown under optimal conditions. Regarding the genes involved in the iron uptake system, both genes involved in the siderophore biosynthesis, showed a significant overexpression in iron limitation condition during the early exponential phase (OD600 0.2; 105 cell/ml), with 2−DDCt values of 6.8. During the exponential phase of growth the ABO_1782 gene was under-expressed (2−DDCt values 0.3), while iucB (ABO_2090) gene showed 6.3-fold overexpression, compared to the optimal growth conditions. Finally, during the stationary phase of growth, the expression of ABO_1782 was strongly induced under iron limitation conditions (10.3-fold), whereas the iucB expression decreased. The expression patterns of genes involved in the iron transport inside the cells were practically comparable. Compared to the optimal conditions of growth, the fhuE and tonB genes were over-expressed through all phases of growth under iron stress. The 2− DDCt values for fhuE were 2.3, 13.88 and 4.9 higher in early exponential, exponential and early stationary phases of growth respectively, while the values corresponding to the over-expression of tonB2 gene were 3.4, 10 and 3.13 (Fig. 3). 3.6. Hydrocarbon analysis The efficiency of n-tetradecane degradation of A. borkumensis SK2 under optimal growth conditions and under iron-limitation conditions was determined after 8 days of incubation at 28 °C. The percentage of degradation was about 39% under iron limitation, while the efficiency of degradation under optimal conditions of growth was slightly higher and reached 48% (Fig. 6). 4. Discussion The success of bioremediation in marine environment depends on several factors among which temperature, oxygen and availability of nutrients (N, P and Fe) are the most important (Boopathy, 2000). A. borkumensis is among the major alkane-degrading player in many investigated marine environment. It harbors effective scavenging systems of nutrients such as N and P, S and various oligo-nutrients such as Fe, Zn, Co, Mg, Mn and Mo encoding genes for a broad range of transport proteins (Schneiker et al., 2006). Such systems allow this organism to successfully compete for the use of recourses as it becomes the dominant member of microbial communities associated to oil-polluted marine areas (Yakimov et al., 2007; Yakimov et al., 2005; Teramoto et al., 2013; Hara et al., 2003; Genovese et al., 2014). The present study focused on the iron uptake systems in A. borkumensis SK2 and their role during the degradation of petroleum hydrocarbons under ironlimiting conditions. Our genomic analyses showed that SK2 harbors two putative NRPS codifying for siderophore-type secondary metabolites, ABO_2093, already described by Kem et al. (2014), which is

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

49

Fig. 2. Growth curves of A. borkumensis SK2 grown in ONR7a (circle) and under iron limitation condition (square) at 28 °C using tetradecane as a sole carbon source.

dedicated to the production of the amphiphilic siderophore amphibactins and a second NRPS gene, ABO_1784 which was the object of our study. The production of a different type of siderophores by the same strain is a common feature in many marine bacteria of genera Pseudomonas (Cox and Adams, 1985; Visca et al., 1992; Mercado-Blanco et al., 2001), Marinobacter (Homann et al., 2009a, 2009b; Barbeau et al., 2001) and Halomonas (Homann et al., 2009a, 2009b). Noteworthy to mention, together with the ironuptake some of these siderophores function as biosurfactants (Martinez et al., 2000; Kem et al., 2014), signaling molecules (quorum sensing) (Lamont et al., 2002; Guan and Kamino, 2001) and antibiotic agents (Adler et al., 2012). Hence the variability of siderophores produced by a single strain suggests their different functions in physiological and ecological successes. During the growth of A. borkumensis SK2 under iron-liming conditions we have detected the siderophore activity otherwise undetectable under optimal conditions. At the same time, the degradation capability of the strains exposed to optimal and iron-limiting conditions didn't show significant differences such as the yield of biomass reached during the incubation. The siderophore activities measured at high cell density during the late exponential phase was comparable with those of other bacterial strains (Baysse et al., 2002; Sreedevi et al., 2014). Moreover, the trend of the siderophore activities measured were not linear but exhibited a wavy,

up and down behavior, as was previously observed for the kinetic of siderophore production by another OMHCB such as Oleispira antarctica (Kube et al., 2013). We could hypothesize, according to Amir et al. (2010), that Alcanivorax strain acts as Escherichia coli when a sudden iron scarcity occurs: the expression of genes within the iron homeostasis network appears as a damped oscillation. Amir et al. demonstrated that the amplitude and period of oscillations are responsive to the degree of iron stress and are cell cycle independent but cell growth-rate dependent, and last for several cell generations. They suggest, according to their experiments and theoretical model, a transient variation in internal free iron concentration, given the tight regulation expected in iron levels (Andrews, 1998; Masse and Arguin, 2005; Semsey et al., 2006). These variations, sensed directly by the Fur repressor, are large enough to lead to nearly full induction/repression of network genes with both amplitude and frequency modulated according to the degree of iron stress. This interesting context hypothesized that also siderophores could be included in this complex network and then could respond maintaining the same fluctuating trend. NMR and Mass Spectrometry revealed the presence in the CAS active fraction of pseudomonine early reported to be produced by strains belonging to Pseudomonas genus (Anthoni et al., 1995; Mercado-Blanco et al., 2001). Differently from amphibactins recently isolated from A. borkumensis by Kem et al. (2014), pseudomonine belongs to the

Fig. 3. Siderophore production (line) by A. borkumensis SK2 growing in the Fe-limited medium ONR7a with tetradecane at 28 °C as per chrome Azurol S reagent (CAS) assay and relative expression of target genes: alkb2 (blue bars), iucB (yellow bars), ABO1782 (red bars), fhuE (purple bars) and tonB2 (gray bars). For each gene, the relative expression during the standard condition of growth was set at 1, and the expression in iron limitation condition was normalized accordingly, using the 2−ΔΔCt methods; we considered significant values greater than two. Standard deviations (SD) from average values measured from biological triplicates are shown as vertical bars.

50

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

Fig. 4. 1H NMR spectrum of fraction containing pseudomonine (Bruker 600 MHz, CD3OD).

family of salicylicilate derived siderophores which include pyochelin from Pseudomonas (Cox et al., 1981) and Burkholderia (Darling et al., 1998), mycobactin S produced by Mycobacterium smegmatis (Hudson and Bentley, 1970), mycobactin T, isolated from Mycobacterium tuberculosis, parabactin produced by Paracoccus denitrificans (Person and Neilands, 1979), maduraferrin from Acinomadura madurae (KellerSchierlein et al., 1988), and vulnibactin, a polyaminecontaining siderophore from Vibrio vulnificus (Okujo et al., 1994), containing two salicylic residues in its molecule. Depending on the type of produced siderophore, the Q-PCR analysis revealed the different patterns of their subtractive expression profile

during growth under iron limitation. In detail, at 48 h iucB gene showed the maximal relative expression value and, as described by Kem et al., the maximal amphiphilic siderophore production. On the contrary, at 72 h iucB gene showed a decreased expression while the gene ABO_1782 increased its relative expression up to 10 fold. At the same time we have obtained the maximal production of the SA-based siderophore described in the present study. The differential expression profile could suggest a different functional role of the two siderophores. Indeed, in additionto iron scavenging, the amphiphilic amphibactins could act also as a biosurfactant as was hypothesized in Marinobacter genus (Martinez et al., 2000) thus helping

Fig. 5. ESI-mass spectrum of fraction containing pseudomonine.

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

51

BRAAVOO (FP7-KBBE OCEAN 2013.1 “Biosensors, Reporters and Algal Autonomous Vessels for Ocean Operation”). We would like to thank all partners of these projects for their useful discussions.

References

Fig. 6. Relative degradation of n-tetradecane present in pure culture of A. borkumensis strain growing in optimal and iron limitation conditions. All values were expressed as the percentages compared to a control (ONR7a + n-tetradecane without biomass) and at the end of experimental period (after 96 h).

the hydrocarbon-degrading organisms to simultaneously increase the bioavailability of highly hydrophobic substrates, which is absolutely required for the growth on petroleum hydrocarbons. The second siderophore could be related to the enhancement of iron uptake at high cell densities when the interspecies competition for the available resources reached its maximum. Moreover, its role related to the quorum sensing in dense microbial population cannot also be excluded. 5. Conclusions Bioremediation is a promising green technology for the recovery of hydrocarbon-polluted marine areas and it is very important for its application to overcome the limiting factors. The iron availability in marine environment is usually very low and this can affect the biodegradation processes of organic matter, including organic pollutants. The knowledge on ironuptake system in hydrocarbonoclastic bacteria could help to overcome this limiting factor. Our results show that A. borkumensis SK2 secretes pseudomonine other than amphibactins already described by Kem et al. (2014). We detected this compound only under conditions of iron stress. Further, we showed that expression of the gene corresponding to ABO_1782 is increased when cells are grown in no-iron medium. Since the degradation rate was maintained unchanged in optimal and iron-limiting conditions, it could be hypothesized thatA. borkumensis pseudomonine has the ability to compete with the rest of the microbial community in oil-polluted marine areas. Although a strategic role of siderophores in iron-limiting conditions could be hypothesized, the mechanism of their effective involvement has to be clarified by further investigations (e.g. a mutant strain with a knock-out mutation for this locus). Acknowledgments This work was funded by the European Community Projects KILL-SPILL (FP7-KBBE-2012.3.5-01-4 Project 312139 “Integrated Biotechnological Solutions for Combating Marine Oil Spills”) and

Adler, C., Corbalán, N.S., Seyedsayamdost, M.R., Pomares, M.F., de Cristóbal, R.E.,Clardy, J., Kolter, R., Vincent, P.A., 2012. Catecholate siderophores protect bacteria from pyochelin toxicity. PLoS ONE 7 (10), e46754. http://dx.doi.org/10.1371/journal. pone.0046754. Amir, A., Meshner, S., Beatus, T., Stavans, J., 2010. Damped oscillations in the adaptive response of the iron homeostasis network of E. coli. Mol. Microbiol. 76, 428–436. http://dx.doi.org/10.1111/j.1365-2958.2010.07111.x. Andersen, C.L., Jensen, J.L., Orntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription — PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245–5250. http://dx.doi.org/10.1158/0008-5472.CAN-04-0496. Andrews, S.C., 1998. Iron storage in bacteria. Adv. Microb. Physiol. 40, 281–351. Anthoni, U.,Christophersen, C., Nielsen, P.H.,Gram, L.,Petersen, B.O., 1995. Pseudomonine, an isoxazolidone with siderophoric activity from Pseudomonas fluorescens AH2 isolated from lake Victorian Nile perch. J. Nat. Prod. 58, 1786–1789. http://dx.doi.org/10.1021/ np50125a026. Archibald, F., 1983. Lactobacillus plantarum, an organism not requiring iron. FEMS Microbiol. Lett. 19, 29–32. http://dx.doi.org/10.1111/j.1574-6968.1983.tb00504.x. Barbeau, K., Rue, E.L., Bruland, K.W., Butler, A., 2001. Photochemical cycling of iron in the surface ocean mediated by microbial iron(III)-binding ligands. Nature 413, 409–413. http://dx.doi.org/10.1038/35096545. Baysse, C., Budzikiewicz, H., Uria-Fernandez, D., Cornelis, P., 2002. Impaired maturation of the siderophore pyoverdine chromophore in Pseudomonas fluorescens ATCC 17400 deficient for the cytochrome c biogenesis protein CcmC. FEBS Lett. 523, 23–28. Becquevort, S.,Lancelot, C.,Schoemann, V., 2007. The role of iron in the bacterial degradation of organic matter derived from Phaeocystis antarctica. Phaeocystis, major link in the biogeochemical cycling of climate-relevant elements. Biogeochemistry 83, 119–135. http://dx.doi.org/10.1007/s10533-007-9079-1. Blin, K., Medema, M.H., Kazempour, D., Fischbach, M.A., Breitling, R., Takano, E., Weber, T., 2013. antiSMASH 2.0 — a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Res. 4, W204–W212. http://dx.doi.org/10. 1093/nar/gkt449. Bonnet, S., Guieu, C., 2006. Atmospheric forcing on the annual iron cycle in the western Mediterranean Sea: a 1-year survey. J. Geophys. Res. 111 (C9). http://dx.doi.org/10. 1029/2005JC003213. Boopathy, R., 2000. Factors limiting bioremediation technologies. Bioresour. Technol. 74, 63–67. Church, M.J., Hutchins, D.A., Ducklow, H.W., 2000. Limitation of bacterial growth by dissolved organic matter and iron in the Southern Ocean. Appl. Environ. Microbiol. 66, 455–466. Cox, C.D., Adams, P., 1985. Siderophore activity of pyoverdin for Pseudomonas aeruginosa. Infect. Immun. 48 (1), 130–138. Cox, C.D., Rinehart Jr., K.L., Moore, M.L., Cook Jr., C., 1981. Pyochelin: novel structure of an iron-chelating growth promoter for Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U.S.A. Biochem. 78 (7), 4256–4260. Crisafi, F.,Denaro, R.,Genovese, M.,Yakimov, M.,Genovese, L., 2013. Application of relative real‐time PCR to detect differential expression of virulence genes in Vibrio anguillarum under standard and stressed growth conditions. J. Fish Dis. http://dx.doi.org/10.1111/ jfd.12158. Darling, P., Chan, M., Cox, A.D., Sokol, P.A., 1998. Siderophore production by cystic fibrosis isolates of Burkholderia cepacia. Infect. Immun. 66 (2), 874–877. Denaro, R.,D'Auria, G.,Di Marco, G.,Genovese, M.,Troussellier, M.,Yakimov, M.M.,Giuliano, L., 2005. Assessing terminal restriction fragment length polymorphism suitability for the description of bacterial community structure and dynamics in hydrocarbonpolluted marine environments. Environ. Microbiol. 7 (1), 78–87. http://dx.doi.org/ 10.1111/j.1462-2920.2004.00685.x. Dibble, J.T., Bartha, R., 1976. The effect of iron on the biodegradation of petroleum in seawater. Appl. Environ. Microbiol. 31 (4), 544–550. Dinkla, I.J., Janssen, D.B., 2003. Simultaneous growth on citrate reduces the effects of iron limitation during toluene degradation in Pseudomonas. Microb. Ecol. 45 (1), 97–107. http://dx.doi.org/10.1007/s00248-002-2023-y. Dinkla, I.J.T.,Gabor, E.M.,Janssen, D.B., 2001. Effects of iron limitation on the degradation of toluene by Pseudomonas strains carrying the TOL (pWWO) plasmid. Appl. Environ. Microbiol. 67 (8), 3406–3412. Dutta, T.K., Harayama, S., 2001. Analysis of long-side chain alkylaromatics in crude oil for evaluation of their fate in the environment. Environ. Sci. Technol. 35 (1), 102–107. http://dx.doi.org/10.1021/es001165a. Dyksterhouse, S.E., Gray, J.P., Herwig, R.P., Lara, J.C., Staley, J.T., 1995. Cycloclasticus pugetii gen. nov., sp. nov., an aromatic hydrocarbon-degrading bacterium from marine sediments. Int. J. Syst. Bacteriol. 45 (1), 116–123. http://dx.doi.org/10.1099/ 00207713-45-1-116. Earhart, C.F., 1996. Uptake and metabolism of iron and molybdenum, In: Neidhardt, F.C., Curtiss III, R., Ingraham, J.L., Lin, E.C.C., Low, K.B., Magasanik, B., Reznikoff, W.S., Riley, M., Schaechter, M., Umbarger, H.E. (Eds.), Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd ed. , vol. 1. ASM Press, Washington, DC. Ehrhardt, M., Klungsøyr, J., Law, R.J., 1991. Hydrocarbons: review of methods for analysis in sea water, biota, and sediments. Copenhagen: International Council for the Exploration of the Sea (ICES). Techn. Mar. Environ. Sci. 44.

52

R. Denaro et al. / Marine Genomics 17 (2014) 43–52

Genovese, M.,Crisafi, F.,Denaro, R.,Cappello, S.,Russo, D.,Calogero, R.,Santisi, S.,Catalfamo, M.,Modica, A.,Smedile, F.,Genovese, L.,Giuliano, L.,Yakimov, M., 2014. Effective bioremediation strategy for rapid in situ clean up of anoxic marine sediments in mesocosm oil spill simulation. Front. Microbiol. 14 (5), 162. http://dx.doi.org/10.3389/fmicb. 2014.00162. Guan, L.L., Kamino, K., 2001. Bacterial response to siderophore and quorum-sensing chemical signals in the seawater microbial community. BMC Microbiol. 1 (1), 27. http://dx.doi.org/10.1186/1471-2180-1-27. Hara, A., Syutsubo, K., Harayama, S., 2003. Alcanivorax which prevails in oil-contaminated seawater exhibits broad substrate specificity for alkane degradation. Environ. Microbiol. 5 (9), 746–753. http://dx.doi.org/10.1046/j.1468-2920.2003.00468.x. Homann, V.V., Edwards, K.J., Webb, E.A., Butler, A., 2009a. Siderophores of Marinobacter aquaeolei: petrobactin and its sulfonated derivatives. Biometals 22 (4), 565–571. http://dx.doi.org/10.1007/s10534-009-9237-0. Homann, V.V., Sandy, M., Tincu, J.A., Templeton, A.S., Tebo, B.M., Butler, A., 2009b. Loihichelins A–F, a suite of amphiphilic siderophores produced by the marine bacterium Halomonas LOB-5. J. Nat. Prod. 72 (5), 884–888. http://dx.doi.org/10. 1021/np800640h. Hudson, A.T., Bentley, R., 1970. Utilization of shikimic acid for the formation of mycobactin S and salicylic acid by Mycobacterium smegmatis. Biochemistry 9, 3984–3987. Hugo, N., Armengaud, J., Gaillard, J., Timmis, K.N., Jouanneau, Y., 1998. A novel [2Fe–2S] ferredoxin from Pseudomonas putida mt2 promotes the reductive reactivation of catechol 2,3-dioxygenase. J. Biol. Chem. 273 (16), 9622–9629. Johnson, K.S., Gordon, R.M., Coale, K.H., 1997. Iron distributions in the Equatorial Pacific: implications for new production. Limnol. Oceanogr. 42 (3), 419–431. Juàrez Tomàs, M.S., Bru de Labanda, E., de Ruiz Holgado, A.P., Nader-Macías, M.E., 2002. Estimation of vaginal probiotic lactobacilli growth parameters with the application of the Gompertz model. Can. J. Microbiol. 48, 82–92. Kanoh, K., Kamino, K., Leleo, G., Adachi, K., Shizuri, Y., 2003. Pseudoalterobactin A and B, new siderophores excreted by marine bacterium Pseudoalteromonas sp. KP20-4. J. Antibiot. 56 (10), 871–875. Keller-Schierlein, W., Hagmann, L., Zähner, H., Huhn, W., 1988. Maduraferrin, a novel siderophore from Acinomadura madurae. Helv. Chim. Acta 71, 1528–1534. Kem, M.P., Zane, H.K., Springer, S.D., Gauglitz, J.M., Butler, A., 2014. Amphiphilic siderophore production by oil-associating microbes. Metallomics. http://dx.doi.org/ 10.1039/C4MT00047A. Kirchman, D.L., Hoffman, K.A., Weaver, R., Hutchins, D.A., 2003. Regulation of growth and energetics of a marine bacterium by nitrogen source and iron availability. Mar. Ecol. Prog. Ser. 250, 291–296. Kube, M., Chernikova, T.N., Al-Ramahi, Y., Beloqui, A., Lopez-Cortez, N., Guazzaroni, M.E.,Heipieper, H.J., Klages, S.,Kotsyurbenko, O.R.,Langer, I., Nechitaylo, T.Y.,Lünsdorf, H., Fernández, M., Juárez, S., Ciordia, S., Singer, A., Kagan, O., Egorova, O., Petit, P.A., Stogios, P., Kim, Y., Tchigvintsev, A., Flick, R., Denaro, R., Genovese, M.,Albar, J.P., Reva, O.N., Martínez-Gomariz, M., Tran, H., Ferrer, M.,Savchenko, A.,Yakunin, A.F., Yakimov, M.M., Golyshina, O.V., Reinhardt, R., Golyshin, P.N., 2013. Genome sequence and functional genomic analysis of the oil degrading bacterium Oleispira antarctica. Nat. Commun. 4, 2156. http://dx.doi.org/10.1038/ncomms3156. Lamont, I.L., Beare, P.A., Ochsner, U., Vasil, A.I., Vasil, M.L., 2002. Siderophore mediated signalling regulates virulence factor production in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 99 (10), 7072–7077. Livak, K.J.,Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−DDCT method. Methods 25, 402–408. http://dx.doi.org/10. 1006/meth.2001.1262. Martinez, J.S., Zhang, G.P.,Holt, P.D.,Jung, H.T.,Carrano, C.J.,Haygood, M.G.,Butler, A., 2000. Self-assembling amphiphilic siderophores from marine bacteria. Science 287 (5456), 1245–1247. http://dx.doi.org/10.1126/science.287.5456.1245. Martínez, M., Ugalde, R.A., Almirón, M., 2006. Irr regulates brucebactin and 2,3dihydroxybenzoic acid biosynthesis, and is implicated in the oxidative stress resistance and intracellular survival of Brucella abortus. Microbiology 152 (9), 2591–2598. http://dx.doi.org/10.1099/mic.0.28782-0. Masse, E., Arguin, M., 2005. Ironing out the problem: new mechanisms of iron homeostasis. Trends Biochem. Sci. 30, 462–468. http://dx.doi.org/10.1016/j. tibs.2005.06.005. Matthijs, S.,Laus, G.,Meyer, J.M.,Abbaspour-Tehrani, K.,Schäfer, M.,Budzikiewicz,Cornelis, P., 2009. Siderophore-mediated iron acquisition in the entomopathogenic bacterium Pseudomonas entomophila L48 and its close relative Pseudomonas putida KT2440. BioMetals 22 (6), 951–964. http://dx.doi.org/10.1007/s10534-009-9247-y. McKew, B.A., Coulon, F., Yakimov, M.M., Denaro, R., Genovese, M., Smith, C.J., Osborn, A.M., Timmis, K.N.,McGenity, T.J., 2007. Efficacy of intervention strategies for bioremediation of crude oil in marine systems and effects on indigenous hydrocarbonoclastic bacteria. Environ. Microbiol. 9, 1562–1571. http://dx.doi.org/10.1111/j.1462- 2920.2007. 01277.x. Medema, M.H.,Blin, K.,Cimermancic, P.,de Jager, V.,Zakrzewski, P.,Fischbach, M.A.,Weber, T.,Breitling, R.,Takano, E., 2011. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Res. 39 (Suppl. 2), W339–W346. http://dx.doi.org/10.1093/ nar/gkr466. Mercado-Blanco, J.,van Der Drift, K.M., Olsson, P.E., Thomas-Oates, J.E.,Van Loon, L.C.,Bakker, P.A., 2001. Analysis of the pmsCEAB gene cluster involved in biosynthesis of salicylic acid and the siderophore Pseudomonine in the biocontrol strain Pseudomonas fluorescens WCS374. J. Bacteriol. 183, 1909–1920. http://dx.doi.org/10.1128/JB.183.6.1909-1920. 2001.

Mikesovà, E., Barànkovà, L., Sakmaryovà, I., Tatarkovà, I., Seeman, P., 2006. Quantitative multiplex real-time PCR for detection of PLP1 gene duplications in Pelizaeus– Merzbacher patients. Genet. Test. 10, 215–220. Okujo, N., Saito, M., Yamamoto, S., Yoshida, T., Miyoshi, S., Shinoda, S., 1994. Structure of vulnibactin, a new polyamine-containing siderophore from Vibrio vulnificus. BioMetals 7, 109–116. Person, T., Neilands, J.B., 1979. Revised structure of a catecholamide spermidine siderophore from Paracoccus denitrificans. Tetrahedron Lett. 50, 485–4808. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper — Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. Porter, K.G.,Feig, Y.S., 1980. The use of DAPI for identifying and counting aquatic microflora. Limnol. Oceanogr. 25, 943–948. Sabirova, J.S., Becker, A., Lünsdorf, H., Nicaud, J.M.,Timmis, K.N.,Golyshin, P.N., 2011. Transcriptional profiling of the marine oil-degrading bacterium Alcanivorax borkumensis during growth on n-alkanes. FEMS Microbiol. Lett. 319 (2), 160–168. http://dx.doi. org/10.1111/j.1574-6968.2011.02279.x. Sayyed, R.Z., Chincholkar, S.B., 2006. Purification of siderophores of Alcaligenes faecalis on Amberlite XAD. Bioresour. Technol. 97, 1026–1029. http://dx.doi.org/10.1016/j. biortech.2005.04.045. Schneiker, S., Martins dos Santos, V.A., Bartels, D., Bekel, T., Brecht, M., Buhrmester, J., Chernikova, T.N., Denaro, R., Ferrer, M., Gertler, C., Goesmann, A., Golyshina, O.V.,Kaminski, F.,Khachane, A.N.,Lang, S.,Linke, B.,McHardy, A.C.,Meyer, F.,Nechitaylo, T., Pühler, A., Regenhardt, D., Rupp, O., Sabirova, J.S., Selbitschka, W., Yakimov, M.M., Timmis, K.N.,Vorhölter, F.J.,Weidner, S.,Kaiser, O.,Golyshin, P.N., 2006. Genome sequence of the ubiquitous hydrocarbon-degrading marine bacterium Alcanivorax borkumensis. Nat. Biotechnol. 24 (8), 997–1004. http://dx.doi.org/10.1038/nbt1232. Schwyn, B.,Neilands, J.B., 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160 (1), 47–56. Semsey, S., Andersson, A.M., Krishna, S., Jensen, M.H., Masse, E., Sneppen, K., 2006. Genetic regulation of fluxes: iron homeostasis of Escherichia coli. Nucleic Acids Res. 34, 4960–4967. http://dx.doi.org/10.1093/nar/gkl627. Shuler, M.L.,Kargi, F., 2002. Bioprocess Engineering: Basic Concepts, 2nd ed. Prentice Hall PTR, Upper Saddle River, NJ. Sreedevi, B.,Preethi, S.,Pramoda, Kumari J., 2014. Isolation, production and optimization of siderophore producing pseudomonas from paddy soil. Int. J. Pharm. Res. Sci. 02 (1), 71–88. Staijen, I.E., Marcionelli, R., Witholt, B., 1999. The PalkBFGHJKL promoter is under carbon catabolite repression control in Pseudomonas oleovorans but not in Escherichia coli alk+ recombinants. J. Bacteriol. 181 (5), 1610–1616. Teramoto, M., Queck, S.Y., Ohnishi, K., 2013. Specialized hydrocarbonoclastic bacteria prevailing in seawater around a port in the Strait of Malacca. PLoS ONE 8 (6), e66594. http://dx.doi.org/10.1371/journal.pone.0066594. Tortell, P.D.,Maldonado, M.T.,Price, N.M., 1996. The role of heterotrophic bacteria in ironlimited ocean ecosystems. Nature 383, 330–332. Tortell, P.D., Maldonado, M.T., Granger, J., Price, N.M., 1999. Marine bacteria and biogeochemical cycling of iron in the oceans. FEMS Microbiol. Ecol. 29 (1), 1–11. Vandesompele, J., De Preter, K.,Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 18, 3(7). Vasil, M.L.,Ochsner, U.A., 1999. The response of Pseudomonas aeruginosa to iron: genetics, biochemistry and virulence. Mol. Microbiol. 34 (3), 399–413. Visca, P., Colotti, G., Serino, L., Verzili, D., Orsi, N., Chiancone, E., 1992. Metal regulation of siderophore synthesis In Pseudomonas aeruginosa and functional effects of siderophore–metal complexes. Appl. Environ. Microbiol. 58 (9), 2886–2893. Wagner, B., Vogel, H., Zanchetta, G., Sulpizio, R., 2010. Environmental changes on the Balkans recorded in the sediments from lakes Prespa and Ohrid. Biogeosci. Discuss. 7, 3365–3392. http://dx.doi.org/10.5194/bgd-7-3365-2010. Wang, Z.,Fingas, M.,Blenkinsopp, S.,Sergy, G.,Landriault, M.,Sigouin, L.,Foght, J.,Semple, K., 1998. Comparison of oil composition changes due to biodegradation and physical weathering in different oils. J. Chromatogr. 809 (1), 89–107. Xuewu, L., Millero, F.J., 2002. The solubility of iron in seawater. Mar. Chem. 77, 43–54. Yakimov, M.M., Golyshin, P.N., Lang, S., Moore, E.R.B., Abraham, W.R., Lünsdorf, H., Timmis, K.N., 1998. Alcanivorax borkumensis gen. nov., sp. nov., a new, hydrocarbon-degrading and surfactant-producing marine bacterium. Int. J. Syst. Bacteriol. 48 (2), 339–348. http://dx.doi.org/10.1099/00207713-48-2-339. Yakimov, M.M.,Denaro, R.,Genovese, M.,Cappello, S.,D'Auria, G.,Chernikova, T.N.,Timmis, K.N., Golyshin, P.N., Giuliano, L., 2005. Natural microbial diversity in superficial sediments of Milazzo Harbor (Sicily) and community successions during microcosm enrichment with various hydrocarbons. Environ. Microbiol. 7 (9), 1426–1441. Yakimov, M.M.,Timmis, K.N.,Golyshin, P.N., 2007. Obligate oil-degrading marine bacteria. Curr. Opin. Biotechnol. 18 (3), 257–266. Ziervogel, K.,McKay, L.J.,Rhodes, B.,Osburn, C.L.,Dickson-Brown, J.,Arnosti, C.,Teske, A., 2012. Microbial activities and dissolved organic matter dynamics in oil-contaminated surface seawater from the deepwater horizon oil spill site. PLoS ONE 7 (4), e34816. Zwietering, M.H., Jongenburger, I., Van't Rombouts, F.M., Riet, K., 1990. Modeling of the bacterial growth curve. Appl. Environ. Microbiol. 56, 1875–1881.