A Two-locus Molecular Characterization of Paramecium calkinsi

Protist, Vol. 163, 263–273, March 2012 http://www.elsevier.de/protis Published online date 27 July 2011

ORIGINAL PAPER

A Two-locus Molecular Characterization of Paramecium calkinsi Ewa Przybos´ a , Sebastian Tarcza,1 , Alexey Potekhinb , Maria Rautianc , and Małgorzata Prajera aDepartment

of Experimental Zoology, Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, Kraków 31-016, Sławkowska 17, Poland bDepartment of Microbiology, Faculty of Biology and Soil Science, St. Petersburg State University, Saint Petersburg 199034, Universitetskaya nab. 7/9, Russia cLaboratory of Protozoan Karyology, Biological Institute of St. Petersburg State University, Saint Petersburg 198504, Oranienbaumskoye shosse 2, Russia Submitted February 18, 2011; Accepted June 25, 2011 Monitoring Editor: C. Graham Clark

Paramecium calkinsi (Ciliophora, Protozoa) is a euryhaline species which was first identified in freshwater habitats, but subsequently several strains were also collected from brackish water. It is characterized by clockwise spiral swimming movement and the general morphology of the “bursaria type.” The present paper is the first molecular characterization of P. calkinsi strains recently collected in distant regions in Russia using ITS1-5.8S- ITS2-5 LSU rDNA (1100 bp) and COI (620 bp) mtDNA sequenced gene fragments. For comparison, our molecular analysis includes P. bursaria, exhibiting a similar “bursaria morphotype” as well as species representing the “aurelia type,” i.e., P. caudatum, P. multimicronucleatum, P. jenningsi, and P. schewiakoffi, and some species of the P. aurelia species complex (P. primaurelia, P. tetraurelia, P. sexaurelia, and P. tredecaurelia). We also use data from GenBank concerning other species in the genus Paramecium and Tetrahymena (which used as an outgroup). The division of the genus Paramecium into four subgenera (proposed by Fokin et al. 2004) is clearly presented by the trees. There is a clear separation between P. calkinsi strains collected from different regions (races). Consequently, given the molecular distances between them, it seems that these races may represent different syngens within the species. © 2011 Elsevier GmbH. All rights reserved. Key words: COI mtDNA; intraspecific polymorphism; ITS1-5.8S-ITS2-LSU rDNA; molecular phylogeny; Paramecium calkinsi.

Introduction The genus Paramecium comprises 12 relatively widely distributed valid species and 4 endemic African species (Fokin et al. 2004; Wichterman 1986). Variation in SSU rDNA (Strüder-Kypke et al. 2000a, b), COI mtDNA (Strüder-Kypke and Lynn 2010), and morphometric and biological data (Fokin 1

Corresponding author; fax +48 12 422 42 94 e-mail [email protected] (S. Tarcz).

© 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.protis.2011.06.006

2001) show that species within the genus form a monophyletic cluster divided into four subgenera, which “reflects the phylogeny of the genus and can also be seen in a large set of morphobiological features of the ciliates” (Fokin et al. 2004). According to Fokin et al. (2004), the first subgenus of the genus Paramecium, named Chloroparamecium due to its prominent symbiosis with the green alga Chlorella, consists only of P. bursaria. This species occupies the basal position in the tree presenting all the species of the genus. The second

264 E. Przybo´s et al.

subgenus, Helianter, includes P. putrinum and P. duboscqui, both of which branch off in the genus after P. bursaria. The third subgenus, Cypriostomum, encompasses P. woodruffi, P. nephridiatum, P. calkinsi, and P. polycaryum. This subgenus is placed in the middle of the genus tree. Finally, the fourth subgenus, named Paramecium due to the fact that all of its species have a cigar-shape, contains the following species: the P. aurelia species complex, P. jenningsi, P. schewiakoffi, P. caudatum, P. multimicronucleatum, and some rare species, i.e., P. wichtermani, P. africanum, P. jankowski, and P. ugandae. The well-defined species were classified into two groups according the shape of the body, the “aurelia” group and the “bursaria” group (Wenrich 1928). The “aurelia” group includes species characterized by a cigar-shaped body, i.e., the P. aurelia species complex, P. jenningsi, P. caudatum, P. multimicronucleatum, and P. schewiakoffi. The “bursaria” group includes P. bursaria, P. calkinsi, P. woodruffi, P. nephridiatum, P. polycaryum, P. duboscqui, and P. putrinum. The species are characterized by a shorter and wider body, truncated in its anterior part (Vivier 1974). Paramecium calkinsi Woodruff, 1921 (Wenrich 1928) is characterized by clockwise spiral swimming movement, which is a unique feature in the genus Paramecium. Its general morphology is of the “bursaria type,” with the anterior part being the broadest (Vivier 1974). Some morphological features of the species were studied by Fokin and Chivilev (1999), who also performed morphometric analysis. According to them, the average size of P. calkinsi cells (fixed and stained by Chatton and Lwoff) in four investigated stocks was 115.0 x 38.0 ␮m, however, the length of living specimens may be greater, reaching 110–140 ␮m (Vivier 1974). The species shows a variable number of micronuclei (1–5), but usually there are 2 per cell, with a size of 1.7–3.4 ␮m, generally located close to the macronucleus. The micronuclei are of the “endosomal type”—they have a thin, light periphery, a large chromatin body in the centre, and are spheroid in shape (Fokin 1997). The main stages of nuclear reorganization in conjugation, the mating types, and the occurrence of selfing were described by Nakata (1958) and also by Fokin et al. (2001). Two syngens with a binary mating system were found in this species (Wichterman 1953, quoted in Wichterman 1986), which is characterized by inbreeding (Fokin et al. 2001). P. calkinsi (Woodruff 1921) is recognized as a euryhaline species, but was first described as a

freshwater one. Subsequently, several strains were collected from brackish water. The species was discovered in North America (original description by Woodruff 1921), Europe and Asia (according to Fokin et al. 2001, 2004). According to literature data (Fokin and Chivilev 1999; Fokin 1997), the European and Asian strains of P. calkinsi were established from natural populations collected in Russia (from the White Sea, the Karelian District, the Kandalaksha District, the Barents Sea, the Murmansk District, and the Vladivostok District), in Armenia (from the Sevan lake district), and in Japan (from the coast of the Inland Sea of Japan). However, these strains are no longer in existence. Molecular studies (PCR-based fingerprint methods and sequenced gene fragments) of the morphological species of the genus Paramecium have been conducted mainly for the P. aurelia spp. complex using different markers: cytB mtDNA (Barth et al. 2008); 10 nuclear and 5 mitochondrial markers (Catania et al. 2009); the ITS1-5.8S-ITS2 region (Coleman 2005); DNA fragments analyzed by PFGE (Nekrasova et al. 2010); RAPD, ARDRA, hsp70, and COI mtDNA (Przybo´s et al. 2007, 2008); RAPD (Stoeck et al. 1998); and the ITS1-5.8SITS2-5 LSU rDNA region (Tarcz et al. 2006). Apart from its application in studies on the P. aurelia species complex, RAPD fingerprints have proved useful in identifying the following species: P. nephridiatum, P. dubosqui, P. woodruffi, and P. calkinsi (Fokin et al. 1999a, b); P. jenningsi (Przybo´s et al. 2003); P. bursaria (Greczek-Stachura et al. 2010); and P. caudatum (Stoeck et al. 2000). Papers concerning molecular analysis of DNA fragments obtained from other Paramecium species are rather sparse, and are focused on the rDNA region for P. bursaria (Greczek-Stachura et al. 2010; Hoshina et al. 2006); P. caudatum and P. multimicronucleatum (Barth et al. 2006); and P. schewiakoffi (Fokin et al. 2004) and on part of the mitochondrial genome (COI gene) for P. caudatum and P. multimicronucleatum (Barth et al. 2006). The present paper is the first molecular characterization of P. calkinsi strains that were recently collected (2004–2010) in very distant regions in Russia (Fig. 1). The aim of this study is to assess the genetic divergence between P. calkinsi and other Paramecium species and polymorphism within P. calkinsi. The molecular characterization of the strains was conducted with the application of two loci (ITS1-5.8S-ITS2-5 LSUrDNA and COI mtDNA), as at least a two-locus approach should be used in molecular phylogenetics (Dunthorn et al. 2011).

Molecular Characterization of Paramecium calkinsi 265

Figure 1. Map of sampling sites of P. calkinsi strains in Russia, 1 – White Sea, Sredniy Island; 2 – Lake Baikal, Olchon Island; 3 – Chukotka, Anadyr region; 4 – Kamchatka, Caldero Uzon; 5 – Far East, Maritime Territory, Okeanskaya (suburb of Vladivostok). Scale – 1000 km.

Results and Discussion Cytological analysis. Giemsa-stained P. calkinsi strains (Table 1) showed a variable number of endosomal-type micronuclei (with chromatin in the centre and a light periphery) (Figs 2, 3): 1 or 2 in strains from Chukotka and the White Sea; 1, 2, 3, or sometimes 4 in the BOB 130-7 strain from an island in Lake Baikal; and 2 in strains from the Maritime Territory. However, in photographs only 2 or 3 micronuclei are visible (Fig. 3). Analysis of studied DNA fragments. Sequences of the rDNA region containing the ITS15.8S-ITS2-5 end of LSU rDNA (1064–1096 bp) and cytochrome oxidase subunit I (717–723 bp) from 17 (COI) to 19 (rDNA) strains of the genus Paramecium were obtained by analysis (Figs 4, 5). The values of intraspecific haplotype diversity (Hd) were 0.965 for the rDNA fragment and 0.963 for COI, which indicates great differentiation among the studied P. calkinsi strains. Only three strains from the Maritime Territory and two the White Sea represent the same haplotype characteristic for each region. Nucleotide diversity (␲) amounted to 0.0856 for rDNA and 0.2434 for COI. This shows and confirms the greater variability of mitochondrial genome. The nucleotide frequencies were A = 0.31, T = 0.286, C = 0.169, and G = 0.234 for rDNA and

Figure 2. A schematic figure showing cell shape and dimensions, as well as type of micronuclei of Paramecium species from the “aurelia type” group: P. multimicronucleatum (a) - several small vesicular micronuclei, P. caudatum (b) – one compact micronucleus, P. aurelia spp.(c) – two vesicular micronuclei, and from the “bursaria type” group P. calkinsi (d) - with a variable number (1-5) of micronuclei, more common two micronuclei of the “endosomal” type (see text). Scale 100 ␮m.

266 E. Przybo´s et al.

Figure 3. P. calkinsi strains, A and B from Chukotka, C from Kamchatka, D from Lake Baikal, E from the White Sea, and F from Maritime Territory. Macronucleus and micronuclei of endosomal type are shown (arrows). Giemsa stain. Scale 10 ␮m.

JF304179 JF304180 JF304181 JF304160 JF304161 JF304162

JF304176 JF304177 JF304178 JF304157 JF304158 JF304159

JF304173 JF304174 JF304175 JF304154 JF304155 JF304156

Russia, Far East, Maritime Territory, Okeanskaya (suburb of Vladivostok) (brakish water) PRO 165- 1 PRO 165- 6 PRO 165- 7

43.18N; 131.90E

Russia, Chukotka, Anadyr region (fresh water) Russia, Kamchatka, Caldero Uzon (brakish water) Ch 3 Ch 7 KUZ 62-1

64.7N; 178.0E 54.5N; 159.7E

Potekhin 2004 Rautian, Beliavskaya 2009 Rautian 2007 Rautian, Beliavskaya 2010 Potekhin, Nekrasova 2007 Russia, White Sea, island Sredniy (brakish water) Russia, Lake Baikal, Olchon Island (fresh water) BM 1-11 BM 14-2 BOB 130-7

66.30N; 33.68E 53.2N; 107.4E

COI mtDNA ITS1-5.8SITS2-5 LSU rDNA

Geographic origin/type of water Strain designation

Table 1. Paramecium calkinsi strains.

Coordinates

Collector’s name

GenBank Accession Numbers

Molecular Characterization of Paramecium calkinsi 267

A = 0.29, T = 0.382, C = 0.167, and G = 0.162 for COI, and revealed a high proportion of A-T pairs which corresponds with typical characteristics of mitochondrial DNA. The mean divergence of all the studied P. calkinsi sequence pairs was p = 0.008/0.116 (rDNA / COI); see also Supplementary Tables S1 and S2. The mean divergence of the studied DNA fragments obtained from all the studied strains (including other Paramecium species) was p = 0.086/0.243 (rDNA / COI). In the studied fragments, we found 26/192 (rDNA / COI) variable positions (11/146 parsimony informative ones) between P. calkinsi strains and 287/402 (rDNA / COI) variable positions (151/325 parsimony informative ones) between all the studied strains. There were no substitutions among strains from a single region (the White Sea, Chukotka, or the Maritime Territory). ModelTest identified the TrN model for the ITS1-5.8S-ITS2-5 end of LSUrDNA (I = 0, G = equal rates for all sites) and GTR + G for COI mtDNA (I = 0, G = 0.2004) as the best nucleotide substitution models for Bayesian analysis. Taxonomic relationships within P. calkinsi. The phylogenetic relationships identified on the basis of the rDNA fragment (Fig. 4) show that the studied strains of P. calkinsi are monophyletic and form a distinct clade, separated from the “aurelia” group and P. bursaria (used in the present analysis as an outgroup). In the case of a tree based on analysis of the COI mtDNA fragment (Fig. 5), P. calkinsi strains are placed together with other species belonging to the subgenus Cypriostomum. Other subgenera of Paramecium genus are placed in the tree as was proposed by Fokin et al. (2004). The basal nodes in the ITS1-5.8S-ITS2-5 LSUrDNA P. calkinsi subtree are generally consistent with the nodes in the COI subtree. In both trees, three branches can be distinguished. The first of these contains strains Ch3, Ch7 from Chukotka and strains from the Maritime Territory (PRO165-1, PRO165-6, and PRO165-7). P. calkinsi from Lake Baikal appears as a separate branch between the above-mentioned strains and a third group containing strains from the White Sea region (BM1-11, BM14-2) and Kamchatka (KUZ62-1). An exception appeared in the NJ ribosomal tree—the strain from Lake Baikal is placed as the most distant branch among the P. calkinsi strains, which may be caused by low bootstrap support. Moreover, a comparison of the common fragments obtained from the studied COI sequences with two GenBank records (Italian strain FN421329 and German strain FJ905147) showed that a new, divergent cluster was formed by these two previously analyzed strains (Fig. 5).

268 E. Przybo´s et al. Figure 4. Phylogram constructed for nine P. calkinsi strains and for other Paramecium species: P. bursaria (set as an outgroup), P. caudatum, P. multimicronucleatum, P. schewiakoffi, P. jenningsi, and some species of the P. aurelia complex, based on a comparison of sequences from ITS1-5.8S-ITS2-5 LSU rDNA fragment using the Neighbor Joining method. Bootstrap values for Neighbor Joining, Maximum Parsimony analysis and posterior probabilities for Bayesian Inference are shown. There were a total of 1073 positions in the final dataset. Phylogenetic analyses were conducted in MEGA 5.0 (NJ/MP) and Mr Bayes 3.1.2 (BI).

Molecular Characterization of Paramecium calkinsi 269

Figure 5. Phylogram constructed for eleven P. calkinsi strains (including two DNA sequences from GenBank), other Paramecium species and Tetrahymena sp. (set as an outgroup) based on a comparison of sequences from COI mtDNA fragment using the Neighbor Joining method. Bootstrap values for Neighbor Joining, Maximum Parsimony analysis and posterior probabilities for Bayesian Inference are shown. There were a total of 620 positions in the final dataset. Phylogenetic analyses were conducted in MEGA 5.0 (NJ/MP) and Mr Bayes 3.1.2 (BI).

270 E. Przybo´s et al.

Taxonomic relationships within Paramecium. Although the obtained substitution rate is faster in the COI gene (p = 0.116) than in the rDNA fragment (p = 0.008), the topology of both trees is very similar. The COI tree topology corresponds to the subgroups proposed by Jankowski in 1969, quoted in Strüder-Kypke et al. 2000a, based on morphological features such as cell size and cell shape, the position of the cytostome, stomatogenetic patterns, number of somatic kineties, and nuclear characteristics or intra-genus relationships based on SSU rDNA analysis, which confirms the existence of four subgenera (Fokin et al. 2004). The basal node which appears next to the outgroup Tetrahymena is composed of two strains of P. bursaria (Chloroparamecium). The next clade contains two sister species, P. dubosqui and P. putrinum (Helianter). The third subgenus (Cypriostomum, known as the “woodruffi” subgroup) contains the studied P. calkinsi strains and one strain of P. nephridiatum, one strain of P. woodruffi, and two strains of P. polycaryum. The close relationship of P. calkinsi, P. nephridiatum, and P. woodruffi is also confirmed by some cytological similarities (number and type of micronuclei) of these species, but they differ at the behavioral level (manner of swimming) and with regard to molecular analysis, that is, RAPD markers (Fokin et al. 1999a). The last subgenus (Paramecium) contains species proposed as members of the “aurelia” subgroup. P. caudatum and P. multimicronucleatum generally appear on separate branches with substantial bootstrap support. Species of the P. aurelia complex, P. jenningsi, and P. schewiakoffi form a monophyletic cluster. The placement of P. jenningsi and P. schewiakoffi among the members of the P. aurelia species complex confirms the close relationships between these species (Fokin et al. 2004) as well as affinities between P. jenningsi and the P. aurelia spp. (Coleman 2005; Hori et al. 2006). It also suggests that P. jenningsi and P. schewiakoffi could be included as members of the P. aurelia species complex (Potekhin et al. 2007). Comparative analysis of the COI gene of the phylum Ciliophora (Strüder-Kypke and Lynn 2010) shows that P. calkinsi is placed close to P. bursaria, but as a separate node, and it is divergent from P. aurelia, P. caudatum, and P. multimicronucleatum. Previous studies using an SSU rDNA fragment showed that P. calkinsi is close to P. bursaria and confirmed a larger distance between P. calkinsi and P. tetraurelia (Strüder-Kypke et al. 2000a). The intraspecific mean variability p = 0.008 / 0.116 (rDNA / COI) of the studied strains of P. calkinsi was higher than that of P. caudatum (rDNA

p = 0.000 / mtDNA p = 0.012), which is thought (based on molecular data only) to be a species without syngens, or cryptic species (Barth et al. 2006; Stoeck et al. 2000). P. caudatum does have syngens, but the borders between them are not so well-pronounced as in most other Paramecium species according to data from the Biological Institute of St. Petersburg State University, Russia (unpubl. observ.). According to a comparison of ribosomal data, P. calkinsi has a similar level of polymorphism as P. bursaria (Greczek-Stachura et al. 2010), in which the mean genetic distance between syngens (cryptic species) equals p = 0.009 for rDNA. On the other hand, in the P. aurelia complex greater variation in rDNA and smaller variation in mtDNA were detected, for example: rDNA p = 0.013, mtDNA p = 0.06 for P. dodecaurelia (Przybo´s et al. 2008); rDNA p = 0.011, mtDNA p = 0.084 for P. pentaurelia (Przybo´s et al. 2011); and rDNA p = 0.016, mtDNA p = 0.092 for P. novaurelia (Tarcz 2007, unpubl. results). No correlation was observed between the geographical origin of the studied strains within the P. aurelia complex and their molecular characteristics, for P. tetraurelia (Przybo´s et al. 2009), P. pentaurelia (Przybo´s et al. 2011), and P. novaurelia (Tarcz 2007, unpubl. results). The P. aurelia complex is characterized by inbreeding which occurs to various degrees in different species (Landis 1986; Sonneborn 1975), causing an increase in intraspecific differentiation. As P. calkinsi is also characterized by inbreeding, it may be supposed that our investigations could reveal possible polymorphism within the species. It can be observed on the COI tree (Fig. 5), where P. calkinsi strains are grouped separately according to their geographical origin: Europe (Germany, Italy, and the White Sea) and Asia (Kamchatka, Baikal, the Maritime Territory, and Chukotka). It seems reasonable to hypothesize that the observed grouping of P. calkinsi strains reflects the existence of syngens or geographical races within the species. Genetic distances, which are similar to those in the P. aurelia species complex, also corroborate the existence of syngens. Future investigations with more numerous strains or different markers are likely to reveal intraspecific polymorphism comparable to that in the species of the Paramecium aurelia complex.

Methods Material: The P. calkinsi strains investigated in this study were found in several very distant regions in Russia (Fig. 1) that

Molecular Characterization of Paramecium calkinsi 271 have never been explored before. They were collected from brackish and fresh water (Table 1). For comparison, strains of nine other species (Supplementary Table S3) were used: P. bursaria, which represents the “bursaria morphotype” as well as species representing the “aurelia type,” including the morphological species P. caudatum, P. multimicronucleatum, P. jenningsi, and P. schewiakoffi and some species of the P. aurelia species complex. Among the latter, species with different mating type inheritance were used: caryonidal (P. primaurelia), clonal (P. tetraurelia, P. sonneborni), and synclonal (two P. tredecaurelia strains representing complementary mating types). Data concerning other species of the genus Paramecium and Tetrahymena (outgroup) were obtained from GenBank. Figure 2 schematically presents cell shapes, dimensions and the type of micronuclei of Paramecium species from the “aurelia-type group,” i.e., P. multimicronucleatum (a), P. caudatum (b), and P. aurelia spp.(c), as well as P. calkinsi (d) from the “bursaria-type” group. Strain collection methods: A volume of 50 mL of water with plankton was drawn from particular sampling sites. Paramecia were isolated 48 hours after sampling, with all paramecia found in a sample considered as the same population (e.g., PRO 165—one population, BM 1 and BM 14—two populations). In some sites, paramecia occurred in fresh water (Lake Baikal, Chukotka), while in others in brackish water (the White Sea, the Maritime Territory, Kamchatka). Strain cultivation methods: The paramecia were cultivated on a lettuce medium inoculated with Enterobacter aerogenes (Sonneborn 1970). All Paramecium strains used in present studies are kept in Department of Experimental Zoology, Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, Kraków, Poland. These materials will be available on request. Cytological methods: P. calkinsi strains were identified by cell shape, dimensions, manner of swimming, and the type and number of their micronuclei (Vivier 1974) on Giemsa-stained slides (after fixation and hydrolysis, Przybo´s 1978) (Fig. 3). Molecular methods: Paramecium genomic DNA was isolated from vegetative cells at the end of the exponential phase using a NucleoSpin Tissue Kit (Macherey-Nagel, Germany), with 500 ␮L of cell culture used for DNA extraction. ITS1-5.8S-ITS2-5 LSU rDNA (1100 bp) and mitochondrial COI (720 bp) fragments were sequenced and analyzed. For the amplification of ITS1-5.8S-ITS2-5 LSU rDNA, two pairs of primers were used: ITS1 (5 -TCCGTAGGTGAACCTGCGG-3 ) – ITS4 (5 -TCCTCCGCTTATTGATATGC-3 ), amplifying the ITS1-5.8S-ITS2 region, and ITS3zg (5 CryAwCGATGAAGAACGCAGCC-3 ) – 3pLSU (5 -CAAGACG GGTCAGTAGAAGCC-3 ), amplifying the 5 end of LSU rDNA. Oligonucleotides ITS1 and ITS4 are universal eukaryprimers (http://www.biology.duke.edu/fungi/mycolab/ otic primers.htm), whereas ITS3zg and 3pLSU were constructed using OligoAnalyzer 3.0 (Tarcz et al., 2011 unpubl. data; http://scitools.idtdna.com/analyzer/). PCR amplification of both markers was carried out in a final volume of 40 ␮L containing 4 ␮L of DNA, 1.5 U of Taq-Polymerase (EurX, Poland), 0.6 ␮L of each primer (at 20 mM), 10x PCR buffer, and 0.8 ␮L of 10 mM dNTPs in a T-personal thermocyclerTM (Biometra GmbH, Germany). The protocol for amplification of ribosomal DNA fragments consisted of initial denaturation at 94 ◦ C, for 2 min, followed by 34 cycles of denaturation at 94 ◦ C, for 5 s, annealing at 50 ◦ C, for 5 s, and extension at 72 ◦ C, for 90 s, with a final extension at 72 ◦ C, for 1 min. To amplify the COI region of mitochondrial DNA, F388dT (5 - TGTAAAACGACGGCCAGTGG wkCbAAAGATGTwGC-3 ) and R1184dT (5 - CAGGAAACA

were GCTATGACTAdACyTCAGGGTGACCrAAAAATCA-3 ) used with the previously described protocol (Strüder-Kypke and Lynn 2010). After amplification, the PCR products were electrophoresed in 1% agarose gel for 45 min at 85 V with a DNA molecular weight marker (XIV Roche, France). For purification, 30 ␮L of each PCR product was separated on 1.8% agarose gel (100 V for 60 min). Then, the band representing the examined fragment was cut out and purified using NucleoSpin Extract II (Macherey-Nagel, Germany). Cycle sequencing was done in both directions with the application of the BigDye Terminator v3.1 (Applied Biosystems, USA). The primers used in PCR reactions were applied for sequencing the rDNA region and the primer pair M13F (5 -TGTAAAACGACGGCCAGT-3 ) – M13R (5 -CAGGAAACAGCTATGAC-3 ) was used for COI fragment sequencing (Strüder-Kypke and Lynn 2010). The sequencing reaction was carried out in a final volume of 10 ␮L containing 3 ␮L of template, 1 ␮L of BigDye (1/4 of the standard reaction), 1 ␮L of sequencing buffer, and 1 ␮L of 5 mM primer. The sequencing products were precipitated using ExTerminator (A&A Biotechnology, Poland) and separated on an ABI PRISM 377 DNA Sequencer (Applied Biosystems, USA). Sequences are available in the NCBI GenBank database (see Tab. 1 and 4 for the accession numbers). Data analysis: Sequences were examined visually using Chromas Lite (Technelysium, Australia) to evaluate and correct chromatograms. Alignment and analysis of the studied sequences were conducted using Clustal W (Thompson et al. 1994) in the BioEdit program (Hall 1999) and checked manually. All of the obtained sequences were unambiguous and were used for analysis. Phylograms were constructed for the studied fragments using MEGA v5.0 (Tamura et al. 2007) with the neighbor-joining method (NJ) (Saitou and Nei 1987) and maximum parsimony (MP) (Nei and Kumar 2000). NJ analysis was performed using a Kimura 2-parameter correction model (Kimura 1980) by bootstrapping with 1000 replicates (Felsenstein 1985). MP analysis was evaluated with the minmini heuristic parameter (level = 2) and bootstrapping with 1000 replicates. For the analyses, appropriate nucleotide substitution models were determined using ModelTest Server 1.0 (Posada 2006) in conjunction with PAUP*4.0b (Swofford 2002). Bayesian analysis (BI) was performed using MrBayes v3.1.2 (Ronquist and Huelsenbeck 2003). Analysis was run for 5,000,000 generations and trees were sampled every 100 generations. All trees were visualized with Tree View v1.6.6 (Page 1996). Haplotype diversity, nucleotide diversity and analysis of variable nucleotide positions were calculated using DnaSP v5.10.01 (Librado and Rozas 2009). Nucleotide frequencies were computed with MEGA v5.0 (Tamura et al. 2004, 2007).

Acknowledgements The authors are very grateful to Dr Sergei I. Fokin, Department of Invertebrate Zoology, St. Petersburg State University, Russia for providing the drawings of Paramecium spp. (Fig. 2). This research was partly supported by the grant (to S.Tarcz) No. N N303 415636 of the Ministry of Science and Higher Education, Warsaw, Poland. The work of the Russian labs is supported by RFBR grants 10-0401192 and by grant NS-65439.2010.4.

272 E. Przybo´s et al.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.protis.2011.06.006.

References Barth D, Krenek S, Fokin SI, Berendonk TU (2006) Intraspecififc genetic variation in Paramecium revealed by mitochondrial cytochrome c oxidase I sequences. J Eukaryot Microbiol 53:20–25 Barth D, Przybos´ E, Fokin SI, Schlegel M, Berendonk TU (2008) Cytochrome b sequence data suggest rapid speciation within the Paramecium aurelia species complex. Mol Phylogenet Evol 49:669–673 Catania F, Würmser F, Potekhin AA, Przybos´ E, Lynch M (2009) Genetic diversity in the Paramecium aurelia species complex. Mol Biol Evol 26:421–431 Coleman AW (2005) Paramecium aurelia revisited. J Eukaryot Microbiol 52:68–77 Dunthorn M, Foissner W, Katz LA (2011) Expanding character sampling for ciliate phylogenetic inference using mitochondrial SSU-rDNA as a molecular marker. Protist 162:85–99 Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791 Fokin SI (1997) Morphological diversity of the micronuclei in Paramecium. Arch Protistenkd 148:375–387 Fokin SI (2001) Paramecium (Ciliophora, Protista). Taxonomy and phylogenetic relationships. Zool Zhurnal 80:899–908, In Russian Fokin SI, Chivilev SM (1999) Brackish water Paramecium species and Paramecium polycaryum. Morphometrical analysis and some biological peculiarities. Acta Protozool 38: 105–117 Fokin SI, Przybos´ E, Chivilev SM (2001) Nuclear reorganization variety in Paramecium (Ciliophora: Peniculida) and its possible evolution. Acta Protozool 40:249–261 Fokin SI, Stoeck T, Schmidt HJ (1999a) Rediscovery of Paramecium nephridiatum Gelei, 1925 and its characteristics. J Eukaryot Microbiol 46:416–425 Fokin SI, Stoeck T, Schmidt HJ (1999b) Paramecium dubosqui Chatton, Brachon. Distribution, ecology and taxonomy, 1933. Eur J Protistol 35:161–167 Fokin SI, Przybos´ E, Chivilev SM, Beier CL, Horn M, Skotarczak B, Wodecka B, Fujishima M (2004) Morphological and molecular investigations of Paramecium schewiakoffi nov. spec. (Ciliophora, Oligohymenophorea) and current status of Paramecium distribution, and taxonomy of Paramecium spp. Eur J Protistol 40:225–243 Greczek-Stachura M, Tarcz S, Przybos´ E (2010) Intra-specific differentiation of Paramecium bursaria strains by molecular methods – preliminary studies. Folia biol (Kraków) 58: 35–45

Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 Hori M, Tomikawa I, Przybos´ E, Fujishima M (2006) Comparison of the evolutionary distances among syngens and sibling species of Paramecium. Mol Phylogenet Evol 38:697–704 Hoshina R, Hayashi S, Imamura N (2006) Intraspecific genetic divergence of Paramecium bursaria and reconstruction of paramecian phylogenetic tree. Acta Protozool 42:171–181 Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–120 Landis WG (1986) The Interplay among Ecology, Breeding Systems, and Genetics in the Paramecium aurelia and Paramecium bursaria Complexes. In Corliss JO, Patterson DJ (eds) Progress in Protistology Vol. 1. Biopress, Bristol, pp 287–307 Librado P, Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–1452 Nakata A (1958) Mating types in Paramecium calkinsi. Doubutsugaku zasshi 67:210–213 (in Japanese, English Abstract) Nei M, Kumar S (2000) Molecular Evolution and Phylogenetics. Oxford University Press, New York Nekrasova IV, Przybos´ E, Rautian MS, Potekhin AA (2010) Electrophoretic karyotype polymorphism of sibling species of the Paramecium aurelia complex. J Eukaryot Microbiol 57:494–507 Page RDM (1996) TreeView: An application to display phylogenetic tress on personal computers. Bioinformatics 12:357–358 Posada D (2006) ModelTest Server: a web-based tool for the statistical selection of models of nucleotide substitution online. Nucleic Acids Res 34:700–703 Potekhin A, Nekrasova I, Skoblo I, Berendonk T, Rautian M (2007) Sibling species concept in ciliates Paramecium revisited: zoogeographic and genomic aspects of syngen biology. Protistology 5:64–65 Przybos´ E (1978) Cytological and karyological studies of Paramecium jenningsi. Folia biol (Kraków) 26:25–29 Przybos´ E, Skotarczak B, Wodecka B (2003) Phylogenetic relationships of Paramecium jenningsi strains (classical analysis and RAPD studies). Folia biol (Kraków) 51:185–195 Przybos´ E, Tarcz S, Fokin S (2009) Molecular polymorphism of Paramecium tetraurelia (Ciliophora, Protozoa) in strains originating from different continents. Folia biol (Kraków) 57:57–63 Przybos´ E, Tarcz S, Greczek-Stachura M, Surmacz M (2011) Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences”. Eur J Protistol 47:138–143 Przybos´ E, Prajer M, Greczek-Stachura M, Skotarczak B, Maciejewska A, Tarcz S (2007) Genetic analysis of the Paramecium aurelia species complex (Protozoa: Ciliophora) by classical and molecular methods. Syst Biodivers 5:417–434 Przybos´ E, Tarcz S, Greczek-Stachura M, Surmacz M, Potekhin A, Rautian M (2008) Molecular studies on intraspecific differentiation of Paramecium dodecaurelia, with

Molecular Characterization of Paramecium calkinsi 273 description of new stands of the species (Protozoa, Ciliophora). Folia biol (Kraków) 56:249–262 Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574 Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 Sonneborn TM (1970) Methods in Paramecium Research. In Prescott DM (ed) Methods in Cell Physiology Vol. 4. Academic Press, New York, London, pp 241–339 Sonneborn TM (1975) The Paramecium aurelia complex of fourteen sibling species. Trans Am Microsc Soc 94: 155–178 Stoeck T, Przybos´ E, Schmidt HJ (1998) Combination of genetics with inter-and intra-strain crosses and RAPDfingerprints reveals different population structures within the Paramecium aurelia species complex. Eur J Protistol 34:348–355 Stoeck T, Welter H, Seitz-Bender D, Kusch J, Schmidt HJ (2000) ARDRA and RAPD-fingerprinting reject the sibling species concept for the ciliate Paramecium caudatum (Ciliophora, Protista). Zool Scripta 29:75–82 Strüder-Kypke MC, Lynn DH (2010) Comparative analysis of the mitochondrial cytochrome c oxidase subunit I (COI) gene in ciliates (Alveolata, Ciliophora) and evaluation of its suitability as a biodiversity marker. Syst Biodivers 8: 131–148 Strüder-Kypke MC, Wright A-DG, Fokin SI, Lynn DH (2000a) Phylogenetic relationships of the genus Paramecium inferred from small subunit rRNA sequences. Mol Phylogenet Evol 14:122–130

Strüder-Kypke MC, Wright A-DG, Fokin SI, Lynn DH (2000b) Phylogenetic relationships of the subclass Peniculia (Oligohemenophorea, Ciliophora) inferred from small subunit rRNA gene sequences. J Eukaryot Microbiol 47:419–429 Swofford DL (2002) In: PAUP. Phylogenetic Analysis Using Parsimony and Other Methods, version 4.0. Sinauer Associates, Sunderland, MA, USA Tamura K, Dudley J, Nei M (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599 Tamura K, Nei M, Kumar S (2004) Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci USA 101:11030–11035 Tarcz S, Przybos´ E, Prajer M, Greczek-Stachura M (2006) Intraspecific variation of diagnostic rDNA genes in Paramecium dodecaurelia, P. tredecaurelia and P. quadecaurelia (Ciliophora, Oligohymenophorea). Acta Protozool 45:255–263 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Vivier E (1974) Morphology, Taxonomy and General Biology of the Genus Paramecium. In Van Wagtendonk WJ (ed) Paramecium, a Current Survey. Elsevier, Amsterdam, pp 1–89 Wenrich DH (1928) Eight well-defined species of Paramecium (Protozoa, Ciliata). Trans Am Microsc Soc 47:275 Wichterman R (1986) The Biology of Paramecium. 2nd Edition Plenum Press, New York, London Woodruff LL (1921) The structure, life history, and intrageneric relationships of Paramecium calkinsi, sp. nov. Biol Bull 41:171–180