Environmental Microbiology (2002) 4(4), 193–203
Minireview A review of bacterial methyl halide degradation: biochemistry, genetics and molecular ecology I. R. McDonald,1* K. L. Warner,1 C. McAnulla,1 C. A. Woodall,1 R. S. Oremland 2 and J. C. Murrell 1 1 Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK. 2 US Geological Survey, Menlo Park, CA 94025, USA. Summary Methyl halide-degrading bacteria are a diverse group of organisms that are found in both terrestrial and marine environments. They potentially play an important role in mitigating ozone depletion resulting from methyl chloride and methyl bromide emissions. The first step in the pathway(s) of methyl halide degradation involves a methyltransferase and, recently, the presence of this pathway has been studied in a number of bacteria. This paper reviews the biochemistry and genetics of methyl halide utilization in the aerobic bacteria Methylobacterium chloromethanicum CM4T, Hyphomicrobium chloromethanicum CM2T, Aminobacter strain IMB-1 and Aminobacter strain CC495. These bacteria are able to use methyl halides as a sole source of carbon and energy, are all members of the a-Proteobacteria and were isolated from a variety of polluted and pristine terrestrial environments. An understanding of the genetics of these bacteria identified a unique gene (cmuA) involved in the degradation of methyl halides, which codes for a protein (CmuA) with unique methyltransferase and corrinoid functions. This unique functional gene, cmuA, is being used to develop molecular ecology techniques to examine the diversity and distribution of methyl halide-utilizing bacteria in the environment and hopefully to understand their role in methyl halide degradation in different environments. These techniques will also enable the detection of potentially novel methyl halidedegrading bacteria.
Received 21 January, 2002; accepted 23 January, 2002. *For correspondence. E-mail
[email protected]; Tel. (+44) 247 652 8362; Fax (+44) 247 652 3568.
© 2002 Blackwell Science Ltd
Introduction Methyl chloride (CH3Cl) is a volatile organic compound with an average concentration in the atmosphere of 540 p.p.t.v. (Khalil et al., 1999). Methyl chloride is of environmental concern because it may be responsible for about 13% of the destruction of the stratospheric ozone layer (Butler, 2000). The primary sources of methyl chloride are thought to be biological and non-biological processes that occur in nature. The major sources of methyl chloride recognized so far include oceans, biomass burning, wood-rotting fungi and salt marshes (Keene et al., 1999; Rhew et al., 2000). The main sink for methyl chloride is thought to be the reaction with tropospheric and stratospheric hydroxyl radicals. Soils have also been shown to be a potentially significant sink for methyl chloride (Khalil and Rasmussen, 1999). Methyl bromide (MeBr) is a fumigant used in the cultivation of soft fruits, vegetables and flowers. Use of methyl bromide as a pesticide increases the yield and quality of crops without leaving behind toxic residues characteristic of more complex organopesticides. The majority of anthropogenic methyl bromide is produced in the USA where 80% is used in fumigation treatments (Price, 1996). The annual global flux of methyl bromide into the atmosphere from agricultural fumigation has been estimated at 16–48 Gg year-1 (Kurylo et al., 1999). Natural sources of methyl bromide are biomass burning, salt marshes, higher plants, phytoplankton, seaweed, fungi and wetlands (Mano and Andreae, 1994; Goodwin et al., 1997; Jeffers et al., 1998; Saemundsdottir and Matrai, 1998; Watling and Harper, 1998; Varner et al., 1999; Rhew et al., 2000). Methyl bromide is the main source in the atmosphere of bromide ions, which are 50–60 times more effective than chloride ions in converting ozone to oxygen. The reaction of chloride and bromide ions with stratospheric ozone may have contributed to 20–25% of the Antarctic ozone hole (Miller, 1996). However, because bromine released from methyl bromide destroys stratospheric ozone (Mellouki et al., 1992; Khalil et al., 1993; Singh and Kanakidou, 1993) its use is likely to be eliminated by the year 2010 under amendments to the Montreal Protocol. Global budgets of the methyl bromide cycle are unbalanced and complex because there are uncertainties in the
194 I. R. McDonald et al. estimates of sinks that require investigation to achieve a complete understanding of global cycling and fluxes of methyl halide gases (Butler, 2000). In addition to methyl bromide oxidation by tropospheric OH radicals (Mellouki et al., 1992), other biogeochemical sinks for methyl bromide include dissolution from the atmosphere into the oceans, where it is destroyed by chemical and/or biological processes (Lobert et al., 1995; King and Saltzman, 1997; Yvon-Lewis and Butler, 1997; Goodwin et al., 1998; Tokarczyk and Saltzman, 2001; Tokarczyk et al., 2001), and consumption by bacteria in soils (Shorter et al., 1995; Hines et al., 1998; Serca et al., 1998). Methyl halides can be co-metabolized by bacteria, through oxidation by both methanotrophs and nitrifying bacteria (Stirling and Dalton, 1979; Rasche et al., 1990) and by hydrolysis (Keuning et al., 1985). The methanotroph Methylomicrobium album BG8 has also been shown to derive some benefit from oxidizing methyl chloride (Han and Semrau, 2000) and, therefore, this group of bacteria may contribute to the degradation of methyl chloride in the environment. The involvement of ammoniaoxidizing bacteria in co-oxidation of methyl bromide under soil conditions has also been demonstrated (Duddleston et al., 2000). Several methylotrophic bacteria have been characterized that are able to use methyl chloride as a growth substrate. These include the strictly anaerobic homoacetogenic bacterium Acetobacterium dehalogenans (Messmer et al., 1993), in which the anoxic dehalogenation of methyl chloride was shown to be catalysed by enzymes that transfer the methyl group of methyl chloride by means of a corrinoid protein to tetrahydrofolate (H4folate) to yield chloride and methyl tetrahydrofolate (CH3-H4folate), an intermediate of the acetyl-CoA pathway (Wohlfarth and Diekert, 1997). However, in this review, we will focus our discussion exclusively on the aerobic bacteria that use methyl chloride or methyl bromide as their sole growth substrate. We will review their phylogenetic diversity, biochemistry, genetics and molecular ecology, discussing work undertaken in our laboratory and those of several collaborators. Phylogenetic diversity of methyl halide-degrading bacteria The majority of bacteria that are able to use methyl halides are aerobic. Leisinger and colleagues (Hartmans et al., 1986) isolated the first aerobic methyl chloridedegrading organism, Hyphomicrobium sp. MC1; however, this organism has now been lost. Trotsenko and colleagues (Doronina et al., 1996) initially isolated eight strains of methyl chloride-utilizing bacteria from industrially contaminated Russian soils; these new isolates were all classified as strains of Methylobacterium and Hyphomicrobium. However, 16S rRNA sequencing
showed that only two distinct strains had been isolated. These were recently designated Hyphomicrobium chloromethanicum CM2T and Methylobacterium chloromethanicum CM4T (McDonald et al., 2001). A 16S ribosomal RNA dendrogram showing the phylogenetic relationship of these bacteria with other members of the a-subdivision of the Proteobacteria is shown in Fig. 1. Two more facultative methylotrophs capable of aerobic growth on both methyl chloride and methyl bromide as sole carbon and energy sources have been isolated recently. Strain IMB1 was isolated from soil that had been fumigated with methyl bromide (Miller et al., 1997; Connell Hancock et al., 1998), whereas strain CC495 was isolated from topsoil in a pristine woodland site (Coulter et al., 1999). These two strains were shown by 16S rRNA sequence analysis to be closely related to each other (Coulter et al., 1999) and to the Aminobacter genus (Kämpfer et al., 1999) (see Fig. 1). A fifth isolate, strain MB2, isolated from the marine environment, was capable of growth on methyl bromide as sole carbon and energy source (Goodwin et al., 1998). Strain MB2 has recently been identified as a member of the marine Roseobacter group of organisms and has been identified as Leisingera methylohalidivorans (Schaefer et al., 2002). In a recent study (McAnulla et al., 2001a), enrichments for methyl chloride-utilizing bacteria from a range of different pristine environments (terrestrial, freshwater, estuarine and marine) were dominated by Hyphomicrobium species. Each sample site yielded at least one pure isolate capable of growth on methyl chloride. A total of eight pure isolates were obtained; six of them (S-3, S-4, MAR-1, PMC, SAC-1 and SAN-1) had almost identical morphologies and were identified as Hyphomicrobium species. Isolate CMC was morphologically similar to strain IMB-1, a Gram-negative motile rod (ª 1.3 ¥ 0.6 mm). Isolate SAC-4 was Gram positive. The 16S rRNA gene was amplified from each of the isolates, sequenced (either completely or partially, 900 bp) and analysed phylogenetically using the PHYLIP package (Felsenstein, 1993). The six Hyphomicrobium-like strains were confirmed as members of the cluster II Hyphomicrobium species (Fig. 1). Three of the isolates (S-3, S-4 and MAR-1) had identical 16S rRNA sequences and were most similar to Hyphomicrobium chloromethanicum CM2. Isolate S-3 was isolated from the Severn Estuary, S-4 from Warwick soil and MAR-1 from the North Sea. Strains SAC-1 and SAN-1 had similar 16S rRNA sequences and were isolated from the same woodland soil site, but did not branch closely with any of the known Hyphomicrobium species; strain PMC was the most distant from the known Hyphomicrobium species. Strain CMC was shown to group closely with strains IMB-1 and CC495 within the Aminobacter group of 16S rRNA sequences (Fig. 1). Strain SAC-4, the Gram-positive isolate, grouped within © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
Bacterial methyl halide degradation 195 Fig. 1. Phylogenetic analysis of the 16S rRNA sequences of the methyl halide-degrading bacterial isolates, M. chloromethanicum CM4, H. chloromethanicum CM2, Leisingera methylohalidivorans MB2, strain CC495, strain IMB-1 and Gram-negative methyl chlorideutilizing isolates. The dendrogram shows the results of an analysis in which DNADIST (Felsenstein, 1993) was used; the scale bar represents 10% sequence divergence, as determined by measuring the lengths of the horizontal lines connecting any two species.
the Nocardioides species, the closest extant relative being Nocardioides simplex. To our knowledge, this is the first report of a Gram-positive aerobic methyl chloridedegrading bacterium (McAnulla et al., 2001b). As most of the isolates obtained were Hyphomicrobium species, Hyphomicrobium type strains were tested for growth on methyl chloride to see whether this ability was common to the genus. None of the eight strains tested [Hyphomicrobium facilis ssp. facilis H-526T (DSM 1565), H. facilis ssp. ureaphilum CO-582T (ATCC 27492), H. facilis ssp. tolerans I-551T (ATCC 27489), H. vulgare MC-750T (ATCC 27500), H. aestuarii NQ-521T (NCIMB 11052), H. denitrificans HA-905, H. hollandicum KB 677T (ATCC 27498), H. zavarzinii ZV 622T (ATCC 27496)] were capable of growth on methyl chloride (McDonald et al., 2001). © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
All samples used for enrichment in the McAnulla et al. (2001a) study yielded strains capable of growth on methyl chloride, which is consistent with the hypothesis that methyl chloride-utilizing bacteria are widespread in the environment. This result might be expected because natural processes produce a considerable amount of methyl chloride; however, it has implications for the cycling of this compound in the environment. Although the methyl chloride-degrading activity of these bacteria in the environment is not known quantitatively at present, it is possible that they may form a significant environmental sink for this compound. Trotsenko and coworkers (Doronina et al., 1996) found that long-term culturing of H. chloromethanicum CM2T and M. chloromethanicum CM4T on alternative substrates led to a loss of the ability to grow on methyl chloride so, presumably, the ability to
196 I. R. McDonald et al. grow on this compound is advantageous to these isolates in their natural habitat. It is possible that the ability to grow on methyl chloride is conferred by an enzyme system whose primary purpose is to degrade a different compound. However, the methyl chloride degradation enzymes characterized thus far have been limited to degradation of monohalomethanes (Vannelli et al., 1998; 1999; Coulter et al., 1999), so the alternative substrate hypothesis seems unlikely. Biochemistry and genetics of methyl halide-degrading bacteria Early studies of methyl chloride-degrading bacteria (Hartmans et al., 1986) suggested that degradation of methyl chloride in Hyphomicrobium sp. strain MC1 was not by dehalogenation but may have been by a monooxygenase reaction. A more recent study by Trotsenko and colleagues (Doronina et al., 1996) showed that the Methylobacterium and Hyphomicrobium strains that they isolated possessed an inducible yet unknown enzyme that calalysed a stoichiometric NAD-, NAD(P)H-, O2- and GSH-independent conversion of chloromethane to HCl and formaldehyde (not via methanol). They postulated the operation of a novel mechanism of methyl chloride dehalogenation that was neither a monooxygenase nor a dehydrogenase; this mechanism was described further in Methylobacterium chloromethanicum CM4 by Leisinger and colleagues. The work of Leisinger and colleagues has mainly focused on Methylobacterium chloromethanicum CM4 and is described below, along with a description of work on the other organisms in turn. Leisingera methylohalidivorans MB2 is not discussed here as, at present, there are little data available. Methylobacterium chloromethanicum CM4T Biochemical and genetic studies exploring the mechanism of methyl chloride metabolism in M. chloromethanicum CM4T have suggested a pathway for methyl chloride utilization (Vannelli et al., 1998; 1999). Two polypeptides of 67 and 35 kDa were induced during growth on methyl chloride (Vannelli et al., 1998). Methyl chloride-grown cells were also capable of dehalogenating methyl bromide and methyl iodide, but not dichloromethane and higher chloroalkanes such as chloroethane, suggesting that the enzyme(s) responsible for methyl chloride degradation are specific for monohalomethanes. No growth of M. chloromethanicum CM4T was observed with methyl bromide as the sole carbon and energy source. This may reflect the greater toxicity of either methyl bromide or the bromide ions produced by degradation or may result from an inability to bind methyl bromide for effective transformation. Transposon mutagenesis was used to create
Fig. 2. Proposed pathway of methyl chloride metabolism in M. chloromethanicum CM4. Modified from Vannelli et al. (1999). CmuA, methyltransferase I; CmuB, methyltransferase II; MetF, putative 5, 10-methylene-H4folate reductase; FolD, putative 5, 10-methylene-H4folate dehydrogenase/5, 10-methenyl-H4folate cyclohydrolase; PurU, putative 10-formyl-H4folate hydrolase; FDH, formate dehydrogenase. The corrinoid protein acting as the primary methyl acceptor and thought to be part of CmuA is indicated by CoI.
mutants that could not grow on methyl chloride; however, mutants could still grow on methanol. Genes containing the transposon insertion were then cloned and sequenced; and this information was used to develop biochemical assays. Based on these results, a pathway for methyl chloride degradation was suggested, which represents a novel catabolic pathway for aerobic methylotrophs (Vannelli et al., 1999) (see Fig. 2). The first step in this pathway involves CmuA, a 67 kDa polypeptide, which has a methyltransferase domain and a corrinoid-binding domain. The methyltransferase domain transfers the methyl group of methyl chloride to the © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
Bacterial methyl halide degradation 197 IMB-1
CM2
cmuC
folD
CM4 II
cmuA
paaE
hutI
orf153orf207 orf225
pduX
cobQ
orf146
cobD
orf219
metF
cmuB
metF
cmuC
cmuA
cmuC
cmuB
orf361
fmdB paaE
cobC
CM4 I cobU
0
folC
folD
2000
purU
4000
orf414
6000
cmuA
orf165
8000
10,000
Scale in bp
Fig. 3. Schematic representation of the methyltransferase gene clusters from strain IMB-1, H. chloromethanicum CM2 and M. chloromethanicum CM4. The orientation and position of genes is shown. Genes with significant identity to each other are in the same colour. Other ORFs are white.
Co atom of the enzyme-bound corrinoid group (methyltransferase I activity). A second polypeptide, CmuB, then transfers the methyl group onto tetrahydrofolate (H4F), forming methyl H4F (methyltransferase II activity). This folate-linked methyl group is progressively oxidized to formate and, finally, to CO2 to provide reducing equivalents for biosynthesis. Carbon assimilation presumably occurs at the level of methylene tetrahydrofolate, which can feed directly into the serine cycle. This pathway was postulated on the basis of physiological, genetic and biochemical evidence (Vannelli et al., 1999). Four genes, cmuA, cmuB, cmuC and purU, were shown to be essential for growth on methyl chloride but not on other C1 substrates (Vannelli et al., 1999). In M. chloromethanicum CM4, these genes were detected on two gene clusters (see Fig. 3). Both CmuA and CmuB have been purified and characterized (Studer et al., 1999; 2001). It has been shown that these two proteins are sufficient for in vitro transfer of the methyl group from methyl chloride onto tetrahydrofolate. The corrinoid of CmuA has been identified, and it has been shown that the protein contains 1 mol of zinc (Studer et al., 2001). Leisinger and coworkers (Studer et al., 2001) also demonstrated that pure CmuA from M. chloromethanicum CM4 contains the chloromethane:halide methyltransferase activity previously shown to be present in strain CC495 (Coulter et al., 1999). Growth of M. chloromethanicum CM4 on methyl chloride was shown to be strictly dependent on the presence of cobalt in the cultivation medium (Studer et al., 2001). It was also shown that vitamin B12 is required for growth on methyl chloride, and that it can synthesize it de novo (Studer et al., 2001), unlike strain CC495, which is dependent on vitamin B12 © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
supplements for growth on methyl chloride (Coulter et al., 1999). Hyphomicrobium chloromethanicum CM2T More recently, molecular and biochemical studies have shown that H. chloromethanicum strain CM2T possesses an inducible enzyme system for the utilization of methyl chloride, in which two polypeptides are expressed (67 kDa, CmuA; and 35 kDa, CmuB) (McAnulla et al., 2001b). A cmu gene cluster (9.5 kb) in H. chloromethanicum contained 10 open reading frames (ORFs) including folD, cmuB, cmuC, cmuA and paaE (see Fig. 3 and Table 1). Finding an ORF indicates a region of DNA that is likely to be coding for a protein, possibly of known function but often of unknown function. CmuA from H. chloromethanicum showed high identity (80%) to CmuA from M. chloromethanicum. CmuB from H. chloromethanicum showed high identity (57%) to the methyltransferase CmuB from M. chloromethanicum. CmuC from H. chloromethanicum shows identity (36%) to CmuC from M. chloromethanicum and is a putative methyltransferase. This molecular analysis and some preliminary biochemical data indicate that the methyl chloride utilization pathway in H. chloromethanicum is similar to the corrinoid-dependent methyl transfer system in M. chloromethanicum. Strain IMB-1 Studies have shown that IMB-1 is able to grow on methyl halides, methylated amines and non-C1 compounds such
198 I. R. McDonald et al. Table 1. Summary of the likely function of genes in the cmu gene clusters from the aerobic methyl halide-degrading bacteria, M. chloromethanicum CM4T, H. chloromethanicum CM2T and strain IMB-1. Gene
Function a
cmuA cmuB a cmuC a metF paaE hutI folD cobU, Q, D and C purU a
Methyltransferase/corrinoid – transfer of CH3 group of CH3Cl to Co atom of enzyme-bound corrinoid group Methyltransferase – transfer of CH3 group onto H4folate forming methyl-H4folate Putative methyltransferase – function unknown Methylene-H4folate reductase – possibly required for the assimilation of one carbon moiety from methyl halide Putative reductase – may bind and transfer the prosthetic groups required for cobalamin reactivation Imidazolonepropionase – may be required for formation of the imidazole ring found in the nucleotide loop of cobalamin Methylene-H4folate cyclohydrolase – may be involved in C1 transfer pathway Cobalamin biosynthesis genes. Formyl-H4folate hydrolase – involved in converting formyl-H4F to formate (see Fig. 2)
a. Genes shown, by transposon mutagenesis, to be essential for growth on methyl chloride in Methylobacterium chloromethanicum CM4T (Vannelli et al., 1998; 1999);
as glucose, acetate and pyruvate (Connell Hancock et al., 1998), but no growth or oxidation was observed with methyl fluoride (MeF), methane, propyl iodide, dibromomethane, dichloromethane or difluoromethane (Miller et al., 1997; Connell Hancock et al., 1998; Schaefer and Oremland, 1999). Growth was observed with methyl bromide, methyl chloride and methyl iodide as sole carbon and energy sources. Growth of IMB-1 on methyl bromide was shown to be inducible on high levels of methyl bromide with some constitutive activity at lower concentrations (Schaefer and Oremland, 1999). Both methyl iodide and methyl chloride demonstrated competitive inhibition with methyl bromide for a potential enzyme active site, suggesting that a common enzyme system is responsible for dehalogenation of methyl bromide, methyl iodide and methyl chloride in strain IMB-1. Cells grown on methyl bromide were capable of oxidizing methyl chloride and vice versa, suggesting that a single inducible enzyme system was responsible for the oxidation of monohalomethanes. Recently, a single cmu gene cluster was identified in IMB-1 (Woodall et al., 2001), which contained six ORFs including cmuC, cmuA, paaE, hutI and metF (see Fig. 3 and Table 1). CmuA from IMB-1 (67 kDa) has high sequence identity (78%) to CmuA from M. chloromethanicum CM4T and from H. chloromethanicum CM2T. CmuA is probably involved in the dehalogenation of methyl bromide in IMB-1, based on this high sequence identity with the CmuA from CM2 and CM4. CmuC from IMB-1 has identity (36%) to CmuC from M. chloromethanicum CM4T, which has been shown to be essential for growth on methyl chloride. The identity value is high enough to suggest that CmuC from IMB-1 will have a similar function to CmuC from CM4T. However, a third cmu gene, cmuB, identified in M. chloromethanicum and H. chloromethanicum, was not detected in IMB-1. Other genes that lie adjacent to the cmuA gene in the strain IMB-1 genome may be involved in methyl bromide metabolism (Woodall et al., 2001). Analysis of the methyl bromide utilization genes in IMB-1 therefore suggests that
this strain contains a similar system to the corrinoiddependent methyl transfer system for methyl halide degradation found in M. chloromethanicum and H. chloromethanicum. Strain CC495 The physiology and biochemistry of methyl chloride degradation by CC495 was investigated by Coulter et al. (1999). Strain CC495 differs from the other methyl halideutilizing isolates in that it requires vitamin B12 addition to the growth media for growth on methyl chloride (Coulter et al., 1999), whereas the other isolates (CM2, CM4 and IMB-1) have no requirement for B12 (Studer et al., 2001). Growth on methyl chloride was inducible, and cells grown on methyl chloride expressed two polypeptides with apparent molecular masses of 67 kDa and 29 kDa. The 67 kDa polypeptide was purified and identified as a halomethane: bisulphide/halide ion methyltransferase (Coulter et al., 1999). The enzyme is a corrinoid protein, and its reported N-terminal sequence showed identity to the N-terminal sequence of CmuA from M. chloromethanicum CM4 (81.3%), H. chloromethanicum (68.8%) and the derived N-terminal sequence from strain IMB-1 (81.3%). At present, studies are under way to clone and sequence the genes that are involved in methyl chloride utilization (cmu genes), from strain CC495. Molecular ecology Recently, a molecular approach to microbial ecology has provided methods for characterizing natural microbial communities without the need to cultivate organisms and, as the vast majority (>95%) of naturally occurring bacteria have not been cultured using standard techniques (Ward et al., 1992; Amann et al., 1995), this represents a major step forward in understanding the complexity of microbial communities (Hugenholtz and Pace, 1996). The majority of these studies have used the 16S rRNA gene © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
Bacterial methyl halide degradation 199 L M L Q
I
AA
K R
A
R K I
D
W
L
E D
K D
V
G
V LR M
V
DL
Y
M
I
V
L D
I
V S
A
L
K
S
I
D
IS
D
S
S T
A
A
V DI Q
E
Q A
I
V F A G
K
E
EM IL S
M
R
E D
H R
V
VL GM
M
V
E
M L M
K R
K
H E H L S E R R I V
I
K
Y
LI
Q
R
T V W
I
A
L
T
Y D
V
N M
K
M
K
D
E
L
E
E S D M
D
V
Fig. 4. Alignment of CmuA from strain IMB-1, H. chloromethanicum CM2 and M. chloromethanicum CM4 and MtsA, a methyltransferase from Methanosarcina barkeri. Similar (shaded boxes) and identical (black boxes) residues are highlighted. The putative zinc-binding motif (LHICG) identified in MtaA and MtsA from M. barkeri is indicated (LeClerc and Grahame, 1996). The position of the cmuA PCR primers are also marked (Æ and ¨).
G A
K R R
M
L V
to examine diversity; however, many have also used a functional gene as a target to examine the diversity of a defined functional group of bacteria, e.g. methaneoxidizing bacteria (Holmes et al., 1995; 1999; McDonald et al., 1995; McDonald and Murrell, 1997; Costello and Lidstrom, 1999; Henckel et al., 2000). The diverse nature of the extant methyl halide-utilizing bacteria (see Fig. 1), and the fact that the other members of the genera to which they belong do not use methyl chloride, means that the use of 16S rRNA probe technology to detect methyl chloride-utilizing bacteria in environmental samples is not feasible. The alternative is to develop polymerase chain reaction (PCR) primers to identify genes involved in the utilization of methyl chloride i.e. ‘functional’ © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
genes. This was facilitated by the cloning of the methyl chloride utilization genes from M. chloromethanicum CM4, H. chloromethanicum CM2 and strain IMB-1. Several genes were identified that were involved in methyl chloride degradation. However, cmuA was selected as a marker for methyl chloride users because all current evidence suggests that CmuA binds methyl chloride and catalyses the first step in its dehalogenation. Development of cmuA-specific PCR primers PCR primers were designed against regions of cmuA that are conserved in strains CM2, CM4 and IMB-1 (see Fig. 4) (McAnulla et al., 2001b). The unique structure of the
200 I. R. McDonald et al. Fig. 5. Alignment of the derived CmuA sequences of PCR-amplified cmuA genes from a methyl chloride enrichment culture and the extant methyl halide degraders H. chloromethanicum CM2, M. chloromethanicum CM4 and strain IMB-1. Similar residues (shaded boxes) and identical residues (black boxes) are highlighted.
gene was also considered when designing the primers. The cmuA gene contains a 5¢ methyltransferase domain and a 3¢ corrinoid-binding domain. Therefore, the forward primer was located in the methyltransferase domain and the reverse primer in the corrinoid-binding domain. As cmuA appears to be the only gene with this structure, this would be expected to increase the specificity of the PCR. If primers were only designed to amplify part of a single domain, there would be the possibility that other methyltransferase or corrinoid-binding genes might be amplified, rather than cmuA. Primers were tested with DNA from strains CM2 and CM4 as positive controls and then used to amplify partial cmuA sequences from other methyl chloride-utilizing isolates. The primers, 929f (AACTAGCTGCTGAGGTTGGC TAYAAYGGNGG) and 1669r (CAACGTATACGGTGGAG GAGTTNGTCATNAC), gave a product of the correct size (740 bp) with template DNA from strains CM2, CM4, IMB-1 and DNA from all seven new Gram-negative isolates from the study of McAnulla et al. (2001a). These PCR products were confirmed as cmuA by sequencing. No PCR products were obtained with DNA from the negative controls (Escherichia coli, Methylobacterium extorquens AM1 and Methylosinus trichosporium OB3b). These PCR primers were also used to amplify cmuA sequences from DNA extracted from a soil enrichment culture. After cloning and sequencing of the resultant PCR products, three different cmuA sequences were
detected (an alignment of the derived CmuA sequences, 197 amino acids, is shown in Fig. 5). One CmuA sequence was identical to the corresponding sequence of CmuA from the isolate Hyphomicrobium S-4, which was isolated from the same soil enrichment culture (McAnulla et al., 2001a). The second CmuA sequence was identical to the corresponding CmuA sequence from the isolate IMB-1, and the third showed significant identity to all CmuA sequences (91% identity to H. chloromethanicum CM2), indicating that the gene isolated from the environment by PCR encoded a novel but related methyltransferase. Before cmuA PCR primers can be used effectively to interrogate environmental samples and to determine the diversity of methyl halide-degrading bacteria, the sequences of more cmuA genes from new isolates are required in order to refine the primer sequences. At present, the PCR primers are only designed from the sequences of three cmuA genes. In order to encompass any diversity in cmuA gene sequences, a larger database of sequences will be required. Future studies Many questions still remain unanswered regarding the biochemistry and molecular biology of methyl halide degradation in bacteria. Here, we highlight several of the key questions, the answers to which will lead to a greater © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
Bacterial methyl halide degradation 201 understanding of the role of these organisms in the degradation of methyl halides in the environment. Are cmuA, cmuB and cmuC absolutely required for methyl halide degradation in H. chloromethanicum CM2, strain IMB-1, strain CC495 and Leisingera methylohalidivorans MB2 as they are in M. chloromethanicum CM4 (Vannelli et al., 1999)? This can be achieved by marker exchange mutagenesis experiments to knock out the genes and determine the phenotype of the mutated strains. Another fundamental question regarding the role of the methyltransferase genes in these bacteria is: are they responsible for the oxidation of both methyl bromide and methyl chloride? Again, the analysis of mutants generated by marker exchange mutagenesis, together with more detailed kinetic analysis of methyl halide oxidation by bacteria, should answer this question. Answers to these questions are important because, if we want to use molecular biological probes based on these functional genes to look at their distribution in the environment, we need to be certain that these genes are involved in the degradation of both methyl chloride and methyl bromide; otherwise, different probes may be required to look at each separate population. There are several key questions regarding the biochemistry of these bacteria that have important implications for understanding which organisms are involved in ambient uptake. For example, how is methyl halide metabolism regulated, is there constitutive methyl halide degradation, and what is the mechanism of inhibition/repression/induction of CmuA? If CmuA is only expressed at high methyl halide concentrations, it will not help to determine which bacteria are responsible for uptake and degradation in environments where methyl halide concentrations are low. Furthermore, this work will require detailed analysis of probably the fastest growing strains and/or strains that are amenable to genetic manipulations or for which there are suitable mutagenesis/ transformation systems. One of the key environmental questions is what is the role of these bacteria in methyl halide metabolism in the environment, particularly the marine and estuarine environments that have recently been shown to be sources of methyl halides (Keppler et al., 2000; Rhew et al., 2000; Yokouchi et al., 2000)? This can be studied by both conventional enrichment and isolation techniques (McAnulla et al., 2001a) and the use of molecular ecology techniques using functional gene probes based on cmuA and other key genes involved in methyl halide metabolism. This type of work is currently being developed in our laboratory. Finally, crystallization and structural studies of CmuA, which is an unusual bifunctional enzyme, should provide interesting insights into the mechanism(s) of methyl halide degradation in bacteria. © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
Acknowledgements We would like to acknowledge collaborators on this work, Kelly Goodwin (Cooperative Institute for Marine and Atmospheric Studies, Rosenstiel School of Marine and Atmospheric Sciences, University of Miami, FL, USA), David Harper and colleagues (School of Agriculture and Food Science, The Queens University of Belfast, N. Ireland), Thomas Leisinger and colleagues (Microbiologisches Institut, ETH Zentrum, Zurich, Switzerland) and Yuri Trotsenko and colleagues (G. K. Skryabin Institute of Biochemistry and Physiology of Microorganisms RAS, Pushchino, Moscow region, Russia). We also acknowledge the financial support provided by the Natural Environment Research Council (GR9/2192), studentships for Karen Warner, Craig McAnulla and Claire Woodall and INTAS grant 94-3122, and current funding through the Natural Environment Research Council grants NER/T/S/200/00618 and NER/A/S/2000/00423.
References Amann, R.I., Ludwig, W., and Schleifer, K.H. (1995) Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 59: 143–169. Butler, J.H. (2000) Better budgets for methyl halides? Nature 403: 260–261. Connell Hancock, T.L., Costello, A.M., Lidstrom, M.E., and Oremland, R.S. (1998) Strain IMB-1, a novel bacterium for the removal of methyl bromide in fumigated agricultural soils. Appl Environ Microbiol 64: 2899–2905. Costello, A.M., and Lidstrom, M.E. (1999) Molecular characterization of functional and phylogenetic genes from natural populations of methanotrophs in lake sediments. Appl Environ Microbiol 65: 5066–5074. Coulter, C., Hamilton, J.T.G., McRoberts, W.C., Kulakov, L., Larkin, M.J., and Harper, D.B. (1999) Halomethane: bisulfide/halide ion methyltransferase, an unusual corrinoid enzyme of environmental significance isolated from an aerobic methylotroph using chloromethane as the sole carbon source. Appl Environ Microbiol 65: 4301–4312. Doronina, N.V., Sokolov, A.P., and Trotsenko, Y.A. (1996) Isolation and initial characterization of aerobic chloromethaneutilizing bacteria. FEMS Microbiol Lett 142: 179–183. Duddleston, K.N., Bottomley, P.J., Porter, A., and Arp, D.J. (2000) Effects of soil and water content on methyl bromide oxidation by the ammonia-oxidizing bacterium Nitrosomonas europaea. Appl Environ Microbiol 66: 2636–2640. Felsenstein, J. (1993) PHYLIP (Phylogenetic Inference Package), Version 3.5c. Seattle: Department of Genetics, University of Washington. Goodwin, K.D., North, W.J., and Lidstrom, M.E. (1997) Production of bromoform and dibromomethane by giant kelp: factors affecting release and comparison to anthropogenic bromine sources. Limnol Oceanogr 42: 1725–1734. Goodwin, K.D., Schaefer, J.K., and Oremland, R.S. (1998) Bacterial oxidation of dibromomethane and methyl bromide in natural waters and enrichment cultures. Appl Environ Microbiol 64: 4629–4636. Han, J.I., and Semrau, J.D. (2000) Chloromethane stimulates
202 I. R. McDonald et al. growth of Methylomicrobium album BG8 on methanol. FEMS Microbiol Lett 187: 77–81. Hartmans, S., Schmuckle, A., Cook, A.M., and Leisinger, T. (1986) Methyl chloride: naturally occurring toxicant and C-1 growth substrate. J Gen Microbiol 132: 1139–1142. Henckel, T., Jäckel, U., Schnell, S., and Conrad, R. (2000) Molecular analyses of novel methanotrophic communities in forest soil that oxidize atmospheric methane. Appl Environ Microbiol 66: 1801–1808. Hines, M.E., Crill, P.M., Varner, R.K., Talbot, R.W., Shorter, J.H., Kolb, C.E., and Harriss, R.C. (1998) Rapid consumption of low concentrations of methyl bromide by soil bacteria. Appl Environ Microbiol 64: 1864–1870. Holmes, A.J., Costello, A.M., Lidstrom, M.E., and Murrell, J.C. (1995) Evidence that particulate methane monooxygenase and ammonia monooxygenase may be evolutionarily related. FEMS Microbiol Lett 132: 203–208. Holmes, A.J., Roslev, P., McDonald, I.R., Iversen, N., Henriksen, K., and Murrell, J.C. (1999) Characterization of methanotrophic bacterial populations in soils showing atmospheric methane uptake. Appl Environ Microbiol 65: 3312–3318. Hugenholtz, P., and Pace, N.R. (1996) Identifying microbial diversity in the natural environment: a molecular phylogenetic approach. Trends Biotechnol 14: 190–197. Jeffers, P.M., Wolfe, N.L., and Nzengung, V. (1998) Green plants: a terrestrial sink for atmospheric CH3Br. Geophys Res Lett 25: 43–46. Kämpfer, P., Müller, C., Mau, M., Neef, A., Auling, G., Busse, H.J., et al. (1999) Description of Pseudaminobacter gen. nov. with two new species, Pseudaminobacter salicylatoxidans sp. nov. and Pseudaminobacter defluvii sp. nov. Int J Syst Bacteriol 49: 887–897. Keene, W.C., Khalil, M.A.K., Erickson, D.J., McCulloch, A., Graedel, T.E., Lobert, J.M., et al. (1999) Composite global emissions of reactive chlorine from anthropogenic and natural sources: reactive chlorine emissions inventory. J Geophys Res 104: 8429–8440. Keppler, F., Eiden, R., Niedan, V., Pracht, J., and Scholer, H.F. (2000) Halocarbons produced by natural oxidation processes during degradation of organic matter. Nature 403: 298–301. Keuning, S., Janssen, D.B., and Witholt, B. (1985) Purification and characterization of hydrolytic haloalkane dehalogenase from Xanthobacter autotrophicus GJ10. J Bacteriol 163: 635–639. Khalil, M.A.K., and Rasmussen, R.A. (1999) Atmospheric methyl chloride. Atmos Environ 33: 1305–1321. Khalil, M.A.K., Rasmussen, R.A., and Gunawardena, R. (1993) Atmospheric methyl bromide: trends and global mass balance. J Geophys Res 98: 2887–2896. Khalil, M.A.K., Moore, R.M., Harper, D.B., Lobert, J.M., Erickson, D.J., Koropalov, V., et al. (1999) Natural emissions of chlorine-containing gases: reactive chlorine emissions inventory. J Geophys Res 104: 8333–8346. King, D.B., and Saltzman, E.S. (1997) Removal of methyl bromide in coastal seawater: chemical and biological rates. J Geophys Res 102: 18715–18721. Kurylo, M.J., Rodriguez, J.M., Andreae, M.O., Atlas, E.L., Blake, D.R., Butler, J.H., et al. (1999) Short-lived ozonerelated compounds. In Scientific Assessment of Ozone
Depletion: 1998. Ennis, C.A. (ed.). Geneva, Switzerland: World Meteorological Organization, p. 2.1. LeClerc, G.M., and Grahame, D.A. (1996) Methylcobamide: coenzyme M methyltransferase isoenzymes from Methanosarcina barkeri. J Biol Chem 271: 18725–18731. Lobert, J.M., Butler, J.H., Montzka, S.A., Geller, L.S., Myers, R.C., and Elkins, J.W. (1995) A net sink for atmospheric CH3Br in the East Pacific ocean. Science 267: 1002–1005. McAnulla, C., McDonald, I.R., and Murrell, J.C. (2001a) Methyl chloride utilising bacteria are ubiquitous in the natural environment. FEMS Microbiol Lett 201: 151–155. McAnulla, C., Woodall, C.A., McDonald, I.R., Studer, A., Vuilleumier, S., Leisinger, T., and Murrell, J.C. (2001b) Chloromethane utilization gene cluster from Hyphomicrobium chloromethanicum strain CM2T and development of functional gene probes to detect halomethane-degrading bacteria. Appl Environ Microbiol 67: 307–316. McDonald, I.R., and Murrell, J.C. (1997) The particulate methane monooxygenase gene pmoA and its use as a functional gene probe for methanotrophs. FEMS Microbiol Lett 156: 205–210. McDonald, I.R., Kenna, E.M., and Murrell, J.C. (1995) Detection of methanotrophic bacteria in environmental samples with the PCR. Appl Environ Microbiol 61: 116–121. McDonald, I.R., Doronina, N.V., Trotsenko, Y.A., McAnulla, C., and Murrell, J.C. (2001) Hyphomicrobium chloromethanicum sp. nov. and Methylobacterium chloromethanicum sp. nov., chloromethane-utilising bacteria isolated from a polluted environment. Int J Syst Evol Microbiol 51: 119–122. Mano, S., and Andreae, M.O. (1994) Emission of methyl bromide from biomass burning. Science 263: 1255–1257. Mellouki, A., Taludar, R.K., Schmoltner, A., Gierczak, T., Mills, M.J., Solomon, S., and Ravishankara, A.R. (1992) Atmospheric lifetimes and ozone depletion potentials of methyl bromide (CH3Br) and dibromomethane (CH2Br2). Geophys Res Lett 19: 2059–2062. Messmer, M., Wohlfarth, G., and Diekert, G. (1993) Methyl chloride metabolism of the strictly anaerobic methyl chloride-utilizing homoacetogen strain MC. Arch Microbiol 160: 383–387. Miller, M. (1996) Methyl bromide and the environment. In The Methyl Bromide Issue. Bell, C.H., Price, N., and Chakrabarti, B. (eds). Chichester: John Wiley and Sons, p. 91. Miller, L.G., Connell, T.L., Guidetti, J.R., and Oremland, R.S. (1997) Bacterial oxidation of methyl bromide in fumigated agricultural soils. Appl Environ Microbiol 63: 4346–4354. Price, N. (1996) Methyl bromide in perspective. The Methyl Bromide Issue. In Bell, C.H., Price, N., and Chakrabarti, B. (eds). Chichester: John Wiley and Sons, p. 1. Rasche, M.E., Hyman, M.R., and Arp, D.J. (1990) Biodegradation of halogenated hydrocarbon fumigants by nitrifying bacteria. Appl Environ Microbiol 56: 2568–2571. Rhew, R.C., Miller, B.R., and Weiss, R.F. (2000) Natural methyl bromide and methyl chloride emissions from coastal salt marshes. Nature 403: 292–295. Saemundsdottir, S., and Matrai, P.A. (1998) Biological production of methyl bromide by cultures of marine phytoplankton. Limnol Oceanogr 43: 81–87. Schaefer, J.K., and Oremland, R.S. (1999) Oxidation of © 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
Bacterial methyl halide degradation 203 methyl halides by the facultative methylotroph strain IMB1. Appl Environ Microbiol 65: 5035–5041. Schaefer, J.K., Goodwin, K.D., McDonald, I.R., Murrell, J.C., and Oremland, R.S. (2002) Leisingera methylohalidivorans General nov., a marine methylotroph that grows on methyl bromide. Int J Syst Evol Microbiol 52: 895–900. Serca, D., Guenther, A., Klinger, L., Helmig, D., Hereid, D., and Zimmerman, P. (1998) Methyl bromide deposition to soils. Atmos Environ 32: 1581–1586. Shorter, J.H., Klob, C.E., Crill, P.M., Kerwin, R.A., Talbot, R.W., Hines, M.E., and Harriss, R.C. (1995) Rapid degradation of atmospheric methyl bromide in soils. Nature 377: 717–719. Singh, H.B., and Kanakidou, M. (1993) An investigation of the atmospheric sources and sinks of methyl bromide. Geophys Res Lett 20: 133–136. Stirling, D.I., and Dalton, H. (1979) Properties of the methane mono-oxygenase from extracts of Methylosinus trichosporium OB3b and evidence for its similarity to the enzyme from Methylococcus capsulatus (Bath). Eur J Biochem 96: 205–212. Studer, A., Vuilleumier, S., and Leisinger, T. (1999) Properties of the methylcobalamin: H4folate methyltransferase involved in chloromethane utilization by Methylobacterium sp. strain CM4. Eur J Biochem 264: 242–249. Studer, A., Stupperich, E., Vuilleumier, S., and Leisinger, T. (2001) Chloromethane: tetrahydrofolate methyl transfer by two proteins from Methylobacterium chloromethanicum strain CM4. Eur J Biochem 268: 2931–2938. Tokarczyk, R., and Saltzman, E.S. (2001) Methyl bromide loss rates in surface waters of the North Atlantic Ocean, Caribbean Sea, and Eastern Pacific Ocean (8∞N to 45∞N). J Geophys Res 106: 9843–9851. Tokarczyk, R., Goodwin, K.D., and Saltzman, E.S. (2001) Methyl bromide loss rate constants in the North Pacific
© 2002 Blackwell Science Ltd, Environmental Microbiology, 4, 193–203
Ocean (11∞N to 57∞N). Geophys Res Lett 28: 4429– 4432. Vannelli, T., Studer, A., Kertesz, M., and Leisinger, T. (1998) Chloromethane metabolism by Methylobacterium sp. strain CM4. Appl Environ Microbiol 64: 1933–1936. Vannelli, T., Messmer, M., Studer, A., Vuilleumier, S., and Leisinger, T. (1999) A corrinoid-dependent catabolic pathway for growth of a Methylobacterium strain with chloromethane. Proc Natl Acad Sci USA 96: 4615–4620. Varner, R.K., Crill, P.M., and Talbot, R.W. (1999) Wetlands: a potentially significant source of atmospheric methyl bromide and methyl chloride. Geophys Res Lett 26: 2433– 2436. Ward, D.M., Bateson, M.M., Weller, R., and Ruff Roberts, A.L. (1992) Ribosomal RNA analysis of microorganisms as they occur in nature. In Advances in Microbial Ecology. Marshall, K.C. (ed.). New York: Plenum Press, p. 219. Watling, R., and Harper, D.B. (1998) Chloromethane production of wood-rotting fungi and an estimate of the global flux to the atmosphere. Mycol Res 102: 769–787. Wohlfarth, G., and Diekert, G. (1997) Anaerobic dehalogenases. Curr Opin Microbiol 8: 290–295. Woodall, C.A., Warner, K.L., Oremland, R.S., Murrell, J.C., and McDonald, I.R. (2001) Identification of methyl halideutilizing genes in the methyl bromide-utilizing bacterial strain IMB-1 suggests a high degree of conservation of methyl halide-specific genes in gram-negative bacteria. Appl Environ Microbiol 67: 1959–1963. Yokouchi, Y., Noijiri, Y., Barrie, L.A., Toom-Sauntry, D., Machida, T., Inuzuka, Y., et al. (2000) A strong source of methyl chloride to the atmosphere from tropical coastal land. Nature 403: 295–298. Yvon-Lewis, S.A., and Butler, J.H. (1997) The potential effect of oceanic biological degradation on the lifetime of atmospheric CH3Br. Geophys Res Lett 24: 1227–1230.
