A novel plant peptidyl-prolyl-cis-trans-isomerase (PPIase): cDNA cloning, structural analysis, enzymatic activity and expression

493

Plant Molecular Biology 32: 493-504, 1996. (~ 1996 Kluwer Academic Publishers. Printed in Belgium.

A novel plant peptidyl.prolyl-cis-trans-isomerase (PPIase): cDNA cloning, structural analysis, enzymatic activity and expression O s h r a B l e c h e r I , N o a E r e l 1, I s a b e l l e C a l l e b a u t 2, K e r e n A v i e z e r I a n d A d i n a B r e i m a n 1,* IDepartment of Botany, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv 69978, Israel (* author for correspondence);2Systbmes Moliculaires & Biologie Structurale, Laboratoire de Mindralogie-Cristallographie, Centre National de la Recherche Scientifique, URA09 Universitis Paris P6 and P7, 4 Place Jussieu, 75252 Parix Cedex 05, France. Received 17 January 1996; accepted in revised form 27 June 1996

Key words: cDNA, expression, FKBR PPIase, wheat

Abstract

A novel cDNA encoding for a peptidyl-prolyl-cis-trans-isomerase (PPIase) belonging to the FK506-binding protein (FKBP) family was isolated from wheat. It contains an open reading frame of 559 amino acids and it represents the first plant FKBP-PPIase to be cloned. It possesses a unique sequence which is composed of three FKPB-Iike domains, in addition to a putative tetratricopeptide repeat (TPR) motif and a calmodulin-binding site. The recombinant FKBPPPIase expressed in and purified from Escherichia coli exhibits PPIase activity that is efficiently inhibited by the immunosuppressive drugs FK506 and rapamycin. Northern blot analysis showed that wheat FKBP was found mainly in young tissues. Polyclonal antibodies revealed the presence of cross-reacting proteins in embryos, roots and shoots. The unique structural features, the enzymatic activity and the presence of putative isoforms in wheat tissues indicate the possibility of the involvement of wheat PPIase in essential biological functions, similar to other members of the FKBP gene family. Introduction

One of the slowest steps in protein folding is the cistrans-isomerization of certain proline residues. This step can be catalysed by peptidyl-prolyl-cis-transisomerases (PPIases), also called rotamases or immunophilins [9, 11]. The term 'immunophilin' refers to their propensity to bind immunosuppresive drugs. Two major unrelated protein families belong to the immunophilins: the cyclophilins which bind cyclosporin A [ 16] and the FK506-binding proteins (FKBPs) which bind the macrolide drugs FK506 and rapamycin [17, 51 ]. The binding of the drugs to the cyclophilins and FKBPs results in the inhibition of their rotamase activity [50]. Immunophilins were found in bacteria, fungi, plants, insects and mammals [ 11, 50, 59]. FKBPs have

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X86903 (TA FKBP70).

been found in the cytosol [54], endoplasmic reticulum (ER) [37] and nucleus [22]. The FKBP family comprises several members that are suffixed with their molecular mass: FKBP12 [54], FKBP13 [37], FKBP25 [21], FKBP59 (also known as p59 or FKBP52 or HSP56 or HBI) [5, 41, 35, 65] and FKBP65 [7]. The main FKBP is the cytosolic FKBP12, whose structure has been established by high-resolution X-ray and NMR [36, 60]. The structure of FKBPI2 is thought to consist of five-stranded/3 sheet wrappings with a right-handed twist around a short c~-helix. FK506 and rapamycin bind inside a hydrophobic cavity between the helix and the sheet that is flanked by three loop regions [60, 61]. Ten amino acids involved in the FKBP12 ligandbinding pocket were found to be particularly conserved in the FKBP family [11, 61]. FKBPI3 displays 43% amino acid identity with FKBP12, but differs in possessing sequences that target it to the lumen of the ER [37]. FKBP25 has low

494 affinity for FK506 but high affinity for rapamycin. It is concentrated in the nucleus where it may form a complex with nuclear proteins including nucleolin and casein kinase II [22]. FKBP59 is a component of the mammalian glucocorticoid receptor complex, to which it binds via a 90 kDa heat shock protein [41 ]. FKBP59 is composed of two FKBP-like domains, the first one possesses PPIase activity and binds FK506 and rapamycin [5], whereas the second differs in its sequence so that some of the amino acids involved in drug binding are not conserved. The function of this domain is not known althought it was shown to bind nucleotides [27]. FKBP59 also contains a tetratricopeptide repeat (TPR) domain and a calmodulin-binding domain [35, 41]. Although many studies on the involvement of PPIases in biological systems have been published, our knowledge of their function is still scanty. The PPIases have been shown to accelerate the process of protein folding in vitro [48, 49] and in vivo [1, 4]. Recent studies indicate a major role for FKBPI2 in the stabilization of the ryanodine receptor [4]. In higher plants, PPIase activity has been identified in chloroplast and mitochondrial extracts [3]. Cyclophilins of tomato [12], Arabidopsis [29], Vicia faba [30] and maize [33] have been cloned. The chloroplastassociated cyclophilins are regulated by light and are responsive to heat stress [30]. Cytosolic cyclophilin genes are regulated by various forms of environmental stress, including heat, cold and high salt concentrations [33, 34]. Plant FKBPs have been identified by their binding to an FK506 affinity column [31 ] and the pea mitochondrial PPIase activity has been shown to be inhibited by rapamycin, suggesting that a FKBP-type PPIase is present in mitochondria [3]. Due to the expected biological importance of PPIases in protein folding, we have undertaken the isolation of wheat PPIases belonging to the FKBP family. This study is the first report of the isolation, sequence analysis, enzymatic activity and in vivo expression of a plant cDNA coding for a FKBP-PPIase.

Materials and methods

Plant material Wheat (Triticum aestivum cv. Atir) seeds were germinated on wet paper or vermiculite for up to 7 days at 25 °C in darkness. Seedlings were then either harvested or transferred to soil and grown in a net house. Tissues used for isolation of RNA and proteins were as follows:

mature embryos were either dissected from dry commercial seeds or after 24 h imbibition unless otherwise indicated. Shoot and root tissues were harvested from etiolated seedlings. Immature embryos were dissected from wheat plants (grown in a net house) 28 days after pollination (DAP). All tissues were frozen in liquid nitrogen at the time of harvesting. Preparation of a cDNA for library screening Conserved regions from known mammalian and yeast FKBPs were determined by sequence comparison and 3 degenerate oligonucleotide primers were synthesised: (1) 5'-GA(GA)GA(CT)GGNAA(AG)AA(AG)TT (CT)GA, (2) 5'-AA(TCA)AA(AG)GGNTGGGA(TC) CA(AG)GG, and (3) 5'-TC(AGC)AC(AG)TC(GA)AA (AGT)ATNA(AG)NGT, where N indicates any base. Poly(A) + RNA isolated from etiolated coleoptiles was used as a template for RT-PCR. Reverse transcriptase (RT) reactions were done with random primers according to the Superscript II protocol (Gibco-BRL). Thirty PCR cycles with primers 1 and 3 were performed as follows: denaturation at 94 °C for 1 rain, annealing at 45 °C for 1 rain and polymerization at 72 °C for 1 rain. The reaction yielded several PCR products which were used as templates for a second round of nested PCR with primers 2 and 3 at the same conditions, to generate a specific 150 bp cDNA fragment. The 150 bp cDNA fragment was cloned into the HincII site in the Bluescript plasmid vector and sequence analysis showed 50% identity between the open reading frame of the wheat cDNA to complementary regions of the mammalian and yeast PPIase FKBPs. Isolation of wheat (wPPlase) cDNA A total of ca. 600 000 phage plaques from wheat root cDNA Agtl 1 library (Clontech, Palo Alto, CA) were screened with the 150 bp PCR probe at high stringency (hybridization in 5 x SSPE, 2.5 x Denhardt's solution, 0.25% SDS (w/v) and 100 #g/ml single-stranded salmon sperm (ssss) DNA at 62 °C. Final washes were done in 0.2x SSPE, 0.1% SDS at 58 °C (1 x SSPE is 150 mM NaC1, 10 mM NaH2PO4, 1 mM EDTA pH 7.4) [47]. Five positive cloned 280-620 bp long were isolated and cloned into the EcoRI site of Bluescript plasmid vector for sequence analysis. All five clones contained overlapping sequences that showed about 50% identity at the amino acid level to mammalian and yeast PPIase FKBPs. Since these clones were not

495 full-length, one of them (620 bp) named pw620 served as a probe for screening 3 x 105 plaques from a new wheat-root-tip cDNA )~ZAPII library (Clontech, Palo Alto, CA) under the stringent conditions previously described. Eleven clones were isolated, rescued from the ~ZAPII phage cloned into Bluescript plasmid vectors and subjected to restriction enzyme and nucleotide sequence analysis.

Analysis of the deduced wheat PPIase sequence In order to analyse the isolated cDNA clone, searches of data banks were performed using the Fasta program [40]. Hydrophobic cluster analysis (HCA) was used to compare protein secondary structures. The HCA analysis is capable of comparing not only sequences but also the protein secondary structure statistically centred on hydrophobic clusters, as well as their distribution [64]. Guidelines to the use of this method have been published [10, 28]. Models of the FKBPlike domains were built using among others the Swiss Model service at the Glaxo Institute for Molecular Biology [42]. GCG programs were used on the Proside data bank to identify phosphorylation motifs [23]. The calmodulin-binding site was deduced by sequence comparison with calmodulin-binding motifs [38].

Construction of expression vector for wPPIase activity An EcoRI site was engineered at the translation stop codon of wPPIase cDNA by PCR, using the primer (5'ACGAATTCCAGTTCAAGCTTTGCTTTC) and an external poly-linker T3 primer, located upstream of the 5' wPPIase cDNA clone in the Bluescript plasmid vector. The PCR consisted of 30 cycles under the following conditions: denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min and polymerization at 72 °C for 1 min. A BgllI-EcoRI fragment, containing the open reading frame of the wPPIase cDNA, was digested from the PCR product, and cloned into BamHI-EcoRI sites of the pGEX-2TK expression vector (Pharmacia Biotec) to form pGEX-wPPIase, pGEX-wPPIase was introduced into E. coli BL21 (DE3) LysS [45]. Induction of expression of the recombinant protein was done by adding 0.5 mM IPTG to logarithmic phase bacteria grown in LB medium (containing 100 #g/ml ampicilin, 25 #g/ml chloramphenicol, 0.2% (w/v) glucose). Cells were harvested by centrifugation after 2 h, washed with PBS (0.14 M NaCI, 2.7 mM KC1, 9,8 mM Na2HPO4, 1.8 mM KH2PO4 pH 7.4), and sonicated

(Ultrasonic Processor sonicator, Heat System, New York). The supernatant containing the recombinant GST-wPPIase fusion protein was collected by centrifugation for 10 rain at 12 000 x g. The recombinant fusion protein was affinity purified to >90% purity by glutathione Sepharose 4B (Pharmacia Biotec). The recombinant fusion glutathione S-transferase (GST)wPPIase with an estimated molecular mass of 99 kDa was used for analysis of PPIase activity. For estimating the molecular weight of the recombinant wPPIase, the purified fusion protein GST-wPPIase was digested with 1 cleavage unit of thrombin per 100 #g of protein (Pharmacia Biotech), at room temperature for 5 min, to yield a 73 kDa wPPIase protein and the 26 kDa GST, as estimated on SDS-PAGE.

Peptidyl-prolyl-cis-trans-isomerase assays Peptidyl-prolyl-cis-trans-isomerase was assayed in a coupled assay with chymotrypsin (Sigma, C-4129) as described by Fisher et al. [8] and Standaert [54] with the following modification. The test peptide was N-succinyl-ala-leu-pro-phe pNA (Bachem Bioscience) which was demonstrated to be a more suitable substrate for FKBP-type PPIases [19]. The assays were performed at 10 °C for 90 s, and monitored at 390 nm with a Hewlett Packard 8452A spectrophotometer equipped with a water-jacketed cell and a stirring attachment controlled by a personal computer. The 4 ml assay cuvettes contained 2.8 ml peptide solution (50 #M) in assay buffer (40 mM Hepes pH 8.0, 0.015% Triton X100), and 25 #1 of the fused recombinant protein (GSTwPPIase) (0.30 #M) in PBS. The reaction was initiated by addition of 150 #1 (10 mg/ml) of chymotrypsin (23/zM). After the addition of chymotrypsin, changes in absorbance at 390 nm were monitored every second for 90 s. Various concentrations of inhibitors were added in 50 #1 of methanol/water (1:1) to the peptide solution before the addition of the recombinant protein. The final concentrations assayed were 0.165 #M to 0.661 #M for FK506, and 0.049 #M to 1.48 #M for rapamycin. FK506 was a gift from Fujisawa USA Inc. and rapamycin was a gift from Wyeth Ayerst Company. First-order rate constants (Kobs) were calculated from semilog plots derived for each reaction. The Kcat/Km values were calculated as described by Harrison and Stein [ 18].

496

Construction of an expression vector for wPPlase

(Ml -P176)for antibody preparation An Ncol-BamHI fragment of the wPPIase cDNA, isolated from the first library (in which the restriction sites exist in the original sequence) was cloned into pET 11 d expression vector [45] (digested with the same enzymes) resulting in pET-PPIase (M j-P176). pET-PPIase (MI-PI76) was introduced into E. coli BL21 (DE3) LysS and induction of recombinant protein expression was performed in the same conditions as previously described for the pGEX vector. Cells were harvested by centrifugation, washed in 50 mM Tris-C1 pH 7.5, 10 mM magnesium acetate, 1 mM EDTA, 0.1 mM DTT, 10% glycerol and lysed by sonication. The extract was centrifuged and the supernatant which contained the recombinant protein wPPIase (MI-PI76) was collected. Recombinant wPPIase (MI -P176) was partially purified by 50% ammonium sulfate precipitation followed by loading the dialysed solution on DE52 cellulose column equilibrated with 50 mM Tris-HCl, pH 7.5, and the fractions were eluted by a continuous KC1 gradient (0-0.5 M in the same buffer). The fractions, containing the recombinant wFKBP (MI-PI76) (analysed by SDS-PAGE) were further purified by preparative 12% SDS-PAGE and transferred to nitrocellulose. The nitrocellulose strips containing the recombinant wPPIase (Mi-P176) were used for antibody production [24].

Preparation of antibodies About 80-100 #g of recombinant wPPIase (M 1-P176) protein transferred to nitrocellulose strips [24] was thoroughly dissolved in 500 /d DMSO (dimethyl sulfoxide) to which 200 #1 of Freund's adjuvant was added (Difco Laboratories, Detroit, MI). The mixture was injected subcutaneously into 7-10 sites on the back of 1 month old female New Zealand rabbits. The first injection mixture was prepared with Freund's complete adjuvant while the 3 subsequent booster injections, spaced 4 weeks apart, were prepared with Freund's incomplete adjuvant. The rabbits were bled from the ear 10 days after each boost and the serum was tested for antibody response. The final titre used in western blot analysis was 1:5000.

RNA isolation and northern blot analysis All tissues were separated from the seedlings and immediately frozen in liquid nitrogen. Total RNA was

prepared from 0.5-2 g of fresh wheat tissues ground in liquid nitrogen using the trizol reagent (Gibco-BRL, Life Technologies, Gaithersburg, MD). Total RNA was separated on 1.4% agarose under denaturing conditions, and then transferred onto a nylon membrane (Hybond-N, Amersham, UK). RNA size was estimated by running a parallel lane of standard RNA molecular weight marker (Boehringer Mannheim). Hybridization with pw620 labelled by random primers (Boehringer, Mannheim) was done in hybridization solution (0.26 M sodium phosphate buffer pH 7.2, 7% SDS, 1% BSA, 1 mM EDTA) at 62 °C for 18 h. Washes were done in 0.26 M sodium phosphate buffer pH 7.2, 1% SDS at 58 °C, three times for 20 rain. For RNA quantitation the filter was reprobed with the wheat 26S rRNA probe derived from pTA71 [13]. The filters were exposed for 3 h to the phosphor imager and the amounts were corrected according to the 26S rRNA scanned.

Preparation of plant extracts for electrophoresis About 2 g fresh weight of plant tissue was ground to powder in liquid nitrogen with a mortar and pestle and 1 ml extraction buffer (50 mM Tris-HC1 pH 7.8, 10 mM EDTA pH 8.0, 300 mM sucrose, 100 mM NaCI, 4 mM phenylmethylsulfonyl fluoride (PMSF), 5 mM benzamidine, 1 mM DTT) was added to the pulverized material. The crude extract was cleared by successive centrifugation for 6 min at 700 × g, 6 min at 3000 x g and 20 rain at 12 000 x g in a SS34 Sorval rotor. The amount was determined by the Bradford reagent [2].

SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis SDS-PAGE was performed using 7.5% acrylamide and the Laemmli buffer system [26]. After electrophoresis, the proteins were transferred onto nitrocellulose membranes (NC 0.45 #m, Schleicher and Schuell) using a Hoeffer minitransfer electrophoresis unit. Transfers were run at 50 V for 2 h. Non-specific sites were blocked for at least 1 h at room temperature with a blocking solution containing 5% non-fat dry milk (Carnation), 0.05% Tween-20 in PBS. Membranes were incubated for 2 h at room temperature with rabbit anti wheat FKBP (MI-PI76), diluted 1:5000 in blocking solution. After 4 washes (5 min each) in 0.1% Tween PBS (T-PBS), the membranes were incubated with goat anti-rabbit IgG horseradish peroxidase conjugate (Sigma) diluted 1: 15 000, for 1 h at room temperature. After washing in T-PBS, as previously described,

497

hfkbp59 hfkbpl2 wfkbp73 hfkbp59

.

.

.

V

.

.

.

E

.

.

.

.

.

~TAEEMKA

.

TESL~QSAPL

E

P M EGV

K

D I S PL'~I ~ D E[ei~l L L ~ V I K

R

T

TEM

M

48

K

hfkbpl2 wfkbp73 hfkbp59

EFK

GEDLTEEE

. . . . . . . . . . . . . . . . . . . .

] ,4 8

J

hfkbpl2 wfkbp73 hfkbp59

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

hfkbpl2 wfkbp73

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

hfkbp59

.

.

.

.

.

.

.

.

hfkbpl2

wfkbp73 hfkbp59 hfkbpl2

.

.

.

.

.

.

.

.

.

.

.

DGTVVSKSEG

.

.

.

.

.

VEFTVKDGHL

.

.

.

.

.

.

CPALAKAVKT

.

.

.

.

KI AL

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

K. L Q D G T .......

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

VFL YY

E S~Q D ,G~EK

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

KGHDE DKLFD

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

NPFE RELR

.

A I FQ

.

.

.

.

.

.

.

.

.

KTD EIG

.

.

.

.

.

.

.

.

E G

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

G

.

.

.

I R

.

.

.

R I Q T R

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

107 238 148

.

.

.

.

.

.

.

.

.

.

.

.

.

107

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

T CN

.

N

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

hfkbpl2

fkbo73

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

. . . . . .

;

.

KoAItFH L Aj

AREK

.

.

.

.

.

.

.

.

.

.

.

.

HI .

.

.

.

.

.

.

.

.

.

.

l .

.

RLAEEENK

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

AKAEASSGDH

.

.

.

.

.

.

K

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

225 107

.

E

.

.

.

.

.

284 107

.

sHNH

.

172

107

.

K D

.

E

TVY

475

E

.

H

R

.

.

Al,~[

xlaalH H H hfkbp59

.

R

hfkbp59 hfkbpl2

.

A HSI~YLKI'.IS~

E

.

.

.

I

.

A A G QSTIV

A

.

K

.

I L

.

VKPQYGFGEM

xlR HaaBvH H

L QR

D ~ D L~N S A D[eDi~I~|E M J~lS E

.

.

AVIE ENLD

T V I ELK

.

.

.

.

MKKGEKVLLA

K V L K E

wfkbp73 hfkbp59 hfkbpl2

.

VFVKYEARLE

.

.

.

107

H

R

.

.

.

. . . . . . . . . .P.T.D.T.E.M. K. E. .E.Q. . . . . . . . . K S N T A G S Q S Q

.

.

.

.

.

.

.

107

VETEA459

Figure 1. Alignmentof wheat PPIase-FKBPamino acid sequence with human FKBP12 and FKBP59 as deduced from FASTAanalysis. The putative amino acid sequence of wheat PPIase-FKBP (wfkbp73) cDNA is shown as aligned by FASTAwith sequences of human FKBPI2 (hfkbpl2) [32, 54] and FKBP59 (hfkbp59) [41, 65]. Single-letter codes are used for amino acid residues and the star indicates translation termination codon of the wheat FKBP73 sequence. Black or grey boxes indicate residues that are identical or similar with the human FKBPS, respectively. Dots indicate gaps introduced to allow optimal alignment of the sequences.

the membranes were incubated with ECL chemiluminescence reagents (Amersham), and the films were developed for 1-10 min. The autoradiogram of the western blots were quantitated by Pharmacia LKBImageMaster DTS.

Results

Isolation and sequence analysis of wheat cDNA coding for a PPlase belonging to the FKBP family The strategy adopted for the isolation of the PPIases was based on the assumption that the domain representing the enzymatic active site will be as conserved in plants as in other organisms [59]. For this purpose degenerate primers were synthesized and a cDNA library was screened. Since the first library screening resulted in the isolation of partial cDNA clones, a second

library was screened. The screening of the I Z A P I I wheat-root-tip cDNA library with the pw620 probe (see materials and methods) resulted in 200 positive clones, from which 11 clones were analysed and found to have an identical 2 kb insert. The full-length 2 kbp sequence contained 25 bp in the 5'-untranslated region, a 1733 bp open reading frame, a 242 bp 3'-untranslated sequence and 22 bp poly(A) tail. A search through the E M B L database revealed that the deduced amino acid sequence exibits 42% identity to human FKPB12 and 50% to human FKBP59 (Fig. 1). The similarity between the wheat cDNA open reading frame to FKBP12 spans the entire PPIase domain and binding site for FK506 and rapamycin [36, 60] (Figs. 1 and 2). This sequence similarity is the basis for classifying the wheat PPIase as a member of the FKBP family, being named wheat FKBP73 (wFKBP73). The sequence similarity is also based on FKBP signature motifs found in the Prosite dictionary and

498 N-tall

:

wfkbp73 hfkbp59

MDDDFDIPAG ............

FKBPI2-1ike

domains

ss hfkbpl2

~QVETISP~

DD

MMGDGMG D~ITAE E M K A

TES

GP QSAPL

TCV iS'IHK~M~

~'dRTF~'~R~Q

hfkbp59-IIWfkbp73-II

H~'~ " ~ "[" ~ ! ~F

~

w~ZbpV3-H:~

~i~J,-',,~,,v..~..~,*

~mi~m~r'.'.'.'.'.'.'.'.'.~ v ~ T ~ [ N i m ' ~ m

ss



hfkbpl2

R ~ E ~ Q ~

h fkbp 59 - I

~

hfkbp59-II

Y~::~iQ~

I~@~'~

(putative

N

S~Q

~"""""~e~E~::E~EA R ~

~

E

41 31

TPR

and

S~DI~O'-~Th'II&'~Ai

~NK~'~M

,

-

~Q~J~..

.

~56 -97 "i-

~!c 2 0 9

K--roT.i~ ; ; I ~ R

E L RWE

• . ;~T

I m~!ramN L pimp 2oi .....

p T

>

SPlaDna ~. Gials~

calmodulin

KI'~S~[O~V[~

binding

hfkbp59

AQA~RLASH~

hfkbp59

A

wfkbp73 hfkbp59

.......................... HPTDTEMKEE QKSNTAGSQS

QLY

.

~D

a m vm v

EI~iIILBMQ S T [ V ~ R [ ~ T

V

~