A comprehensive analysis of fifteen genes of steviol glycosides biosynthesis pathway in Stevia rebaudiana (Bertoni)

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright

Author's personal copy Gene 492 (2012) 276–284

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

A comprehensive analysis of fifteen genes of steviol glycosides biosynthesis pathway in Stevia rebaudiana (Bertoni) Hitesh Kumar a, 1, Kiran Kaul a, 2, Suphla Bajpai-Gupta b, Vijay Kumar Kaul c, 2, Sanjay Kumar a,⁎ a b c

Biotechnology Division, CSIR-Institute of Himalayan Bioresource Technology (Council of Scientific and Industrial Research), Palampur-176061, Himachal Pradesh, India Plant Biotechnology Division, CSIR-Indian Institute of Integrative Medicine (Council of Scientific and Industrial Research), Jammu 180001, India Natural Plant Products Division, CSIR-Institute of Himalayan Bioresource Technology (Council of Scientific and Industrial Research), Palampur-176061, Himachal Pradesh, India

a r t i c l e

i n f o

Article history: Accepted 4 October 2011 Available online 20 October 2011 Received by Meghan Jendrysik Keywords: Gene expression MEP pathway Phytohormones Rebaudioside A Stevia rebaudiana Steviol glycosides Stevioside

a b s t r a c t Stevia [Stevia rebuaidana (Bertoni); family: Asteraceae] is known to yield diterpenoid steviol glycosides (SGs), which are about 300 times sweeter than sugar. The present work analyzed the expression of various genes of the SGs biosynthesis pathway in different organs of the plant in relation to the SGs content. Of the various genes of the pathway, SrDXS, SrDXR, SrCPPS, SrKS, SrKO and three glucosyltransferases namely SrUGT85C2, SrUGT74G1 and SrUGT76G1 were reported from stevia. Here, we report cloning of seven additional full-length cDNA sequences namely, SrMCT, SrCMK, SrMDS, SrHDS, SrHDR, SrIDI and SrGGDPS followed by expression analysis of all the fifteen genes vis-à-vis SGs content analysis. SGs content was highest in the leaf at 3rd node position (node position with reference to the apical leaf as the first leaf) as compared to the leaves at other node positions. Except for SrDXR and SrKO, gene expression was maximum in leaf at 1st node and minimum in leaf at 5th node. The expression of SrKO was highest in leaf at 3rd node while in case of SrDXR expression showed an increase up to 3rd leaf and decrease thereafter. SGs accumulated maximum in leaf tissue followed by stem and root, and similar was the pattern of expression of all the fifteen genes. The genes responded to the modulators of the terpenopids biosynthesis. Gibberellin (GA3) treatment up-regulated the expression of SrMCT, SrCMK, SrMDS and SrUGT74G1, whereas methyl jasmonate and kinetin treatment down-regulated the expression of all the fifteen genes of the pathway. © 2011 Elsevier B.V. All rights reserved.

1. Introduction

Abbreviations: SGs, Steviol glycosides; MEP, 2-C-methyl-D-erythritol-4 phosphate; DXP, 1-deoxy-D-xylulose 5-phosphate; DXS, DXP synthase; DXR, DXP reductoisomerase; IPP, Isopentenyl diphosphate; DMAPP, Dimethylallyl diphosphate; MCT, 4-(cytidine 5′ diphospho)-2-C-methyl-D-erythritol synthase; CMK, 4-(cytidine 5′ diphospho)-2-C-methyl-D-erythritol kinase; MDS, 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase; HDS, (E)-4-hydroxy-3-methylbut-2-enyl diphosphate synthase; HDR, (E)-4-hydroxy-3methylbut-2-enyl diphosphate reductase; IDI, Isopentenyl diphosphate isomerase; GGDPS, Geranylgeranyl diphosphate synthase; GGDP, Geranylgeranyl diphosphate; CPPS, Copalyl diphosphate synthase; KS, Kaurene synthase; KO, Kaurene oxidase; KAH, Kaurenoic acid hydroxylase; GTs, Glucosyltransferases; MeJA, Methyl jasmonate; RTPCR, Reverse transcriptase-polymerase chain reaction; RACE, Rapid amplification of cDNA ends; UPM, Universal primer mix A; NUP, Nested universal primer A; HPTLC, High performance thin layer chromatography; TLC, Thin layer chromatography; IDV, Integrated density value; FARM, First aspartate-rich motif; SARM, Second aspartate-rich motif. ⁎ Corresponding author. Tel.: + 91 1894 233339; fax: + 91 1894 230433. E-mail addresses: [email protected] (H. Kumar), [email protected] (K. Kaul), [email protected] (S. Bajpai-Gupta), [email protected] (V.K. Kaul), [email protected], [email protected] (S. Kumar). 1 Present address: Department of Botany, SCVB Government College, Palampur176061, Himachal Pradesh, India. Tel.: + 91 1894 235973; fax: + 91 1894 235973. 2 Tel.: + 91 1894 233339; fax: + 91 1894 230433. 0378-1119/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.10.015

Stevia [Stevia rebuaidana (Bertoni)] is a perennial herb which accumulates up to 30% of diterpenoid steviol glycosides (SGs) of the leaf dry weight (Geuns, 2003). SGs are approximately 300 times sweeter than common table sugar and are used as non-calorific sweetener in many countries of the world including China, Japan, Korea, Australia, New Zealand and many countries of European Union. SGs are glucosylated derivatives of diterpenoid alcohol steviol. Stevioside and rebaudioside A are the major SGs. Stevioside has three molecules of D-glucose attached to a steviol ring, whereas, rebaudioside A has four of these molecules. Other SGs present in lower concentration are: steviolbioside, rebaudioside B, C, D, E, F and dulcoside A (Kennelly, 2002; Starrat et al., 2002). World Health Organization has prescribed an acceptable daily intake for SGs of 0–2 mg/kg body weight (Beneford et al., 2006). Stevioside, one of the SGs, has been reported to lower the postprandial blood glucose level of Type II diabetes patients and blood pressure in mildly hypertensive patients (Hsieh et al., 2003; Gregersen et al., 2004). Experiments using labeled glucose revealed the involvement of plastidial, 2-C-methyl-D-erythritol-4 phosphate (MEP) pathway in the biosynthesis of steviol (Totté et al., 2000). The first step in the MEP pathway (Fig. 1) involves condensation of pyruvate and glyceraldehyde3-phosphate into 1-deoxy-D-xylulose 5-phosphate (DXP) catalyzed by

Author's personal copy H. Kumar et al. / Gene 492 (2012) 276–284

DXP synthase (DXS) (Kuzuyama et al., 2000). In the first committed step of the pathway, DXP reductoisomerase (DXR) catalyses the conversion of DXP into MEP, through NADPH dependent reduction and an intra-molecular rearrangement (Takahashi et al., 1998). MEP is converted into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) by the consecutive action of five enzymes namely 4-(cytidine 5′ diphospho)-2-C-methyl-D-erythritol synthase (MCT), 4-(cytidine 5′ diphospho)-2-C-methyl-D-erythritol kinase (CMK), 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS), (E)-4-hydroxy-3-methylbut-2-enyl diphosphate synthase (HDS), and (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR) encoded by MCT, CMK, MDS, HDS and HDR genes, respectively (Rohdich et al., 2000a,b; Hecht et al., 2001; Hsieh and Goodman, 2005, 2006). IPP and DMAPP are interconverted by isopentenyl diphosphate isomerase (IDI). Further, geranylgeranyl diphosphate synthase (GGDPS) carries out condensation of three molecules of IPP and one molecule of DMAPP to form geranylgeranyl diphosphate (GGDP) (McGarvey and Croteau, 1995). GGDP serves as an essential intermediate for biosynthesis of several isoprenoids and hence analysis and regulation of genes in the GGDP biosynthesis assumes central position in understanding the biosynthesis and possible manipulation of diterpenoids in plants (Bohlmann et al., 1998). In stevia, GGDP is converted into steviol by the consecutive action of four enzymes namely copalyl diphosphate synthase (CPPS), kaurene synthase (KS), kaurene oxidase (KO) and kaurenoic acid hydroxylase (KAH) (Brandle and Telmer, 2007). Different SGs are formed by glucosylation of steviol by specific glucosyltransferases (GTs) (Shibata et al., 1991, 1995). SGs biosynthesis pathway can be divided into two stages; early stage wherein GGDP is synthesized and late stage, which is involved in the synthesis of SGs from GGDP. Accordingly, the genes are termed as early and late genes representing early and late stages, respectively. Late genes reported from stevia include SrCPPS, SrKS, SrKO, and those

277

encoding GTs, namely SrUGT85C2, SrUGT74G1 and SrUGT76G1. Correlative studies showed the importance of SrCPPS, SrKS, SrKO in regulating SGs content. Of the nine early genes of GGDP biosynthesis, only two genes namely SrDXS and SrDXR are reported in stevia (Totté et al., 2003); and any relationship between expression of these genes and SGs content is also lacking. In order to have a comprehensive picture on the role of early as well as late genes of SGs biosynthesis pathway in relation to SGs content, it was imperative to clone the rest of early genes and study expression of all the genes vis-à-vis SGs content. To understand the SGs biosynthesis, we took advantage of the existing knowledge that secondary metabolites generally exhibit variation in response to organ and the developmental stage (Goralka and Langenheim, 1996; Dudareva et al., 2005; Singh et al., 2008; Rani et al., 2009; Singh et al., 2009a,b). The present manuscript discusses on spatial and developmental variation in SGs vis-à-vis expression of fifteen genes of the pathway; and in response to phytohormones, gibberellin (GA3), kinetin and methyl jasmonate (MeJA). These phytohormones were selected due to their known effect in modulating the terpenoids biosynthesis in general (Khoshkoo et al., 1993; Verpoorte et al., 1997; Martin et al., 2002; Choi et al., 2005; Zeneli et al., 2006; Amini et al., 2009). 2. Material and methods 2.1. Plant material Plants of Stevia rebaudiana (Bertoni), well maintained at experimental farm of our institute (32°06′20″ N latitude; 76°33′29″ E longitude; 1300 m amsl) were chosen for present studies. Required tissues were harvested and frozen immediately in liquid nitrogen. All the samples were stored at −80 °C until further use. Stevia gradually accumulates the SGs starting from the month of March onwards with peak at August–September (Bondarev et al.,

Glyceraldehyde 3-phosphate

Pyruvate

1 1-Deoxy-D-xylulose 5-phosphate

2 2-C-Methyl-D-erythritol 4-phosphate

3 4-(Cytidine 5' diphospho)-2-C-methyl-D-erythritol

4

MEP pathway

4-(Cytidine 5' diphospho)-2-C-methyl-D-erythritol 2-phosphate

5 2-C-Methyl-D-erythritol 2,4-cyclodiphosphate

6 (E)-4-hydroxy-3-methylbut-2-enyl diphosphate

Rebaudioside A

7 17

8 Dimethylallyl diphosphate

Isopentenyl diphosphate

Stevioside

16

9

Steviolbioside

Geranylgeranyl diphosphate

10 Copalyl diphosphate

11

12 (-) -Kaurene

13 (-)-Kaurenoic acid

14 Steviol

15 Steviolmonoside

Fig. 1. Schematic diagram showing steviol glycosides (SGs) biosynthesis pathway in stevia. Encircled numbers represent enzyme catalyzing the corresponding reaction step as follows: 1 DXS: 1-deoxy-D-xylulose 5-phospate synthase; 2 DXR: 1-deoxy-D-xylulose 5-phospate reductoisomerase; 3 MCT: 4-(cytidine 5′ diphospho)-2-C-methyl-D-erythritol 4-phosphate synthase; 4 CMK: 4-(cytidine 5′ diphospho)-2-C-methyl-D-erythritol kinase; 5 MDS: 2-C-methyl-D-erytrithol 2,4-cyclodiphosphate synthase; 6 HDS: (E)-4-hydroxy-3-methylbut-2enyl diphosphate synthase; 7 HDR: (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase; 8 IDI: isopentenyl diphosphate isomerase; 9 GGDPS: geranylgeranyl diphosphate synthase; 10 CPPS: copalyl diphosphate synthase; 11 KS: kaurene synthase; 12 KO: kaurene oxidase; 13 KAH: kaurenoic acid hydroxylase; 14 UGT85C2; 15 UGT; 16 UGT74G1; and 17 UGT76G1.

Author's personal copy 278

H. Kumar et al. / Gene 492 (2012) 276–284

2003); therefore, the experiments were carried out on six months old plants, when SGs contents are close to maximum. 2.2. Partial cloning of genes using degenerate primers Based on the highly conserved regions, primers were designed for MCT, CMK, MDS, HDS, HDR, IDI, and GGDPS (Table 1). Total RNA was isolated from leaf tissue as described earlier (Ghawana et al., 2011). Contaminating DNA was removed by DNase 1 (2U) digestion (Amplification grade, Invitrogen, USA). Total RNA (2 μg) was reverse transcribed at 42 °C with 200 U of Superscript III reverse transcriptase (Invitrogen, USA) in 20 μl reaction as per the manufacturer's instructions. PCR was performed using 1 μl of the reverse transcription mixture using 1 U Taq polymerase (Qiagen, Germany) in a 50 μl reaction on a GeneAmp 9700 cycler (Applied Biosystems) using the cycling conditions as described in Table 1. Amplified product was cloned into pGEM®-T Easy vector (Promega, USA) as per manufacturer's protocol. Sequences of cloned genes were analyzed using BLASTX. The partial sequences were cloned to fulllength through rapid amplification of cDNA ends (RACE). 2.3. Cloning of full length genes by RACE Degenerate primers yielded partial cDNAs and hence RACE was performed to clone the full-length cDNAs. Primers for 3′ and 5′ RACE of SrMCT, SrCMK, SrMDS, SrHDS, SrHDR, SrIDI, and SrGGDPS were designed based on the partial sequence information obtained above. Table 2 describes all the primers and PCR conditions used for RACE. The cDNA was synthesized using the DNA-free RNA isolated from leaf tissue. SMART TM RACE cDNA amplification Kit (BD Biosciences, Clontech, USA) was used for the purpose and various protocols as detailed by the manufacturer were followed. First, the first-strand 3′-RACE-ready and 5′-RACE-ready cDNA were prepared to be used as templates for 3′- and 5′-RACE, respectively. 3′-RACE PCR was performed using the 3′-gene-specific primer GSP1 and universal primer

Table 1 Primer sequencesa and PCR conditions used in the present work for the amplification of genes from stevia. Name of Primer sequence (forward primer, PCR conditions the gene F and reverse primer, R) (5′-3′) SrMCT

SrCMK

SrMDS

SrHDS

SrHDR

SrIDI

SrGGDPS

F: AARGARMGNCARGAYWSNGT R: GGNGTNGTNACYTTDATRTT F: CCTTGCAAGATHAATGTKTTCTT R: GCARTAKGCWGCTCCATANGARAA F: GCNCAYWSNGAYGGNGAYGT R: TTYTCNCCNARNSWRTCNAC F: CAYYTNGGNGTNACNGARGCNGG R: CCNGGNCCRTTNACDATRCANCC F: GGNTTYTGYTGGGGNGTNGA R: ACCCANGGRCANGTNGTRTC F: ACNTGYTGYWSNCAYCCNYTNTA R: TTYTGNACRTGRTCCCACCAYTT F: ARATGATMCAYACBAKSTCDYT R: ATRTCRTCMACMACYTGAAAYA

94 °C, 30 s; 52 °C, 1 min; 72 °C, 2 min (35 cycles).

94 °C, 30 s; 55 °C, 1 min; 72 °C, 2 min (35 cycles).

94 °C, 30 s; 52 °C, 1 min; 72 °C, 2 min (35 cycles).

94 °C, 30 s; 55 °C, 1 min; 72 °C, 2 min (35 cycles).

94 °C, 30 s; 50 °C, 1 min; 72 °C, 2 min (35 cycles).

94 °C, 30 s; 54 °C, 1 min; 72 °C, 2 min (35 cycles).

94 °C, 30 s; 50 °C, 1 min; 72 °C, 2 min (40 cycles).

a R = A/G; M = A/C; W = A/T; Y = C/T; S = C/G; K = G/T; D = A/G/T; H = A/C/T; B = G/C/T; N = A/T/G/C.

Table 2 Primer sequencesa and PCR conditions used in RACE reactions. cDNA

RACE primers (5′-3′)

SrMCT

GSP1: GTTCTGAATGATGGGTTGCGAGTTGGAG NGSP1: AAACCCTTTGGGAAATGCAAACTCCACA GSP2:

PCR conditions

Primary PCR 5 cycles: 94 °C, 30 s; 72 °C, 3 min; 5 cycles: 94 °C, 30 s; 70 °C, 30 s; 72 °C, 3 min; and 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. TGTGGAGTTTGCATTTCCCAAAGGGTTT Nested PCR NGSP2: 30 cycles: 94 °C, 30 s; 68 °C, CTCCAACTCGCAACCCATCATTCAGAAC 30 s; 72 °C, 3 min. SrCMK GSP1: Primary PCR GCTTTGTGGGCGGCTAACCAATTTAGTG 5 cycles: 94 °C, 30 s; 72 °C, NGSP1: 3 min; 5 cycles: 94 °C, 30 s; TTTAGTGGTGGTTTGGCGACCGAAAAAG 70 °C, 30 s; 72 °C, 3 min; and GSP2: 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C,3 min. TCTTGGAGTTCTTTTTCGGTCGCCAAAC Nested PCR NGSP2: 30 cycles: 94 °C, 30 s; 68 °C, CCCGGTTGGAACCCTTTTATCAACATGA 30 s; 72 °C, 3 min. SrMDS GSP1: Primary PCR GCTCACTCTGATGGTGATGTGCTTTTGC 5 cycles: 94 °C, 30 s; 72 °C, NGSP1: 3 min; 5 cycles: 94 °C, 30 s; CTTTGGGTCTACCTGACATCGGGCAAAT 70 °C, 30 s; 72 °C, 3 min; and GSP2: 30 cycles: 94 °C, 30 s; 68 °C, CGCCTCTTTATGCGGGCTTAACTTTGGT 30 s; 72 °C, 3 min. NGSP2: Nested PCR TGCCCCTTTCCATTTAGGATCATTGTCG 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. SrHDS GSP1: Primary PCR CCTGTTCAAAAGGAGGGTGAAGAGGTG NGSP1: 5 cycles: 94 °C, 30 s; 72 °C, ACAAAACCTTTGCCAAACGCCATTGTCT 3 min; 5 cycles: 94 °C, 30 s; GSP2: 70 °C, 30 s; 72 °C, 3 min; and CCATCAACTAAAAGCGCACCAGCATTTG 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. NGSP2: Nested PCR GGAACAGAACCATCACGGTGGAGTACA 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. SrHDR GSP1: Primary PCR TGTTGAGCGTGCGGTTCAGATTGCTTAT 5 cycles: 94 °C, 30 s; 72 °C, NGSP1: 3 min; 5 cycles: 94 °C, 30 s; TGATGTCATTGATAAGGGCGACGTCGTA 70 °C, 30 s; 72 °C, 3 min; and GSP2: 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. AGGCAAAATTACGACGTCGCCCTTATCA Nested PCR NGSP2: 30 cycles: 94 °C, 30 s; 68 °C, ACGACGTCGCCCTTATCAATGACATCAA 30 s; 72 °C, 3 min. SrIDI GSP1: Primary PCR TGTTGGATGAACTTGGTATCCCTGCTGA 5 cycles: 94 °C, 30 s; 72 °C, NGSP1: 3 min; 5 cycles: 94 °C, 30 s; CTACAAGGCTCCGTCTGATGGAAAGTGG 70 °C, 30 s; 72 °C, 3 min; and GSP2: 30 ACCTGAACCATGGAGACAGCTTCAACC cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. NGSP2: Nested PCR CCAAAGGCGTAAACTGATCAACTGGAA 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. SrGGDPS GSP1: Primary PCR AGGTGTACGGTGAAGAAATGGCGGTTC 5 cycles: 94 °C, 30 s; 72 °C, NGSP1: 3 min; 5 cycles: 94 °C, 30 s; ACAGGATCGTCCGAGCCATTGGTGAAC 70 °C, 30 s; 72 °C, 3 min; and GSP2: 30 cycles: 94 °C, 30 s; 68 °C, TCTAACCCAACATCAGCCCCTTCGGATA 30 s; 72 °C, 3 min. NGSP2: Nested PCR GAACCGCCATTTCTTCACCGTACACCTT 30 cycles: 94 °C, 30 s; 68 °C, 30 s; 72 °C, 3 min. a GSP1, gene specific primer for 3′-RACE; NGSP1, nested gene specific primer for 3′-RACE. GSP2, gene specific primer for 5′-RACE; NGSP2, nested gene specific primer for 3′-RACE.

mix A (UPM). Nested PCR was performed using NGSP1 primer and nested universal primer A (NUP). 5′-RACE PCR was performed with GSP2 primer and UPM, followed by nested PCR using nested NGSP2 primer and NUP. Amplicons were cloned into pGEM®-T Easy vector, and sequenced. The resulting 3′ and 5′ sequences were aligned using NCBI BLAST align software (http://www.ncbi.nlm.nih.gov/).

Author's personal copy H. Kumar et al. / Gene 492 (2012) 276–284

Subsequently, full-length cDNA clones were obtained using the primers designed from start and stop codons (Table 3) and cloned as described above. 2.4. Bioinformatic analyses For similarity searches, BLAST analysis was performed at NCBI (http://www.ncbi.nlm.nih.gov). Sequences were aligned using ClustalW (http://ebi.ac.uk/) and multalin program (http://prodes.toulouse. inra.fr/multalin/multalin.html) at default settings. Primers were designed and analyzed using Primer 3 Input software (Primer3_www. cgi v.0.2; http://frodo.wi.mit.edu/). Poly A signal was searched using HCpolya: Hamming Clustering poly-A prediction in Eukaryotic Genes (http://zeus2.itb.cnr.it/webgene/). The translated amino acid sequences were generated using the programs available at the ExPASy proteomic server (http://www.expasy.org). The protein families and domains of deduced amino acid sequences were analyzed using tools available at SMART (http://smart.emblheidelberg.de/). 2.5. Analysis of SGs content Pre-weighed frozen tissues were ground with cold methanol using a mortar and pestle. The ground material was transferred to a 50 ml flask and left at room temperature for 24 h. Samples were filtered and the solvent (methanol extract) was stored. The filtrate was reextracted with methanol as above and the process was repeated four times. Methanol extracts were pooled and dried under reduced pressure at 40 °C. Dry extracts were dissolved in 80% methanol– water and subjected to high performance thin layer chromatography (HPTLC) analysis (Jaitak et al., 2008). HPTLC was performed on a precoated silica gel HPTLC 60 F254 (20 × 10 cm) plate of 0.20 mm layer thickness. The samples and standards were applied on the plate as 6 mm wide bands with an automatic thin layer chromatography (TLC) sampler (ATS4) under a flow of nitrogen gas, 10 mm from the bottom, 10 mm from the side, space between two spots was 6 mm of the plate, and application speed was 150 nm/s. HPTLC plates were developed in a CAMAG twin-trough chamber (20 × 10 cm), which was pre-saturated with 50 ml mobile phase ethyl acetateethanol-water (80:20:12, v/v/v) for 30 min at room temperature (25 ± 2 °C) and 50 ± 5% RH. The chromatogram was run upto 9 cm from the base. TLC plates were dried in air drier in adequate ventilation conditions. The flow of air in the laboratory was maintained unidirectional (laminar flow, towards exhaust). Spots were visualized by spraying with acetic anhydride: sulphuric acid: ethanol (1:1:10, v/v/ v) followed by heating on CAMAG HPTLC plate heater at 110 °C for 2 min. Quantitative evaluation of HPTLC plate was performed after 20 min in reflection absorption mode at 510 nm, slit width Table 3 Primer sequences used for the full length cDNA amplifications and PCR conditions used in the present work. cDNA

Full length primers (forward primer, F and reverse primer, R) (5′-3′)

PCR conditions

SrMCT

F: ATGACGATTCTTCAAGTTATGTCGCCCC R: TTAAGCGGGCACAAATGAGTCGTTATTT F: ATGGCGACAATGGCTGCCACTCACTTCT R: TTACGCGGTGTTACTGGTTTGATTTGCA F: ATGGCTACTTCTTCGTCGTGTTACACCT R: TTATTTCTTCATCAACAGCACAACCGTG F: ATGGCGACCGGAGCTGCACCAACTTCTT R: TTACTCTTCCACAGGAGGATCAACCCAA F: ATGGCGACTCTCCGATTCAGCCCTTTCT R: TTAAGCGAATTGCAAGGATTCTTCACGT F: ATGGGTGACGATTCCGGCATGGACGCCG R: TTATATCAACTTATGGATGGTCTTCATG F: ATGGCTCTTGTAAATCCCACAGCTTTGT R: TCAGTTTTGCCTATAAGCATTGTAATTA

94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C,

SrCMK SrMDS SrHDS SrHDR SrIDI SrGGDPS

30 s; 60 °C, 1 min; 2 min (35 cycles). 30 s; 60 °C, 1 min; 2 min (35 cycles). 30 s; 60 °C, 1 min; 2 min (35 cycles). 30 s; 60 °C, 1 min; 2 min (35 cycles). 30 s; 60 °C, 1 min; 2 min (35 cycles). 30 s; 60 °C, 1 min; 2 min (35 cycles). 30 s; 60 °C, 1 min; 2 min (40 cycles).

279

6 mm × 0.4 mm, scanning speed 20 mm/s, and data resolution 100 μm/step. A CAMAG video documentation system in conjunction with the Reprostar 3 was used for imaging and archiving the thin layer chromatograms. The object was captured by means of a highly sensitive digital camera DXA252, CAMAG. A special digitizing board (frame grabber) assisted in rapid processing via the personal computer system. Image acquisition processing and archiving were controlled via Win CATS software. 2.6. Gene expression analyses Gene expression was studied by reverse transcription-polymerase chain reaction (RT-PCR) using 26S rRNA as an internal control (Singh et al., 2004). Synthesis of cDNA was carried out as described earlier and PCR was performed using 1 μl of cDNA template in a 25 μl reaction. Cycling conditions were optimized for each gene to obtain amplification under the exponential phase of PCR amplification (Table 4). Images were captured and signal intensities were measured using a gel documentation system (Alpha DigiDoc™, Alpha Innotech, USA). Integrated density value (IDV) was calculated using AD-1000 software to estimate changes in the gene expression. All PCRs were replicated at least three times using first strand cDNA of at least two independent RNA preparations and representative one time gel pictures are shown. 2.7. Phytohormones treatment Cuttings of six month old plants were transferred to a plant growth chamber (temperature 25 ± 3 °C, light intensity 200 μE m − 2 s − 1, RH 70–80%; Saveer Biotech, India) and placed in 100 μM GA3 (Mansouri et al., 2011), 100 μM kinetin (Yi et al., 1999) and 100 μM MeJA (Bhardwaj et al., 2011), separately (Sigma-Aldrich, USA). Cuttings kept in water served as control. 3rd leaf was harvested Table 4 Primer sequences for expression primers and PCR conditions used in the present work. cDNA SrDXS

Expression primers (forward primer, F and reverse primer, R) (5′-3′)

F: GATCTACAAAAGTTACCGGTTC R: TCCTCTACGGTAAGTAAGACTTC SrDXR F: TTGAGCTATCTATCTCCAACAC R: TATCTGTTCAGCAAGAAGAGTC SrMCT F: AGACAAGATTCTGTTTTTAGTG R: GAGTTGTAACCTTGATGTTAGT SrCMK F: AATCTATATCGCAAGAAGACTG R: CTTCCAGACATAAAAACAGAAT SrMDS F: GAGCCTGGATACCCTCTCATC R: CCTCTTTATGCGGGCTTAACT SrHDS F: AAAAGGTTGATTGATGTAAGTAT R: TAATAAGATACCATCTCCAAGTC SrHDR F: AAACAATTTGATGTCATTGATAA R: GGTTCTTTCTACTAGTTTTCCAA SrIDI F: TATGAGTTACTCCTTCAGCAAC R: AGGTAGTCAAGTTCATGTTCTC SrGGDPS F: AGTTCATGACGACCTTCCATGCA R: ATATGAATATACTCCAAGTGGTC SrCPPS1 F: CGACTCGAGACAAGATATTACT R: CTATAAAGGCTGTTATGTCCTC SrKS1-1 F: GAGAGAAGCTATATGGACAAGAG R: GATGTCCTTCACAGTATCAAGA SrKO1 F: GTTGAAGGAGAAGAAACCTTAC R: CAACATATAAGCTCTCCACATC SrUGT85C2 F: GAGAATCACTCTTGAGATCCAT R: TAATACTAGGCTCCAACTCATC SrUGT74G1 F: CATGAACTGGTTAGACGATAAG R: TTATTACTCCTCTTTCCTCCTC SrUGT76G1 F: ATCTGTTGCTGACAGTCTTAAC R: TAACATACAGTACCGAACTTGG 26S rRNA F: CACAATGATAGGAAGAGCCGAC R: CAAGGGAACGGGCTTGGCAGAATC

PCR conditions 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C, 94 °C, 72 °C,

30 s; 55 °C, 1 min; 1 min (29 cycles) 30 s; 55 °C, 1 min; 1 min (35 cycles) 30 s; 55 °C, 1 min; 1 min (30 cycles) 30 s; 55 °C, 1 min; 1 min (31 cycles) 30 s; 55 °C, 1 min; 1 min (29 cycles) 30 s; 55 °C, 1 min; 1 min (30 cycles) 30 s; 55 °C, 1 min; 1 min (30 cycles) 30 s; 55 °C, 1 min; 1 min (31 cycles) 30 s; 55 °C, 1 min; 1 min (40 cycles) 30 s; 55 °C, 1 min; 1 min (32 cycles) 30 s; 55 °C, 1 min; 1 min (33 cycles) 30 s; 55 °C, 1 min; 1 min (32 cycles) 30 s; 55 °C, 1 min; 1 min (31 cycles) 30 s; 55 °C, 1 min; 1 min (31 cycles) 30 s; 55 °C, 1 min; 1 min (31 cycles) 30 s; 55 °C, 1 min; 1 min (24 cycles)

Author's personal copy 280

H. Kumar et al. / Gene 492 (2012) 276–284

and used for analyses. The samples were harvested at different time intervals starting from 10:00 am onwards and stored at − 80 °C until used. The cuttings showed wilting symptoms at 8 h of the treatment and hence all the experiments were performed till 6 h of the treatment. The sampling was performed at 2 h, 4 h and 6 h of transfer of the cutting to the treatment medium. The experiment was repeated three times. The period of 6 h was too small to monitor any change in the SGs content (data not shown) and hence the effect was studied on the expression of genes only.

3. Results and discussion 3.1. Isolation of seven cDNA sequences encoding the enzymes of SGs biosynthesis pathway SGs are derived from MEP pathway involving series of enzymes encoded by the corresponding genes. A holistic picture on various genes of the pathway is crucial to identify the critical regulatory gene (s), which has not been studied yet in stevia. Previous studies indicated the importance of SrCPPS, SrKS and SrKO in determining SGs content (Richman et al., 1999, 2005; Humphrey et al., 2006). The conclusion was based on relative expression of these genes and SGs content in different organs. Also, three GTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) are known to modulate the synthesis of stevioside and rebaudioside A and hence assumes importance (Richman et al., 2005). In the present work, seven full-length cDNAs involved in SGs biosynthesis pathway were cloned for the first time from stevia using degenerate primers followed by RACE. Degenerate primers yielded amplicons of 401 bp, 426 bp, 332 bp, 1127 bp, 290 bp, 398 bp and 446 bp for SrMCT, SrCMK, SrMDS, SrHDS, SrHDR, SrIDI and SrGGDPS, respectively. RACE yielded full-length cDNAs of SrMCT, SrCMK, SrMDS, SrHDS, SrHDR, SrIDI and SrGGDPS of 1241 bp, 1500 bp, 870 bp, 2599 bp, 1629 bp, 1048 bp, and 1245 bp, respectively and BLASTX analysis showed 63 to 92% homology with the corresponding sequence reported from Arabidopsis thaliana (Supplementary file 1). SrMCT, SrCMK, SrMDS, SrHDS, SrHDR, SrIDI and SrGGDPS had an open reading frame of 954 bp, 1215 bp, 696 bp, 2223 bp, 1377 bp, 699 bp, and 1086 bp, respectively (Supplementary file 2). Full-length cDNAs of SrMCT, SrCMK, SrMDS, SrHDS, SrHDR, SrIDI, and SrGGDPS were submitted to NCBI gene databank under the accession numbers DQ269452, DQ269453, DQ631427, DQ768749, DQ269451, DQ989585 and DQ432013, respectively. Alignment of deduced amino acid sequences with the corresponding sequences available at gene databank at NCBI revealed the presence of conserved amino acid residues (Supplementary file 3). Arg

102, Lys 109, Arg 258 and Lys 295 are conserved in SrMCT and contribute to the enzyme activity through their role in binding and processing of substrates (Richard et al., 2001; Kemp et al., 2003). In SrCMK, residues 183 through 202 are the conserved ATP-binding site for the functional activity (Rohdich et al., 2000b). Highly conserved residues present in SrIspF at positions Asp 82, His 84 and His 116 contribute to the enzymatic reaction (Calisto et al., 2007). SrHDS had three conserved Cys residues at positions 644, 647 and 678, which constitute the ligands of the [4Fe–4S] 2 + cluster (Seemann et al., 2005). SrHDR had conserved Cys residues at positions 114, 205 and 259 known to be essential for the functional activity (Gräwert et al., 2004). Characteristic Cys in NxxCxHP consensus sequence and a Glu in ExE consensus sequence are conserved in the active site of SrIDI (Hahn et al., 1996). SrGGDPS displays two strongly conserved aspartate-rich domains characterized as the first aspartate-rich motif (FARM) and the second aspartate-rich motif (SARM). FARM contain highly conserved DD (Asp) and RR (Arg) dipeptides, DD(X)9RR, while DDXXD motif is present in SARM. Both DD(X)9RR and DDXXD motifs are important for the catalytic activity of GGPPS (Ashby and Edwards, 1990). Pfam analysis also showed the presence of characteristic conserved domains in the deduced amino acid sequences of SrMCT, SrCMK, SrMDS, SrHDS, SrHDR, SrIDI and SrGGDPS (Supplementary file 4). 3.2. Spatial, developmental and hormonal regulation of SGs biosynthesis pathway genes and SGs content The current study examined the relationship between expression of SGs biosynthesis pathway genes and SGs content of stevia in different leaf positions and different vegetative parts of the plant. Gene expression was also studied in response to applied phyto-hormones. 3.2.1. Older leaves exhibit lower SGs content and a decrease in expression of SGs biosynthesis pathway genes Stevioside and rebaudioside A contents were studied from 1st leaf (youngest/immature; leaf number refers to the node position) to 5th leaf (relatively mature leaf) in six month old stevia plants. Stevioside and Rebaudioside A were minimum in 1st leaf (23% and 37%, respectively of the 3rd leaf) and maximum in 3rd leaf. Thereafter, the contents showed slight decline in 4th and 5th leaf (Fig. 2A). Expression of SrDXS, SrMCT, SrCMK, SrHDR, SrIDI, SrGGDPS, SrCPPS and three GTs exhibited evident down-regulation in mature as compared to younger leaves (Fig. 2B). Of all the genes, SrDXR and SrKO showed 50% and 29% increase, respectively in leaf at 3rd node position. Correlation coefficient of all the fifteen genes with stevioside and rebaudioside A

B

A

Leaf position 1st

Stevioside

3

Rebaudioside A

2.5

%

2 1.5 1 0.5 0 1st

2nd

3rd

Leaf position

4th

5th

2nd

3rd

4th

5th 26S rRNA SrDXS SrDXR SrMCT SrCMK SrMDS SrHDS SrHDR SrIDI SrGGDPS SrCPPS1 SrKS1-1 SrKO1 SrUGT85C2 SrUGT74G1 SrUGT76G1

Fig. 2. SGs content (A), and expression of genes of SGs biosynthetic pathway (B) in leaves at different node positions (leaf position is defined with reference to the apical leaf as the 1st leaf). 26S rRNA was used as an internal control as shown previously (Singh et al., 2004). Name of genes is shown on right side of the panel in abbreviated form with their expanded form in Fig. 1. All the experiments were repeated three times. Each value represents the mean ± standard error of three separate biological replicates.

Author's personal copy H. Kumar et al. / Gene 492 (2012) 276–284

contents showed a positive correlation with the expression of SrDXR with stevioside (r = 0.71) and rebaudioside A (r =0.77). SrKO showed a positive correlation only with stevioside content (r= 0.62) (Supplementary file 5) suggesting their role in controlling the metabolic flux for SGs biosynthesis. Absence of correlation between SGs content and expression of rest of the genes of the pathway suggests that these genes (or their gene products) could be non-limiting/non-regulatory as has been shown in other metabolic pathways as well wherein only a few genes of the pathway served as regulatory genes (Singh et al., 2008). In previous report, SrKO was shown to be important for SGs accumulation (Humphrey et al., 2006). Our report suggested the importance of SrDXR as well in regulating SGs accumulation. In fact, DXR has been shown to play a key role in controlling accumulation of isoprenoids precursors in plants such as Picrorhiza kurrooa (Kawoosa et al., 2010), Populus × canescens (Mayrhofer et al., 2005) and Mentha × piperita (Mahmoud and Croteau, 2001) and also their compartmentalization in Catharanthuus roseus (Burlat et al., 2004). Since MEP pathway is involved in the synthesis of a large number of compounds such as chlorophylls and many diterpenoids, comparatively higher expression of these genes in younger tissue suggests their requirement for growth and development. 3.2.2. Leaf tissue exhibits highest SGs content and expression of genes as compared to stem and root An analysis of SGs in leaf (3rd leaf was used for this experiment due to the presence of maximum SGs amongst leaf at various positions), stem and roots of six month old plant showed that stevioside content in stem and roots was 78% and 52%, respectively of the leaf tissue. Rebaudioside A was not detected in the root, while in stem it was 7% of the leaf tissue (Fig. 3A). Previous studies on stevia also showed lower SGs level in stem and root as compared to the leaf (Bondarev et al., 2003). RT-PCR analysis showed that all the fifteen genes were expressed maximally in leaf, to a lesser extent in stem and least expression was detected in roots (Fig. 3B). Also, the expression of all the fifteen genes showed a very strong positive correlation with SGs content (Supplementary file 5). MEP pathway genes have been shown to be associated with terpenoid accumulation in a variety of systems (Cordoba et al., 2009). For example,

1.8

Root

Stem

Leaf 26S rRNA

1.6

Stevioside

SrDXS

1.4

Rebaudioside A

SrDXR SrMCT

1.2

%

DXS has been reported as a regulating gene for the biosynthesis of various plastidic isoprenoids including chlorophylls, tocopherols, carotenoids, abscisic acid, and gibberellins (Estévez et al., 2001). Over-expression of DXS was positively correlated with essential oil accumulation in spike lavender (Munoz-Bertomeu et al., 2006) and ginkgolide accumulation in Ginkgo biloba (Gong et al., 2006). Expression of MCT has been positively correlated with ginkgolides content in Ginkgo biloba (Kim et al., 2006), and phytoalexins content in Oryza sativa (Okada et al., 2007). Similarly CMK has been shown to be associated with ginkgolide biosynthesis (Kim et al., 2008). A positive correlation has been shown between expression of MDS and monoterpenoid indole alkaloids accumulation in Cataranthus roseus (Veau et al., 2000) and ginkgolides biosynthesis in Ginkgo bioloba (Kim et al., 2006). HDR have been shown to be involved in carotenoid biosynthesis (Flores-Perez et al., 2008) and taxadiene production (Botella-Pavia et al., 2004). Silencing the IDI gene resulted in plants with an 80% reduction in pigments compared with controls (Page et al., 2004), demonstrating the usefulness of IDI for a fully functional MEP pathway. Among the late genes, expression of SrGGDP, whose gene product catalyses a dedicated step in SGs biosynthesis showed an elevated level of transcript in leaf as compared to the stem and root. The expression of GGDP has been found to be correlated with terpenoid synthesis in many plants for example, in taxol biosynthesis in Taxus canadensis (Hefner et al., 1998) and prenyl chain elongation for rubber biosynthesis in Hevea brasiliensis (Takaya et al., 2003). The MEP pathway enzymes are localized in plastids, in particular in chloroplasts and this is in accordance with a higher expression of MEP pathway genes in leaves (Lichtenthaler, 1999). Similarly GGDPS, CPPS and KS also contain chloroplast localization signals helping their sorting in chloroplasts. Expression analysis and in situ hybridization of SrCPPS, SrKS and SrKO revealed the presence of transcripts in leaf parenchyma (Humphrey et al., 2006). Also, the expression of different GTs involved in stevioside and rebaudioside A biosynthesis showed higher expression in leaf as compared to stem and root tissues. These studies support our results on higher expression of the pathway genes in leaf tissue as compared to the other tissues and are also reflected in higher accumulation of SGs in leaf tissues. SGs are derived from the same kaurenoid precursor as gibberellins. and SrCPPS,

B

A

281

SrCMK

1

SrMDS

0.8

SrHDS SrHDR

0.6 0.4

SrIDI

0.2

SrGGDPS SrCPPS1

0 Root

Stem

Organs

Leaf

SrKS1-1 SrKO1 SrUGT85C2 SrUGT74G1 SrUGT76G1

Fig. 3. SGs content (A), and expression of genes of SGs biosynthesis pathway (B) in leaf (3rd leaf; leaf position with reference to the apical leaf as the first leaf), stem and root tissues. 26S rRNA was used as an internal control as shown previously (Singh et al., 2004). Name of genes is shown on right side of the panel in abbreviated form with their expanded form in Fig. 1. Each value represents the mean ± standard error of three separate biological replicates.

Author's personal copy 282

H. Kumar et al. / Gene 492 (2012) 276–284

A

C

B

Fig. 4. Effect of gibberelin (GA3, 100 μM; A), methyl jasmonate (MeJA, 100 μM; B) and kinetin (100 μM; C) on gene expression in 3rd leaf (leaf position with reference to the apical leaf as the first leaf) at different time intervals as shown above each panel. Experiment was conducted using stem cuttings with leaves present upto 5 nodes. Cuttings were placed in vials containing the desired phytohormone; those placed in water served as the control. Sampling was done at 2, 4 and 6 h of the treatment. Name of the gene is shown on right side of the panel in abbreviated form with the expanded form mentioned in the legend of Fig. 1. 26S rRNA was used as an internal control as shown previously (Singh et al., 2004).

SrKS and SrKO are involved in both gibberellins and steviol biosynthesis. In stevia, it has been shown that these genes are highly expressed in mature leaves, a pattern opposite to that found in other plants where these genes are expressed more in the younger/meristematic tissue, suggesting their involvement in the synthesis of SGs (Richman et al., 2005). 3.2.3. GA3 up-regulated selected genes of the pathway, whereas MeJA and kinetin down-regulated all the fifteen genes GA3, kinetin and MeJA are known to modulate terpenoid biosynthesis (Khoshkoo et al., 1993; Choi et al., 2005; Zeneli et al., 2006; Amini et al., 2009). Therefore, it was of interest to understand the role of these phytohormones on expression regulation of genes involved in SGs biosynthesis. Expression analysis showed that SrMCT, SrCMK, SrMDS and SrUGT74G1 exhibited a gradual up-regulation up to 6 h of GA3 treatment (Fig. 4A), whereas expression of other genes did not exhibit any perceptible change. There is limited information on the effect of GA3 in relation to terpenoid metabolism. The work on Cannabis sativa showed down-regulation of the DXS by the GA3 (Mansouri et al., 2011). However, up-regulation of the genes of the SGs biosynthesis pathway in stevia suggests differential gene regulation. MeJa and kinetin down-regulated the expression of all the fifteen genes of SGs biosynthesis pathway at 2 h and onwards of the treatments (Figs. 4B, C). MeJA has been reported to up-regulate as well as down-regulate the products derived from MEP pathway. For example, MeJA has been shown to up-regulate monoterpenoid indole alkaloids accumulation in Catharanthus roseus cells by altering the genes involved in the pathway (Goklany et al., 2009). Similalry, terpenoid accumulation in developing xylem of Norway spruce stems was reported by MeJa treatment (Zeneli et al., 2006). A decrease in chlorophyll contents has been reported for Cucurbita pepo in response to MeJA treatment (Ananieva et al., 2004). Since chlorophyll is also derived from MEP pathway, MeJA down-regulated chlorophyll accumulation possibly by down-regulating genes of MEP pathway. Kinetin has been shown to decrease the terpenoid aldehydes in root-knot nematode infected cotton plants; though any analysis on gene expression was lacking (Khoshkoo et al., 1993). The present work offers opportunities to explore the mechanism of gene regulation in response to at least these phytohormones. 4. Conclusions The present research led to cloning of seven genes of SGs biosynthesis pathway and also analyzed a total of fifteen genes in relation to SGs in

stevia. SGs content was highest in 3rd leaf as compared to the leaves at other node positions, and stem and roots. Except for SrDXR and SrKO, gene expression was maximum in leaf at 1st node position and minimum in leaf at 5th node position. Expression of SrDXR and SrKO showed a positive correlation with the SGs content. Similarly a very high expression of the SGs biosynthesis pathway genes was noticed in leaf tissue as compared to the stem and roots, which showed a strong positive correlation with SGs content. Expression of SrMCT, SrCMK, SrMDS and SrUGT74G1 was up-regulated in response to GA3 treatment, while MeJA and kinetin down-regulated the expression of all the genes of the pathway. Supplementary materials related to this article can be found online at doi:10.1016/j.gene.2011.10.015. Acknowledgments Authors thank Council of Scientific and Industrial Research (CSIR) for funding under the mission mode project entitled “Exploration and acquisition of specific and targeted neutraceuticals with a back drop of nutrigenomic stevia, tea and potato species; CMM0014”. HK gratefully acknowledges the Junior/Senior Research Fellowship awarded by Indian Council of Medical Research (ICMR). The technical assistance provided by Digvijay Singh and Vijay Lata Pathania is duly acknowledged. The manuscript represents IHBT communication number 2069. References Amini, A., Glevarec, G., Andreu, F., Rideau, M., Creche, J., 2009. Low levels of gibberellic acid control the biosynthesis of ajmalicine in Catharanthus roseus cell suspenion cultures. Planta Med. 75, 187–191. Ananieva, K., Malbeck, J., Kamínek, M., Van Staden, J., 2004. Methyl jasmonate downregulates endogenous cytokinin levels in cotyledons of Cucurbita pepo (zucchini) seedlings. Physiol. Plant. 122, 496–503. Ashby, M.N., Edwards, P.A., 1990. Elucidation of the deficiency in two yeast coenzyme Q mutants. Characterization of the structural gene encoding hexaprenyl pyrophosphate synthetase. J. Biol. Chem. 265, 13157–13164. Beneford, D.J., DiNovi, M., Schlatter, J., 2006. Steviol glycosides. Safety evaluation of certain food additives. WHO Food Additive Series. WHO, Geneva, pp. 117–143. Bhardwaj, P.K., Kaur, J., Sobti, R.C., Ahuja, P.S., Kumar, S., 2011. Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid. Gene 483, 49–53. Bohlmann, J., Meyer-Gauen, G., Croteau, R., 1998. Plant terpenoid synthases: molecular biology and phylogenetic analysis. Proc. Natl. Acad. Sci. U. S. A. 95, 4126–4133. Bondarev, N., Sukhanova, M., Reshetnyak, O., Nosov, A., 2003. Steviol glycoside content in different organs of Stevia rebaudiana and its dynamics during ontogeny. Biol. Planta. 47, 261–264. Botella-Pavia, P., Besumbes, O., Phillips, M.A., Carretero-Paulet, L., Boronat, A., RodriguezConcepcion, M., 2004. Regulation of carotenoid biosynthesis in plants: evidence for

Author's personal copy H. Kumar et al. / Gene 492 (2012) 276–284 a key role of hydroxymethylbutenyl diphosphate reductase in controlling the supply of plastidial isoprenoid precursors. Plant J. 40, 188–199. Brandle, J.E., Telmer, P.G., 2007. Steviol glycoside biosynthesis. Phytochemistry 68, 1855–1863. Burlat, V., Oudin, A., Courtois, M., Rideau, M., St-Pierre, B., 2004. Co-expression of three MEP pathway genes and geraniol 10-hydroxylase in internal phloem parenchyma of Catharanthus roseus implicates multicellular translocation of intermediates during the biosynthesis of monoterpene indole alkaloids and isoprenoid-derived primary metabolites. Plant J. 38, 131–141. Calisto, B.M., Perez-Gil, J., Bergua, M., Querol-Audi, J., Fita, I., Imperial, S., 2007. Biosynthesis of isoprenoids in plants: structure of the 2C-methyl-D-erithrytol 2,4-cyclodiphosphate synthase from Arabidopsis thaliana. Comparison with the bacterial enzymes. Protein Sci. 16, 2082–2088. Choi, D.-W., et al., 2005. Analysis of transcripts in methyl jasmonate-treated ginseng hairy roots to identify genes involved in the biosynthesis of ginsenosides and other secondary metabolites. Plant Cell Rep. 23, 557–566. Cordoba, E., Salmi, M., León, P., 2009. Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants. J. Exp. Bot. 60, 2933–2943. Dudareva, N., et al., 2005. The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. Proc. Natl. Acad. Sci. U. S. A. 102, 933–938. Estévez, J.M., Cantero, A., Reindl, A., Reichler, S., León, P., 2001. 1-deoxy-D-xylulose-5phosphate synthase, a limiting enzyme for plastidic isoprenoid biosynthesis in plants. J. Biol. Chem. 276, 22901–22909. Flores-Perez, U., Perez-Gil, J., Rodriguez-Villalon, A., Gil, M., Vera, P., Rodriguez-Concepcion, M., 2008. Contribution of hydroxymethylbutenyl diphosphate synthase to carotenoid biosynthesis in bacteria and plants. Biochem. Biophys. Res. Commun. 371, 510–514. Geuns, J.M.C., 2003. Stevioside. Phytochemistry 64, 913–921. Ghawana, S., et al., 2011. An RNA isolation system for plant tissues rich in secondary metabolites. BMC Res. Notes 4, 85. Goklany, S., Loring, R.H., Glick, J., Lee-Parsons, C.W., 2009. Assessing the limitations to terpenoid indole alkaloid biosynthesis in Catharanthus roseus hairy root cultures through gene expression profiling and precursor feeding. Biotechnol. Prog. 25, 1289–1296. Gong, Y.F., Liao, Z.H., Guo, B.H., Sun, X.F., Tang, K.X., 2006. Molecular cloning and expression profile analysis of Ginkgo biloba DXS gene encoding 1-deoxy-D-xylulose 5-phosphate synthase, the first committed enzyme of the 2-C-methyl-D-erythritol 4-phosphate pathway. Planta Med. 72, 329–335. Goralka, R.J.L., Langenheim, J.H., 1996. Implications of foliar monoterpenoid variation among ontogenetic stages of the California bay tree (Umbellularia californica) for deer herbivory. Biochem. Syst. Ecol. 24, 13–23. Gräwert, T., et al., 2004. IspH protein of Escherichia coli: studies on iron-sulfur cluster implementation and catalysis. J. Am. Chem. Soc. 126, 12847–12855. Gregersen, S., Jeppesen, P.B., Holst, J.J., Hermansen, K., 2004. Antihyperglycemic effects of stevioside in type 2 diabetic subjects. Metab. Clin. Exp. 53, 73–76. Hahn, F.M., Baker, J.A., Poulter, C.D., 1996. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase. J. Bacteriol. 178, 619–624. Hecht, S., et al., 2001. Studies on the nonmevalonate pathway to terpenes: the role of the GcpE (IspG) protein. Proc. Natl. Acad. Sci. U. S. A. 98, 14837–14842. Hefner, J., Ketchum, R.E.B., Croteau, R., 1998. Cloning and functional expression of a cDNA encoding geranylgeranyl diphosphate synthase from Taxus canadensis and assessment of the role of this prenyltransferase in cells induced for Taxol production. Arch. Biochem. Biophys. 360, 62–74. Hsieh, M.H., Goodman, H.M., 2005. The arabidopsis IspH homolog is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. Plant Physiol. 138, 641–653. Hsieh, M.H., Goodman, H.M., 2006. Functional evidence for the involvement of Arabidopsis IspF homolog in the nonmevalonate pathway of plastid isoprenoid biosynthesis. Planta 223, 779–784. Hsieh, M.H., et al., 2003. Efficacy and tolerability of oral stevioside in patients with mild essential hypertension: a two-year, randomized, placebo-controlled study. Clin. Ther. 25, 2797–2808. Humphrey, T.V., Richman, A.S., Menassa, R., Brandle, J.E., 2006. Spatial organisation of four enzymes from Stevia rebaudiana that are involved in steviol glycoside synthesis. Plant Mol. Biol. 61, 47–62. Jaitak, V., Gupta, A.P., Kaul, V.K., Ahuja, P.S., 2008. Validated high-performance thinlayer chromatography method for steviol glycosides in Stevia rebaudiana. J. Pharm. Biomed. Anal. 47, 790–794. Kawoosa, T., et al., 2010. Light and temperature regulated terpene biosynthesis: hepatoprotective monoterpene picroside accumulation in Picrorhiza kurrooa. Funct. Integr. Genomics 10, 393–404. Kemp, L.E., Bond, C.S., Hunter, W.N., 2003. Structure of a tetragonal crystal form of Escherichia coli 2C-methyl-Derythritol 4-phosphate cytidylyltransferase. Acta Crystallogr. 59, 607–610. Kennelly, E.J., 2002. Sweet and non-sweet constituents of Stevia rebaudiana (Bertoni) Bertoni. In: Kinghorn, A.D. (Ed.), Stevia, the Genus Stevia. Medicinal and Aromatic Plants-Industrial Profiles. Taylor and Francis, London and New York, pp. 68–85. Khoshkoo, N., Hedin, P.A., McCarty, J.C., 1993. Effects of bioregulators on the terpenoid aldehydes in root-knot nematode infected cotton plants. J. Agric. Food Chem. 41, 2442–2446. Kim, S.M., Kuzuyama, T., Chang, Y.J., Kwon, H.J., Kim, S.U., 2006. Cloning and functional characterization of 2-C-methyl-D-erythritol 4-phosphate cytidyltransferase (GbMECT) gene from Ginkgo biloba. Phytochemistry 67, 1435–1441. Kim, S.M., Kim, Y.B., Kuzuyama, T., Kim, S.U., 2008. Two copies of 4-(cytidine 5′-diphospho)2-C-methyl-d-erythritol kinase (CMK) gene in Ginkgo biloba: molecular cloning and functional characterization. Planta 228, 941–950.

283

Kuzuyama, T., Takagi, M., Takahashi, S., Seto, H., 2000. Cloning and characterization of 1-deoxy-D-xylulose 5-phosphate synthase from Streptomyces sp strain CL190, which uses both the mevalonate and nonmevalonate pathways for isopentenyl diphosphate biosynthesis. J. Bacteriol. 182, 891–897. Lichtenthaler, H.K., 1999. The 1-deoxy-d-xylulose- 5-phosphate pathway of isoprenoid biosynthesis in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 47–65. Mahmoud, S.S., Croteau, R.B., 2001. Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase. Proc. Natl. Acad. Sci. U. S. A. 98, 8915–8920. Mansouri, H., Asrar, Z., Amarowic, R., 2011. The response of terpenoids to exogenous gibberellic acid in Cannabis sativa L. at vegetative stage. Acta Physiol. Plant. 33, 1085–1091. Martin, D., Tholl, D., Gershenzon, J., Bohlmann, J., 2002. Methyl jasmonate induces traumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumulation in developing xylem of Norway spruce stems. Plant Physiol. 129, 1003–1018. Mayrhofer, S., Teuber, M., Zimmer, I., Louis, S., Fischbach, R.J., Schnitzler, R.P., 2005. Diurnal and seasonal variation of isoprene biosynthesis-related genes in Grey poplar leaves. Plant Physiol. 139, 474–484. McGarvey, D.J., Croteau, R., 1995. Terpenoid metabolism. Plant Cell 7, 1015–1026. Munoz-Bertomeu, J., Arrillaga, I., Ros, R., Segura, J., 2006. Up-regulation of 1-deoxy-Dxylulose-5-phosphate synthase enhances production of essential oils in transgenic spike lavender. Plant Physiol. 142, 890–900. Okada, A., et al., 2007. Elicitor induced activation of the methylerythritol phosphate pathway toward phytoalexins biosynthesis in rice. Plant Mol. Biol. 65, 177–187. Page, J.E., et al., 2004. Functional analysis of the final steps of the 1-Deoxy-D-xylulose 5-phosphate (DXP) pathway to isoprenoids in plants using virus-induced gene silencing. Plant Physiol. 134, 1401–1413. Rani, A., Singh, K., Sood, P., Kumar, S., Ahuja, P.S., 2009. p-Coumarate:CoA ligase as a key gene in the yield of catechins in tea [Camellia sinensis (L.) O. Kuntze]. Funct. Integr. Genomics 9, 271–275. Richard, S.B., et al., 2001. Structure of 4-diphosphocytidyl-2-C-methylerythritol synthethase involved in mevalonate-independent isoprenoid biosynthesis. Nat. Struct. Biol. 8, 641–648. Richman, A.S., Gijzen, M., Starratt, A.N., Yang, Z., Brandle, J.E., 1999. Diterpene synthesis in Stevia rebaudiana: recruitment and up-regulation of key enzymes from the gibberellin biosynthetic pathway. Plant J. 19, 411–421. Richman, A., et al., 2005. Functional genomics uncovers three glucosyltransferases involved in the synthesis of the major sweet glucosides of Stevia rebaudiana. Plant J. 41, 56–67. Rohdich, F., et al., 2000a. Biosynthesis of terpenoids: 4-Diphosphocytidyl-2C-methylD-erythritol synthase of Arabidopsis thaliana. Proc. Natl. Acad. Sci. U. S. A. 97, 6451–6456. Rohdich, F., et al., 2000b. Biosynthesis of terpenoids: 4-diphosphocytidyl-2-C-methylD-erythritol kinase from tomato. Proc. Natl. Acad. Sci. U. S. A. 97, 8251–8256. Seemann, M., et al., 2005. Isoprenoid biosynthesis in chloroplasts via the methylerythritol phosphate pathway: the (E)-4-hydroxy-3-methylbut 2-enyl diphosphate synthase (GcpE) from Arabidopsis thaliana is a [4Fe-4S] protein. J. Biol. Inorg. Chem. 10, 131–137. Shibata, H., Sonoke, S., Ochiai, H., Nishihashi, H., Yamada, M., 1991. Glucosylation of steviol and steviol-glucosides in extracts from Stevia rebaudiana Bertoni. Plant Physiol. 95, 152–156. Shibata, H., Sawa, Y., Oka, T., Sonoke, S., Kim, K.K., Yoshioka, M., 1995. Steviol and steviol-glycoside — glucosyltransferase activities in Stevia rebaudiana Bertoni — purification and partial characterization. Arch. Biochem. Biophys. 321, 390–396. Singh, K., et al., 2004. 26S rRNA-based internal control gene primer pair for reverse transcription-polymerase chain reaction-based quantitative expression studies in diverse plant species. Anal. Biochem. 335, 330–333. Singh, K., et al., 2008. An early gene of the flavonoid pathway, flavanone 3-hydroxylase, exhibits a positive relationship with the concentration of catechins in tea (Camellia sinensis). Tree Physiol. 28, 1349–1356. Singh, K., Kumar, S., Rani, A., Gulati, A., Ahuja, P., 2009a. Phenylalanine ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) and catechins (flavan-3-ols) accumulation in tea. Funct. Integr. Genomics 9, 125–134. Singh, K., et al., 2009b. Differential display mediated cloning of anthocyanidin reductase gene from tea (Camellia sinensis) and its relationship with the concentration of epicatechins. Tree Physiol. 29, 837–846. Starrat, A.N., Kirby, C.W., Pocs, R., Brandle, J.E., 2002. Rebaudioside F, a diterpene glycoside from Stevia rebaudiana. Phytochemistry 59, 367–370. Takahashi, S., Kuzuyama, T., Watanabe, H., Seto, H., 1998. A 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-elythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc. Natl. Acad. Sci. U. S. A. 95, 9879–9884. Takaya, A., et al., 2003. Cloning, expression and characterization of a functional cDNA clone encoding geranylgeranyl diphosphate synthase of Hevea brasiliensis. Biochim. Biophys. Acta 1625, 214–220. Totté, N., Charon, L., Rohmer, M., Compernolle, F., Baboeuf, I., Geuns, J.M.C., 2000. Biosynthesis of the diterpenoid steviol, an ent-kaurene derivative from Stevia rebaudiana Bertoni, via the methylerythritol phosphate pathway. Tetrahedron Lett. 41, 6407–6410. Totté, N., Van den Ende, W., Damme, E.J.M.V., Compernolle, F., Baboeuf, I., Geuns, J.M.C., 2003. Cloning and heterologous expression of early genes in gibberellin and steviol biosynthesis via the methylerythritol phosphate pathway in Stevia rebaudiana. Can. J. Bot. 81, 517–522. Veau, B., Courtois, M., Oudin, A., Chenieux, J.C., Rideau, M., Clastre, M., 2000. Cloning and expression of cDNAs encoding two enzymes of the MEP pathway in Catharanthus roseus. Biochim. Biophys. Acta 1517, 159–163.

Author's personal copy 284

H. Kumar et al. / Gene 492 (2012) 276–284

Verpoorte, R., Van der Heijden, R., Moreno, P.R.H., 1997. Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus cells. In: Geoffrey, A.C. (Ed.), The Alkaloids: Chemistry and Pharmacology. Academic Press, New York, pp. 221–229. Yi, H.C., Joo, S., Nam, K.H., Lee, J.S., Kang, B.G., Kim, W.T., 1999. Auxin and brassinosteroid differentially regulate the expression of three members of the 1-aminocyclopropane-1-

carboxylate synthase gene family in mung bean (Vigna radiata L.). Plant Mol. Biol. 41, 443–454. Zeneli, G., Krokene, P., Christiansen, E., Krekling, T., Gershenzon, J., 2006. Methyl jasmonate treatment of mature Norway spruce (Picea abies) trees increases the accumulation of terpenoid resin components and protects against infection by Ceratocystis polonica, a bark beetle-associated fungus. Tree Physiol. 26, 977–988.