A 63 kDa VSP9B10A-like protein expressed in a C-8 Giardia duodenalis Mexican clone

Archives of Medical Research 35 (2004) 199–208

ORIGINAL ARTICLE

A 63 kDa VSP9B10A-Like Protein Expressed in a C-8 Giardia duodenalis Mexican Clone Rosa Marı´a Bermu´dez-Cruz,a Guadalupe Ortega-Pierres,a Vı´ctor Ceja,a Ramo´n Coral-Va´zquez,a,b Rocı´o Fonseca,a Lourdes Cervantes,a Alejandra Sa´nchez,a Francisco Depardo´n,a George Newportc and Cecilia Montan˜e´za a

Departamento de Gene´tica y Biologı´a Molecular, Centro de Investigacio´n y de Estudios Avanzados del Instituto Polite´cnico National (Cinvestav del IPN), Mexico City, Mexico b Unidad de Investigacio´n Me´dica en Gene´tica Humana, Hospital de Pediatrı´a, Centro Me´dico Nacional Siglo XXI (CMN-SXXI), Instituto Mexicano del Seguro Social (IMSS), Mexico City, Mexico c Department of Stomatology, University of California at San Francisco (UCSF), San Francisco, CA, USA Received for publication October 14, 2003; accepted December 10, 2003 (03/170).

Background. It is well documented that Giardia duodenalis undergoes surface antigenic variation both in vivo and in vitro. Proteins involved have been characterized and referred to as VSP (variable surface protein). Methods. Two cloned cDNA inserts of 0.45 and 1.95 kb were obtained from G. duodenalis expression library and sequenced. Comparison sequence analyses were made against Genbank. PCR analysis was performed on G. duodenalis isolates to identify isolates bearing genes encoding such a peptide. Specific antiserum was prepared against 450-bp encoded peptide and tested by Western blot, immunofluorescence, and inhibition of adhesion of G. duodenalis to target cells. Results. We cloned and characterized a G. duodenalis 450-bp DNA fragment; its DNA sequence analysis revealed that this fragment displayed 99% identity with vsp9B10A gene. Predicted amino acid sequence for this fragment also had significant (99%) identity to VSP9B10A. A second 1.95-kb insert, which encompassed the 450-bp cDNA fragment, was also isolated; its DNA and amino acid sequence displayed 99.5% identity with vsp9B10A gene and 99.2% with the corresponding inferred protein, respectively. This inferred protein contained 24 Cys-X-X-Cys motifs and long ORF of 642 aminoacids. PCR analysis showed that DNA sequence encoding a fragment of this gene was present in P1, CIEA:0487:2-C-8 clone and in INP:180800-B2 G. duodenalis human isolates, while it was absent in sheep isolate of G. duodenalis INP:150593-J10. Conclusions. Immunofluorescence analysis using antibodies raised against the peptide encoded by 450-bp fragment showed that expression of this epitope varies on trophozoite surface of the C-8 Mexican clone and is involved in parasite adhesion to target epithelial cells. 쑖 2004 IMSS. Published by Elsevier Inc. Key Words: Adhesion, Antigenic variation, Cysteine-rich variable surface protein, Giardia duodenalis.

Introduction The protozoan parasite Giardia duodenalis, which shares prokaryotic and eukaryotic features (1,2), is a major cause

Address reprint requests to: Cecilia Montan˜e´z, Ph.D., Departamento de Gene´tica y Biologı´a Molecular, Cinvestav del IPN, Apdo. Postal 14-170, 07360 Me´xico, D.F., Me´xico. Phone: (⫹52) (55) 5061-3334; FAX: (⫹52) (55) 5747-7100; E-mail: [email protected]

0188-4409/04 $–see front matter. Copyright d o i : 1 0 .1 0 16 / j . a rc m e d .2 00 3 .1 2 .0 05

of human diarrhea in underdeveloped countries; in addition, epidemic outbreaks of giardiasis have been reported in developed countries (3–5). This parasite inhabits small intestine of humans as well as of many other mammals. Clinical manifestations of infections are highly variable, the majority of individuals remaining asymptomatic. In symptomatic patients, duration of infection can last from weeks to years and several reports indicated that immunity to the parasite developed after primary infection (6).

쑖 2004 IMSS. Published by Elsevier Inc.

200

Bermu´dez-Cruz et al. / Archives of Medical Research 35 (2004) 199–208

Several studies showed that G. duodenalis isolates were heterogeneous and polymorphisms among organisms of this group were identified (1,7,8–11). Significant genetic differences were detected among isolates and changes in surface antigens of this parasite were extensively studied. G. duodenalis isolates and clones from some isolates showed marked surface antigen variability both in vivo and in vitro by switching major surface antigens (12–17). Antigenic variation was shown both by spontaneous appearance of variants in cloned cultures (16,18,19) and by depletion experiments of clones using cytotoxic mAbs and analysis of surviving trophozoites (20,21). In experimental infections of humans (18), gerbils (22), and neonatal mice (23) with clones of G. duodenalis, initial variable surface protein (VSP) was lost and replaced by a heterologous mixture of variable specific surface proteins (12,13). Recently, this switching was observed on the surface of G. duodenalis where VSP1267 antigen was initially expressed and then replaced by VSP9B10A. Although dual expression was observed only as a transient process in this report (17), simultaneous expression of VSP9B10B and VSP1267 was recently reported (24). Experimental infections in the mother/offspring mouse system demonstrated that surface antigen alterations within parasite populations were initiated upon antibody production in response to parasite infections (23). Additionally, nonimmunologic factors such as intestinal proteases may interfere in the process of antigen variation in that they favored proliferation of these variant antigen-type populations that resisted hostile physiologic conditions within intestine (25). Proteins involved in antigenic variation referred to as VSPs [also known as cysteine-rich proteins (CRP)] are antigenically distinct and cover the surface of the parasite (14,18,26). Interestingly, approximately 2.4% of a sampling of the Giardia genome were vsp genes (24,27). VSPs are sparsely glycosylated, cysteine-rich, unique proteins with molecular weights documented from 22.3 kDa to ⬎200 kDa and are immunologically different. Number of VSPs per Giardia genome was estimated as at least ca. 150 by two independent methods (24). Sequences of VSPs reported revealed a family of cysteine-rich (11–12%) proteins (CRP) that characteristically contained Cys-X-X-Cys motifs. All VSPs had a well-conserved hydrophobic tail of approximately 38 amino acids terminated by invariant hydrophilic amino acids CRGKA (24). Function of VSPs is unknown; however, it was speculated that cysteines were not reactive without reduction and probably existed as disulfide bonds; this accounted for high resistance of the majority of VSPs to effects of intestinal proteases (24), which would allow the trophozoite to thrive in small intestine. Also, by binding Zn2⫹ or other metals in intestine, VSPs may contribute to Zn2⫹ malnutrition or inhibition of metal-dependent intestinal enzymes, which would lead to malabsorption, a well-known consequence of giardiasis (28).

In this work we cloned a G. duodenalis 450-bp DNA fragment, which is part of a 1.95-kb DNA clone. Both DNA fragments and predicted peptides shared characteristics with VSP genes and displayed significant identity with the recently described VSP9B10A G. duodenalis surface antigen (17). Expression of the peptide encoded by the 450-bp fragment varied on the surface of the CIEA:0487:02-C-8 Mexican clone. This epitope was involved in adherence of parasite to target epithelial cells.

Materials and Methods Growth of parasites. G. duodenalis Portland 1 (P1) and WB trophozoites were obtained from E. Weinbach (National Institutes of Health, Bethesda, MD, USA). G. duodenalis clone C-8 was obtained by limiting dilution from isolate CIEA:0487:2, which originated from a 4-year-old Mexican symptomatic patient (29). Axenic isolates of G. intestinalis— INP:150593-J10 [human isolate] (30) and INP:180800-B2 [sheep isolate]—were established at the Instituto Nacional de Pediatrı´a (INP) in Mexico City. Trophozoites were axenically cultured under anaerobic conditions at 37⬚C in Diamond’s modified TYI-S-33 medium (31) supplemented with 10% heat-inactivated calf serum and antibiotics (penicillin and streptomycin at 250 µg/mL). Cells were harvested in logarithmic phase by centrifugation at 250 × g for 10 min and washed three times with phosphate buffered saline pH 7.2 (PBS). The pellet from the final wash was suspended in a small volume of 10 mM TRIS pH 8.1, 25 mM NEM (N-ethylmaleimide), and 1 mM PMSF (phenylmethyl-sulfonylfluoride). Soluble extracts were obtained by sonication using 0.4% Triton X-100 as solubilizing agent and protein determination was performed by modified Lowry method (32). Isolation of clones from an expression library. A cDNA expression library in λgt11 was obtained after RNA isolation from G. duodenalis P1 according to the method previously described (33). Giardia trophozoites were disrupted with a Tenbroek tissue grinder containing 4 M guanidine isothiocyanate/20 mM sodium acetate (pH 5.2)/1 mM mercaptoethanol/0.5% sarcosyl and centrifuged over a cushion of 5.7 M CsCl for 12 h (34). The pellet was resuspended in water, and polyA⫹ RNA was selected by passage over an oligodT column. Blunt-ended cDNAs were synthesized according to the method of Gubler and Hoffman (35), incubated with EcoRI methylase, then ligated to excess EcoRI linkers and digested with EcoRI. cDNAs were cloned into EcoRI site of bacteriophage lambda gt11. After in vitro packaging of cDNAs into phage, recombinants were plated on Escherichia coli Y1088 (36), yielding approximately 150,000 plaques that were amplified and maintained as liquid stocks. Recombinant clone λgt11VSP63-1 was identified by using a rabbit polyclonal antiserum against surface antigens of G. duodenalis P1 strain as previously described (37).

Giardia duodenalis 63 kDa VSP9B10A-Like Protein

DNA cloning and sequencing. Cloned 0.45-kb cDNA insert of G. duodenalis λgt11VSP63-1 was excised using EcoR1 and subcloned into Bluescript SK vector. DNA sequence of VSP63-1 fragment was performed on double-stranded template using protocol for DNA sequencing by chain termination method (38) and Sequenase 2.0 (U.S. Biochemical, Cleveland, OH, USA). DNA and inferred amino acid sequences were analyzed and compared using the programs FASTA (39), BLAST 2.0.11 (40), and LALIGN (41). A second clone, VSP63-2 (1.95-kb) was obtained after screening the expression library mentioned previously by hybridization with 32P-labeled cDNA insert of VSP63-1 clone. This 1.95-kb cDNA fragment was subcloned and sequenced as previously described for VSP63-1 clone using AmpliTaqTM DNA polymerase (PE Applied Biosystems, Foster City, CA, USA). Isolation of fusion proteins. Lac Z fusion protein (rVSP631) was obtained after infection of 20 mL of E. coli Y1090 with λgt11VSP63-1. Cultures were grown overnight in Luria broth (50 µg/mL ampicillin) using 5 × 108 phages/mL to infect bacteria. Induction was performed by adding IPTG to a final concentration of 2 mM and incubating for an additional 5–6 h at 40⬚C. Extracts were obtained and bacterial proteins from cultures were separated in 7.5% PAGE-SDS gels according to Laemmli (42). The polypeptide represented by 137 kDa band was excised after matching an unstained gel with a Coomassie blue (Bio Rad, Hercules, CA, USA)-stained section. This polypeptide was electroeluted, homogenized, and injected into mice. The polypeptide was specifically recognized by rVSP63-1-specific antibodies by Western blot. Production of antisera against fusion peptide. An antiserum against rVSP63-1 was raised in BALB/c mice. Mice were injected intraperitoneally (i.p.) with the electroeluted 137 kDa (rVSP63-1) protein previously excised from the gel (approximately 3–4 µg per mouse). Mice were boosted i.p. four times 1 week apart with a similar dose and were bled 7 days after final immunization. Reactivity of immune mouse sera was determined by ELISA (43). Western blot. Extracts of G. duodenalis C-8 trophozoites prepared as described (44) were subjected to electrophoresis in SDS on 7% polyacrylamide gels and resolved polypeptides were transferred to nitrocellulose. Immunoblotting was performed as previously described (45). A serum against βgalactosidase was used as control at 1:60 dilution. DNA purification. Trophozoites from axenic cultures were washed in HBSS (pH 7.5), concentrated, and incubated overnight at 42⬚C in a lysis solution (10 mM Tris-HCl, pH 7.4; 10 mM EDTA; 150 mM NaCl; 0.4% sodium dodecylsulfate, and 200 µg/mL proteinase K). The lysate was treated with phenol/chloroform (1:1) and nucleic acids were precipitated with 0.3 M sodium acetate pH 7 and ethanol at ⫺20⬚C and then dissolved in 10 mM Tris-HCl, 1 mM EDTA (pH

201

8.0). RNA was removed by incubating with 20 µg/mL RNase A at 37⬚C for 30 min and DNA was re-extracted with phenol. DNA was again precipitated in ethanol and finally redissolved in 10 mM Tris-HCl pH 8.0, 1 mM EDTA. PCR amplification. Specific oligonucleotides 5′ CTGCACTGCACTCGGTGTAAC 3′ and 5′ GGAGCCTCTACTTGGCAGGTA 3′ were designed based on vsp9B10A DNA gene sequence and purchased from GIBCO. These oligos were used to amplify a 1283-bp segment from vsp9B10A gene. PCR reaction was performed in a Perkin Elmer model 2400 thermocycler using 50 µL reaction mixtures containing 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.2 mM dATP, dGTP, dCTP, and dTTP, 5′ and 3′ primers (each 0.25 µM), 100 ng of Giardia DNA, and 1.5 U of Taq DNA polymerase (TaqGold, Perkin Elmer Co., Boston, MA, USA). Reactions involved an initial 3-min denaturation at 94⬚C followed by 30 cycles comprising 1 min at 94⬚C, 1 min at 55⬚C, and 1 min at 72⬚C, and a final 7-min extension step at 72⬚C. A control lacking template DNA was included in the experiment. Amplification products were identified after electrophoresis in 1% agarose gels (Tris-Borate-EDTA buffer) and staining with ethidium bromide (0.5 µg/mL). Phage ΦX174 Hae III restriction fragments (BoehringerMannheim, Mannheim, Germany) were used as size markers. Immunofluorescence assays. Immunofluorescence assays were performed using trophozoites of clone C-8 of G. duodenalis according to Riggs et al. (46). [rVSP63-1]-specific antibody was used at 1:50 dilution and incubated with formaldehyde fixed trophozoites at room temperature (approximately 22⬚C) for 30 min in presence of 10% bovine serum. Antiserum against λgt11 was also used as negative control. Afterward, trophozoites were washed by centrifugation and incubated with 1:1,000 dilution of goat anti-mouse Igcoupled to FITC. Fluorescent cells were visualized using a Zeiss (Mexico City, Mexico) optical microscope equipped with an epifluorescence system. C8 and other clones were derived from the same parental and because the latter did not express VSP63 they were also used as negative control (data not shown). Adhesion inhibition assay. Effect of anti-[rVSP63-1] mouse serum on adhesion of C-8 trophozoites to Madin–Darby canine kidney (MDCK) cells was examined using in vitro adhesion assay. In this, 7.5 × 105 trophozoites from clone C-8 previously shown to bear vspB910A-like gene and to display surface epitopes similar to the fusion peptide (by indirect immunofluorescence) were labeled for 48 h with 3 H thymidine and incubated with 1:5 dilution of anti-βgalactosidase or [rVSP63-1]-specific antibodies at room temperature for 30 min. Then, trophozoites were added to confluent MDCK cell monolayers grown in 2-cm2 wells and cultures were incubated for 2 h at 37⬚C in a 5% CO2 atmosphere. Subsequently, radioactivity was determined as

202

Bermu´dez-Cruz et al. / Archives of Medical Research 35 (2004) 199–208

TCA-precipitable material of nonadherent trophozoites harvested on a 3 MM Whatman filter paper as described (47). Adhesion inhibition was determined as percentage of TCAprecipitable cpm in nonadherent trophozoites with regard to total number of TCA-precipitable cpm. To verify total cpm, adherent trophozoites were washed with 200 µL of cold PBS and then incubated 1 h at 4⬚C to obtain TCA-precipitable material and cpm were determined. Net inhibition was determined by subtracting nonspecific inhibition in presence of anti-β-galactosidase serum from this inhibition obtained in presence of [rVSP63-1]-specific antibodies.

Results cDNA clone-encoding part of a trophozoite surface protein. Clone λgt11VSP63-1 was identified within the Giardia cDNA λgt11 expression library by immunoblotting using rabbit antiserum raised against P1 isolate surface antigens. This antiserum recognized antigens from P1 G. duodenalis with molecular weights of approximately 65, 55, and 40 kDa by Western blot analysis (data not shown). Nucleotide sequence of cloned 0.45-kb cDNA insert was determined after subcloning it in a Bluescript plasmid (Figure 1A). VSP63-1 sequence was 60% G/C and encoded a hydrophilic

Figure 1. A) Homology between VSP63-2 clone and vsp9B10A gene DNA. VSP63-2 sequence is placed on bottom strand, while vsp9B10A gene sequence is above it. Symbol “:” indicates identity. Region where VSP63-1 clone is located is shown by highlighting (EMBL nucleotide sequence database accession number AJ320503). Differences in nucleotide sequence from VSP9B10A can be found by lack of the symbol “:”; *** indicates location of translation initiation codon; ••• indicates location of translation termination codon. Arrows mark position of specific primers for vsp9B10A gene used for PCR assay; B) Nucleotide and predicted amino acid sequence of Giardia duodenalis VSP63-2 cDNA fragment (EMBL nucleotide sequence database accession number AJ457171). Sequence shown is right after EcoRI site. Predicted amino acid sequence is shown below nucleotide sequence. C-X-X-C motifs are indicated in bold.

Giardia duodenalis 63 kDa VSP9B10A-Like Protein

203

Figure 1. Continued.

peptide 149 amino acids long. Recombinant phage expressed a fusion protein of approximately 137 kDa (data not shown). Inferred peptide sequence contained cysteine residues and displayed characteristic C-X-X-C motifs of VSP (Figure 1B, motifs in bold). It was also rich in alanine and glutamic acid, while tryptophan was not found in the sequence. Comparison of VSP63-1 sequence to these G. duodenalis DNA sequences contained in the GenBank database showed closest similarity to Giardia cysteine-rich VSP genes. Among these, the most closely related nucleotide sequence was found with VSP9B10A (17) (99.5% identity) (Figure 1A), VSP9B10B (24) (89.98%), tsa417-2 (48,49) (67.6% identity), and tsa417-1 (50) (58.98% identity) G. duodenalis major surface antigens. To identify a cDNA clone representing a more complete portion of the coding sequence of the parent gene, VSP63-1 insert was used as a probe to re-screen the G. duodenalis cDNA library. Thus, a second clone was identified and designated as VSP63-2. This clone contained a 1.95-kb cDNA insert. After DNA sequence was determined, it was compared with vsp9B10A gene sequence and high identity (99.5%) was also found (Figure 1A). VSP63-1 is part of VSP63-2 (Figure 1A), which suggests that VSP63-1 and VSP63-2 inserts may represent overlapping parts of the same gene. A potential translation initiation codon was found at position 44 (position 44 corresponded to position 804 in

VSP9B10A); however, because N-terminal segment required for protein translocation was absent, clone VSP63-2 might be an internal part of a vsp9B10A-like gene. An open reading frame expanding 1930 bp and beginning at position 1 was obtained. A termination codon was located at position 1930, allowing expression of a 642-amino acid peptide with 99.2% identity with VSP9B10A-inferred protein sequence, this sequence containing 24 C-X-X-C motifs (Figure 1B). VSP63-2 sequence contained nine differences from vsp9B10A gene sequence; however, these were changes and not deletions or insertions (Figure 1A, see Legend) and only five differences were found in inferred protein sequence (Figure 1B). Due to high homology with VSP9B10A, VSP63 could be a vsp9B10A-like gene or at least part of vsp9B10A gene. vsp9B10A DNA is not present in all G. duodenalis isolates. To determine whether a VSP9B10A-like sequence is present in several G. duodenalis isolates, PCR amplification reaction using specific primers for vsp9B10A gene (location of these primers is shown in Figure 1A) was performed using DNA from G. duodenalis human isolates and clones WB, P1, CIEA:0487:2-C-8, INP:150593-J10, and G. duodenalis sheep isolate INP:180800-B2. Figure 2 shows results of PCR amplification of the vsp9B10A-like gene fragment from plasmid pVSP63-2 (control), and isolates P1, C-8, WB,

204

Bermu´dez-Cruz et al. / Archives of Medical Research 35 (2004) 199–208

Figure 2. PCR amplification of vsp9B10A-like gene segments from G. duodenalis isolates genomic DNA. PCR amplification products from vsp9B10A-like gene were resolved in a 1% agarose gel stained with ethidium bromide. Negative image of the gel is shown. PCR products from plasmid pVSP63-2 (lane 1) and DNA from P1 (lane 2), C-8 (lane 3), WB (lane 5), B2 (lane 6), and J10 (lane 7) G. duodenalis isolates and clones are shown. Arrowhead indicates 1283-bp specific fragment for vsp9B10A gene. Numbers to the right are shown to indicate sizes in bp of Phage ΦX174/Hae III molecular weight markers (lane 4).

INP:180800-B2 (Figure 2, lanes 1–3, 5, 6, respectively), which indicated that these isolates bore a vsp9B10A-like gene. Interestingly, either this sequence was not present in isolate INP:150593-J10 (Figure 2, lane 7) as observed in other isolates where vsp9B10A was not expressed (24), or sequence contained in the primer was not present due to gene polymorphism and therefore no amplification was obtained when PCR was performed. Analysis of epitopes expressed by VSP63. C-8 was cloned from isolate CIEA:0487 obtained from a 4-year-old symptomatic patient, which does bear the vsp9B10A-like vsp63 gene. Therefore, C-8 was used to characterize VSP63encoded protein. Antiserum against (pVSP63-1)-encoded fusion peptide (rVSP63-1) purified by polyacrylamide gel electrophoresis was prepared in mice. This antiserum was tested by Western blot analysis and immunofluorescence analysis using trophozoites of G. duodenalis C-8 clone as described in Materials and Methods. Results of Western blot analysis (Figure 3) showed specific recognition of a 63-kDa G. duodenalis component by [rVSP63-1]-specific antibodies. Due to its VSP features (see later), this protein is referred to as VSP63. Analysis of trophozoites from C-8 clone by indirect immunofluorescence assay using [rVSP63-1]-specific antibodies revealed presence of cells expressing exposed epitopes. This expression was not associated with any condition or

Figure 3. Western blot analysis of G. duodenalis C-8 proteins. Extracts of C-8 clone were obtained as described by Ortega-Pierres et al. (43). [rVSP631]-specific antibody was diluted 1:5 (lane 2) and mouse polyclonal antiserum raised against β-galactosidase diluted at 1:60 (lane 1) was used as control. Molecular weight in kDa of proteins used as standards is shown to the left of the figure.

presence of any specific factor. Antibody reactivity was localized as patches on trophozoite surface (data not shown). Variation in expression of epitopes recognized by [rVSP631]-specific antibodies was observed by indirect immunofluorescence assay during continuous parasite culture. Figure 4 shows percentage of fluorescent cells in parasites tested every 3–4 days for a period of 35 days of continuous culture. Percentage of cells expressing VSP63-1 epitope among trophozoites of G. duodenalis clone C-8 varied from 2 to 90%. Immunofluorescence signal correlated with Western blot results using [rVSP63-1]-specific antibodies where C-8 cultures with 2% of cells expressing VSP63-1 showed no VSP63 corresponding band while those with 67–90% percentage of cells expressed showed a specific VSP63 band. These analyses were performed at 18, 21, and 32 days after cultures were initiated. Control trophozoites showing no reactivity with antiserum raised against VSP63-1 were also included (data not shown). Analysis of the role of VSP63-1 peptide in adhesion of trophozoites to MDCK cells. With the aim to analyze participation of VSP63 epitope in adherence of parasite to epithelial cells, C-8 clone trophozoites with high expression of cloned epitope (69% fluorescent cells) were incubated prior to their interaction with MDCK monolayer cells with a subagglutination dose of antibodies (anti-β-galactosidase or [rVSP63-1]specific antibodies, stippled and stripped bars, respectively) performed as previously reported (47). Figure 5 shows inhibition of adhesion of trophozoites to MDCK cells. There was nonspecific inhibition (24%) by anti-β-galactosidase antibody of adherence of trophozoites to epithelial cells. However, when trophozoites were incubated with [rVSP631]-specific antibodies, higher inhibition (45%) of their adhesion to MDCK cells was observed; therefore, net adhesion

Giardia duodenalis 63 kDa VSP9B10A-Like Protein

205

Figure 4. Kinetics of reactivity of [rVSP63-1]-specific antibodies with trophozoites from clone C-8. Reactivity of C-8 clone cells with [rVSP63-1]-specific antibodies was analyzed at 3- to 4-day intervals during 35 days of culture by indirect immunofluorescence assays. Percentage of fluorescent trophozoites was determined by epifluorescence microscopy. Average percentage obtained in three independent assays at each time point is shown. 䊊 indicates cells labeled with antibody against λgt11 and ■ indicates cells labeled with [rVSP63-1]-specific antibodies.

inhibition was 21% in these assays. The possibility of Giardia-specific antibodies resulting from Giardia infections can be ruled out because control mouse serum did not recognize VSP63 antigen as determined by Western blot (data not shown). Also, control mouse serum was used as negative control and 2% inhibition of adhesion was obtained. Discussion Several microorganisms developed a variety of mechanisms that allowed them to evade host immune response. These

Figure 5. Inhibition of adhesion of G. duodenalis C-8 clone to MDCK cells. Inhibition of adhesion of G. duodenalis C-8 to MDCK cells was performed as indicated in Materials and Methods. Percentage of nonadherent trophozoites under each condition was determined as described in Materials and Methods. Stippled box corresponds to trophozoite cultures incubated with mouse antiserum against β-galactosidase; striped box corresponds to trophozoites incubated with [rVSP63-1]-specific antibodies, as explained in the text. Value reported represents mean value of three independent adhesion assays carried out by duplicate. Error bars indicate 4.5% deviation.

mechanisms included antigenic variation of major surface antigens and it was shown that this antigenic variation was used by various organisms such as African trypanosomes, Plasmodium spp., Neisseria gonorrhea, Borrelia hermsii, and Giardia duodenalis (51). CRVSP genes of Giardia consist of a family of genes encoding cysteine-rich variable surface proteins. Putative roles for these proteins include resistance to proteases, bile salt, and heavy metals and binding to Zn2⫹ (28,52). Polymorphisms in the physical map of cysteine-rich surface protein genes among cloned cell lines were previously described; however, these genes were not present in rearranging Giardia telomeres or polymorphic chromosomes (53,54). G. duodenalis possessed a repertoire of variant specific surface protein (VSP) genes ranging from 133 to 151 (24,55); nonetheless, little is known with regard to organization and mechanisms of expression of CRVSP genes. It was suggested that VSP genes were not telomeric (54,56) and head-to-head orientation of two expression-linked genes was described (56). Recent studies, however, reported a new family of genes encoding cysteine-rich proteins that is located at telomeres of Giardia chromosomes (57,58). Despite this finding, VSP genes were not generally telomeric and apparently no evidence of recombination was documented for VSP relocation to other parts of the genome (2). In this work we cloned two DNA fragments encoding a peptide from G. duodenalis strain P1, which belong to CRVSP gene family based on homology with other VSP genes (mainly vsp9B10A). Clone VSP63-2 encodes a peptide that displays Cys-X-X-Cys motifs and might correspond to an internal segment of VSP9B10A because N-terminal domain required for translocation is absent. Western blot results indicated that antiserum raised in mice against the fusion polypeptide from clone λgt11VSP63-1 reacted with

206

Bermu´dez-Cruz et al. / Archives of Medical Research 35 (2004) 199–208

a protein of 63 kDa from an extract of the G. duodenalis C-8 clone. This clone was shown to bear a vsp9B10A-like gene fragment by PCR analysis. With the aim of obtaining the complete sequence for this gene, VSP63-2 was identified by using VSP63-1 as a probe to screen the Giardia expression library. Clone VSP63-2 sequence was compared to vsp9B10A gene and results suggested that VSP63 could be a VSP9B10A-like protein. Predicted molecular weight corresponding to VSP9B10A was 76 kDa; however, a 68 kDa protein was detected (24), which differed from VSP63 molecular weight (63 kDa). Although this could also be the result of an incomplete denaturation process during SDS electrophoresis, most probably the VSP63-2 clone represents an internal segment of a vsp9B10A-like gene. Interestingly, although there are few changes (nine changes in all) within VSP63 sequence when compared with VSP9B10A sequence, there is no shift of the open reading frame. This finding would suggest that VSP63 might be part of the VSP9B10 gene family. It is noteworthy that the majority of G. duodenalis isolates analyzed in this study did bear a vsp9B10A-like gene, while one did not. It appears that one human isolate tested either does not contain a vsp9B10A-like gene or that this gene has changes in the region where primers bind, resulting in absence of amplification product during PCR. The importance of adherence for survival of G. duodenalis in vivo is dependent on cell attachment abilities because without these the parasite would be swept away by peristaltic movements of intestine. Mechanisms of attachment of trophozoites to intestinal cells have not been established definitively. Evidence supports roles for ventral disk, considered a specific attachment organelle, trophozoite contractile elements, hydrodynamic mechanical forces, and lectin-mediating binding. Ultrastructural studies showed that Giardia attaches to Int-407 (human intestinal cells) monolayer predominantly by its ventral surface probably, as previously reported, through giardins. Int-407 cells contact trophozoites with elongated microvilli, and both trophozoite imprints and interactions of Giardia flagella with intestinal cells were also observed (59). Transmission electron microscopy showed that Giardia lateral crest and ventrolateral flange were important structures in the adherence process. Although a role for VSP in adhesion was not reported previously for Giardia, variable surface proteins from other organisms such as Mycoplasma bovis play a major part as adhesion factors. Competitive adherence assays were performed to analyze Mycoplasma VSP role in adhesion. Specific antibodies against these vsp were analyzed, and it was shown that they also reduced Mycoplasma adhesion (60,61). In this work we present the first evidence that VSP proteins are involved in adhesion of parasite to host cells. We would like to speculate that, meanwhile, VSP9B10B protein is preferentially expressed during encystation process and therefore related with such a process; VSP9B10A,

a protein expressed preferentially in vegetative trophozoite [not present in extracts from cysts (24)] is involved to some extent in adhesion process, this being only a part of this complex event. Although the role of antigenic variation is not known, it is possible that it contributes to survival of the parasite, because a large amount of the organism’s resources are devoted to this. Antibody-mediated inhibition of parasite adhesion suggests that these molecules participate in this phenomenon. Indeed, B-cell mechanisms have been found to play a role in control of the infection. This together with T-cell-mediated responses as well as other factors of host control the outcome of Giardia infections. Additionally, [rVSP63-1]-specific antibody was obtained from G. duodenalis Portland 1 fusion peptide and it recognized a 63 kDa protein in extracts from clone C-8 from CIEA:0487:2 isolate. In addition, the fact that VSP9B10B protein has only been shown as expressed as an encystingrelated protein suggested that most likely [rVSP63-1]-specific antibody recognized only VSP9B10A protein. Further investigation with regard to the role of VSPs in adhesion mechanisms is currently the theme of our work.

Acknowledgments We thank Alison Rattray and Vicky van Santen for critical review of the manuscript. We also thank Adalberto Herrera, Blanca Herrera, and Rene´ Lo´pez for technical assistance.

References 1. Upcroft JA, Upcroft P. My favorite cell: Giardia. Bioessays 1998;20: 256–263. 2. Adam RD. The Giardia lamblia genome. Int J Parasitol 2000;30: 475–484. 3. Wolfe MS. Symptomatology, diagnosis and treatment. In: Erlandsen SL, Meyer EA, editors. Giardia and giardiasis: biology, pathogenesis, and epidemiology. New York: Plenum Press;1984. pp. 147–161. 4. Islam A. Giardiasis in developing countries. In: Meyer EA, editor. Giardia and Giardiasis. New York: Elsevier Science Publishers;1990. pp. 235–266. 5. Tay ZJ, Ruı´z A, Schenone H, Robert L, Sa´nchez-Vega JT, Uribarren T, Becerril MA, Romero R. Frecuencia de las protozoosis intestinales en la Repu´blica Mexicana. Bol Chil Parasitol 1994;49:9–15. 6. Smith PD, Gillin FD, Spira WM, Nash TE. Chronic giardiasis: studies on drug sensitivity, toxin production and host immune response. Gastroenterology 1982;83:797–803. 7. Korman SH, Le Blancq SM, Spira DT, El On J, Reifen RM, Deckelbaum RJ. Giardia lamblia: identification of different strains from man. Z Parasitenkd 1986;72:173–180. 8. Adam RD, Nash TE, Wellems TE. The Giardia lamblia trophozoite contains sets of closely related chromosomes. Nucleic Acids Res 1988;16:4555–4567. 9. Campbell SR, van Keulen H, Erlandsen SL, Senturia JB, Jarroll EL. Giardia sp. comparison of electrophoretic karyotypes. Exp Parasitol 1990;71:470–482. 10. Adam RD, Nash TE, Wellems TE. Telomeric location of Giardia rDNA genes. Mol Cell Biol 1991;11:3326–3330.

Giardia duodenalis 63 kDa VSP9B10A-Like Protein 11. Weiss JB, van Keulen H, Nash TE. Classification of subgroups of Giardia lamblia based upon RNA gene sequence using the polymerase chain reaction. Mol Biochem Parasitol 1992;54:73–86. 12. Nash TE. Surface antigen variability and variation in Giardia lamblia. Parasitol Today 1992;8:229–234. 13. Nash TE. Antigenic variation in Giardia lamblia and the host’s immune response. Phil Trans R Soc Lond B Biol Sci 1997;352:1369–1375. 14. Nash TE. Surface antigenic variation in Giardia lamblia. Mol Microbiol 2002;45(3):585–590. 15. Aggarwal A, Nash TE. Antigenic variation of Giardia lamblia in vivo. Infect Immun 1988;56:1420–1423. 16. Herna´ndez J. Identificacio´n de una mole´cula de superficie de G. lamblia de 200 kDa y su participacio´n en el feno´meno de adherencia. Ph.D. thesis. Me´xico, D.F.: Escuela Nacional de Ciencias Biolo´gicas (ENCB) del IPN:1992. 17. Nash TE, Luja´n HT, Mowatt MR, Conrad JT. Variant-specific surface protein switching in Giardia lamblia. Infect Immun 2001;69:1922– 1923. 18. Nash TE, Conrad JT, Merrit JW Jr. Variant specific epitopes of Giardia lamblia. Mol Biochem Parasitol 1990;42:125–132. 19. Enciso JA, Fonseca R, Argu¨ello-Garcı´a R, Cedillo R, Ortega-Pierres MG. Recurrent variation of surface antigens in clones of Giardia. The 38th Annual Meeting of the American Society of Tropical Medicine and Hygiene. Honolulu, Hawaii, USA, 1989. 20. Nash TE, Aggarwal A, Adam RD, Conrad JT, Merrit JW Jr. Antigenic variation in Giardia lamblia. J Immunol 1988;141:636–641. 21. Aggarwal A, Merritt JW Jr, Nash TE. Cysteine rich variant surface proteins of Giardia lamblia. Mol Biochem Parasitol 1989;32:39–47. 22. Aggarwal A, Nash TE. Comparison of two antigenically distinct Giardia lamblia isolates in gerbils. Am J Trop Med Hyg 1987;36:325–332. 23. Sta¨ger S, Gottstein B, Sa¨ger H, Jungi TW, Mu¨ller N. Influence of antibodies in mother’s milk on antigenic variation of Giardia lamblia in the murine mother-offspring model of infection. Infect Immun 1998;66:1287–1292. 24. Carranza PG, Feltes G, Ropolo A, Quintana SMC, Touz MC, Luja´n HD. Simultaneous expression of different variant-specific surface proteins in single Giardia lamblia trophozoites during encystations. Infect Immun 2002;70:5265–5268. 25. Mu¨ller N, Gottstein B. Antigenic variation and the murine immune response to Giardia lamblia. Int J Parasitol 1998;28:1829–1839. 26. Ungar BL, Nash TE. Cross-reactivity among different Giardia lamblia isolates using immunofluorescence antibody and enzyme immunoassay techniques. Am J Trop Med Hyg 1987;37:283–289. 27. Smith MW, Aley SB, Sogin M, Gillin FD, Evans GA. Sequence survey of the Giardia lamblia genome. Mol Biochem Parasitol 1998;95: 267–280. 28. Nash TE, Mowatt MR. Variant-specific surface proteins of Giardia lamblia are zinc-binding proteins. Proc Natl Acad Sci USA 1993;90: 5489–5493. 29. Cedillo-Rivera R, Enciso-Moreno JA, Martı´nez-Palomo A, OrtegaPierres G. Isolation and axenization of Giardia lamblia isolates from symptomatic and asymptomatic patients in Mexico. Arch Med Res 1991;22:79–85. 30. Ponce-Macotela M, Martı´nez-Gordillo M, Bermu´dez-Cruz R, OrtegaPierres G, Salazar-Schettino PM, Ey P. Unusual prevalence of the Giardia intestinalis AII subtype amongst isolates from human and domestic animals in Mexico. Int J Parasitol 2002;32:1201–1202. 31. Keister DB. Axenic culture of Giardia lamblia in TSY-S-33 medium supplemented with bile. Trans R Soc Trop Med Hyg 1983;77:487–488. 32. Dulley JR, Grieve PA. A simple technique for eliminating interference by detergents in the Lowry method of protein determination. Anal Biochem 1975;64:136–141. 33. Brawerman G. The isolation of messenger RNA from mammalian cells. In: Moldare K, Grossman L, editors. Methods in enzymology. New York: Academic Press;1974. pp. 605–612.

207

34. Chirgwing JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979;18:5294–5299. 35. Gubler U, Hoffman B. A simple and very efficient method for generating cDNA libraries. Gene 1983;25:263–269. 36. Young RA, Davis RW. Efficient isolation of genes by using antibody probes. Proc Natl Acad Sci USA 1983;80:1194–1198. 37. Huynh TV, Young RA, Davis RW. Construction and screening cDNA libraries in Lambda gt10 and Lambda gt11. In: Glover DM, editor. DNA cloning, a practical approach. Oxford, UK: IRL Press, Ltd.;1985. p. 49. 38. Sanger FS, Nicklen S, Coulson AR. DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 1977;74:5463–5467. 39. Pearson WR, Lipman DJ. Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 1988;85:2444–2448. 40. Altschul SF, Madden LM, Shaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389– 3402. 41. Pearson WR, Wood T, Zhang Z, Miller W. Comparison of DNA sequences with protein sequences. Genomics 1997;46:24–36. 42. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–685. 43. Engvall E, Perlmann P. Enzyme-linked immunosorbent assay (ELISA). III. Quantitation of specific antibodies by enzyme-labeled and immunoglobulin in antigen-coated tubes. J Immunol 1972;109:129–135. 44. Ortega-Pierres G, Lascura´in R, Argu¨ello-Garcı´a R, Coral-Va´zquez R, Acosta G, Santos JI. In: Wallis PM, Hammond R, editors. The response of humans to antigens of Giardia lamblia. Advances in Giardia research. Calgary, Alberta, Canada: University of Calgary Press;1988. pp. 177–180. 45. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 1979;76:4350–4354. 46. Riggs JL, Dupuis KW, Nakamura K, Spath DP. Detection of Giardia lamblia by immunofluorescence. Appl Environ Microbiol 1983;45: 698–700. 47. Kobiler D, Mirelman D. Adhesion of Entamoeba histolytica to monolayers of human cells. J Infect Dis 1981;144:539–546. 48. Ey PL, Andrews RH, Mayrhofer G. Differentiation of major genotypes of G. intestinalis by polymerase chain reaction analysis of a gene encoding a trophozoite surface antigen. Parasitology 1993;106:347– 356. 49. Ey PL, Khanna K, Manning PA, Mayrhofer G. A gene encoding a 69kilodalton major surface protein of G. intestinalis trophozoites. Mol Biochem Parasitol 1993;58:247–257. 50. Gillin FD, Hagblom P, Harwood J, Aley SB, Reiner DS, McCafferty M, So M, Guiney DG. Isolation and expression of the gene for a major surface protein of Giardia lamblia. Proc Natl Acad Sci USA 1990;87:4463–4467. 51. Lanzer M, Fischer K, Le Blancq SM. Parasitism and chromosome dynamics in protozoan parasites; is there a connection? Mol Biochem Parasitol 1995;70:1–8. 52. Chen N, Upcroft JA, Upcroft P. A new cysteine-rich protein-encoding gene family in Giardia duodenalis. Gene 1996;169:33–38. 53. Le Blancq SM, Korman SH, van Der Ploeg L. Frequent rearrangements of rRNA-encoding chromosomes in Giardia lamblia. Nucleic Acids Res 1991;19:4405–4412. 54. Yang YM, Adam RD. A group of Giardia lamblia variant-specific protein (VSP) genes with nearly identical 5′ regions. Mol Biochem Parasitol 1995;75:69–74. 55. Nash TE, Mowatt MR. Characterization of a Giardia lamblia variantspecific surface protein (VSP) gene from isolate GS/M and estimation

208

Bermu´dez-Cruz et al. / Archives of Medical Research 35 (2004) 199–208

of the VSP gene repertoire size. Mol Biochem Parasitol 1992;51: 219–227. 56. Adam RD, Yang YM, Nash TE. The cysteine-rich protein gene family of Giardia lamblia; loss of CRP gene in an antigenic variant. Mol Cell Biol 1992;12:1194–1201. 57. Upcroft P, Chen N, Upcroft JA. Telomeric organization of a variable and inducible toxin gene family in the ancient eukaryote Giardia duodenalis. Genome Res 1997;7:37–46. 58. Upcroft P, Upcroft J. Organization and structure of the Giardia genome. Protist 1999;150:17–23.

59. Sousa MC, Goncalves CA, Bairos VA, Poiares-Da-Silva J. Adherence of Giardia lamblia trophozoites to Int-407 human intestinal cells. Clin Diagn Lab Immunol 2001;8(2):258–265. 60. Sachse K, Grajetzki C, Rosengarten R, Hanel I, Heller M, Pfutzner H. Mechanisms and factors involved in Mycoplasma bovis adhesion to host cells. Zentralbl Bakteriol 1996;284:80–92. 61. Sachse K, Helbig JH, Lysnyansky I, Grajetzki C, Muller W, Jacobs E, Yogev D. Epitope mapping of immunogenic and adhesive structures in repetitive domains of Mycoplasma bovis variable surface lipoproteins. Infect Immun 2000;68(2):680–687.