Molecular evidence for long distance dispersal across the Southern Hemisphere in the Ganoderma applanatum-australe species complex (Basidiomycota)

mycological research 112 (2008) 425–436

journal homepage: www.elsevier.com/locate/mycres

Molecular evidence for long distance dispersal across the Southern Hemisphere in the Ganoderma applanatum-australe species complex (Basidiomycota) Jean-Marc MONCALVOa,b,*, Peter K. BUCHANANc a

Department of Natural History, Royal Ontario Museum, 100 Queen’s Park, Toronto, Ontario M5S 2C6, Canada Department of Ecology and Evolutionary Biology, University of Toronto, 100 Queen’s Park, Toronto, Ontario M5S 2C6, Canada c Landcare Research, Private Bag 92170, Auckland, New Zealand b

article info

abstract

Article history:

We examined phylogeographic relationships in the cosmopolitan polypore fungus Gano-

Received 20 February 2007

derma applanatum and allies, and conservatively infer a possible age of origin for these

Received in revised form

fungi. Results indicate that it is very unlikely that members of this species complex diver-

19 November 2007

sified before the break-up of Gondwana from Laurasia ca 120 M years ago, and also before

Accepted 11 December 2007

the final separation of the Gondwanan landmasses from each other that was achieved

Corresponding Editor:

about 66 M years ago. An earliest possible age of origin of 30 M years was estimated from

H. Thorsten Lumbsch

nucleotide substitution rates in the 18S rDNA gene. Phylogenetic reconstruction of a worldwide sampling of ITS rDNA sequences reveals at least eight distinct clades that are strongly

Keywords:

correlated with the geographic origin of the strains, and also correspond to mating groups.

Divergence time

These include one Southern Hemisphere clade, one Southern Hemisphere–Eastern Asia

Endemism

clade, two temperate Northern Hemisphere clades, three Asian clades, and one neotropical

Gondwana

clade. Geographically distant collections from the Southern Hemisphere shared identical

Internal transcribed spacer (ITS)

ITS haplotypes, and an ITS recombinant was noted. Nested clade analysis of a parsimony

Mating

network among isolates of the Southern Hemisphere clade indicated restricted gene flow

Nested clade analysis

with isolation-by-distance among the New Zealand, Australia–Tasmania, Chile–Argentine,

Parsimony network

and South Africa populations, suggesting episodic events of long-distance dispersal within

Vicariance

the Southern Hemisphere. This study indicates that dispersal bias plays a more important role than generally admitted to explain the Southern Hemisphere distribution of many taxa, at least for saprobic fungi. ª 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction The Southern Hemisphere endemism of many organisms has been largely interpreted as a consequence of the separation of the Gondwana and Laurasia landmasses that took place about 120 M years ago (Raven & Axelrod 1974; Raven 1979; Keast 1981; Ladiges et al. 1991), and subsequent separation of the

different Gondwanan fragments that was achieved about 66 M years ago (White 1990). One of the most cited examples to support this view is that of the vicariant distribution of the Southern Hemisphere beech, Nothofagus, whose phylogeny supports the sequence of Gondwana break-up (Swenson et al. 2001). However, long-distance dispersal of Nothofagus has been recently suggested (Knapp et al. 2005), and it was

* Corresponding author. Department of Natural History, Royal Ontario Museum, 100 Queen’s Park, Toronto, Ontario M5S 2C6, Canada. E-mail address: [email protected] 0953-7562/$ – see front matter ª 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.mycres.2007.12.001

426

also shown that geographic patterns in the plant family Proteaceae was not fully congruent with the timing of the break-up of Gondwana (Barker et al. 2007). Overall, there is now increasing evidence from molecular phylogenetic studies that dispersal may play a much greater role in the observed endemism of Southern Hemisphere taxa than generally assumed (Sanmartin & Ronquist 2004; McGlone 2005; Moreira-Mun˜oz 2007), and directional asymmetry of long-distance dispersal has been shown (Cook & Crisp 2005). A recent and remarkable example of the occurrence of extreme long-distance dispersal in plants is from the rainforest tree Ceiba pentandra (Malvaceae), which is naturally widespread across equatorial Africa and the Neotropics, and exhibits shared haplotypes in populations on both continents (Dick et al. 2007). Mycologists have historically embraced the classic view of tectonic hypotheses to explain the observed Southern Hemisphere endemism of many fungi (Korf 1983; Horak 1981, 1983; Moyersoen et al., 2003; Walker 1996). Notable examples of mushrooms endemic to Gondwana include the Nothofagus-associated Cyttaria, and many members of the ectomycorrhizal genera Descolea, Amanita, and Cortinarius (including its synonyms Rozites and Thaxterogaster; Peintner et al. 2001, 2002a, b). However, fungal endemism in the Southern Hemisphere is generally observed at the species level, not at the generic level. This poses interesting questions about speciation rates and dispersal in fungi. Fungi have airborne spores and are, therefore, believed to have fewer barriers to dispersal than other organisms. However, many fungal species are geographically restricted. It has been suggested that fungi with limited distribution are climate dependent or are restricted to certain hosts as specialized parasites or symbionts (Ryvarden 1991; Bisby 1933; Korf 1983; Horak 1981, 1983). However, because many fungal taxa show no climatic or host dependence (e.g. most saprophytic species), or have a wide range of hosts, but have not followed them everywhere, it can also be assumed that other biological, physical, or historical factors control their distribution. Molecular phylogenetic studies are revealing that many fungal groups have a distribution that corresponds to geography (e.g. Vilgalys & Sun 1994; O’Donnell et al. 1998, 2000; Coetzee et al. 2000, 2001a, b; James et al. 2001; Isikhuemhen et al. 2000; Geml et al. 2006), and closer examination of taxa considered to be widespread often results in the recognition of allopatric, cryptic sibling species (e.g. Buchanan 1998; Goodwin et al. 1999; Zervakis et al. 2004). In these studies and others, the observed biogeographic patterns are generally explained by continental drift, geological barriers, and host restriction rather than by dispersal biases. In cases where Southern Hemisphere fungi are the same as taxa originally known only from the Northern Hemisphere, human activities are invoked to suggest recent introduction (Coetzee et al. 2001a, b; Johnston et al. 2006). Overall, although Southern Hemisphere fungi have been relatively well documented morphologically and taxonomically, the origins and evolutionary relationships of most of them have yet to be inferred within a comprehensive molecular phylogenetic context. Here we examined the global phylogeographic structure in the Ganoderma applanatum-australe species complex (Basidiomycota) with the use of nucleotide sequence data from the ITS of the rDNA gene. This is a cosmopolitan and widespread

J.-M. Moncalvo, P. K. Buchanan

group of white-rot polypore fungi that has been reported as pathogens of conifers and angiosperms, including palms (Flood et al. 2000). We used 18S rDNA data to infer whether these fungi are more likely to have diversified before or after the break-up of Gondwana. Members of this species complex are readily identifiable from their overall morphology, but species boundaries are poorly established based on morphology (Moncalvo & Ryvarden 1997) although can be attained by integration of molecular and other data (e.g. Smith & Sivasithamparam 2000a, b, 2003). Here we also conducted a few, preliminary mating studies to examine whether genetic divergence in the G. applanatum-australe species complex can be associated with the development of intersterility.

Materials and methods Strains used Specimens used in this study are listed in Table 1. They represent a broad geographic sampling of 98 cultures and fruit bodies obtained from private collections, herbaria, and culture collection centres, including material used in earlier phylogenetic studies (Moncalvo et al. 1995; Gottlieb et al. 2000). Collections were from angiosperms, conifers, and palms although many had data missing regarding their host. Original identifications include the names Ganoderma australe, G. applanatum, G. lobatum, G. tornatum, G. lipsiensis, G. adspersum, G. gibbosum, and G. philippii (for a taxonomic discussion see Moncalvo & Ryvarden 1997). Voucher material from this study consists of both cultures and dried specimens, and is deposited at Landcare Research, Auckland, New Zealand, the Royal Ontario Museum, Toronto, Canada, or Duke University, NC, USA.

Molecular techniques DNA isolation, PCR amplification, and primers used for fungal amplification and sequencing of the 18S and ITS rDNA were described elsewhere (Moncalvo et al. 1995; Hibbett et al. 1997). Amplified PCR products were purified by microcentrifugation using Ultrafree-MC filters (Millipore, Bedford, MA) and sequenced using fluorescent dye terminator chemistries (Applied Biosystems, Foster City, CA). Sequences were run on ABI automated sequencers and the resulting chromatograms were edited in Sequencher 3.0 (Gene Codes Corp., Ann Arbor, MI). The new sequences produced in this study have been deposited in the GenBank database. ITS accession numbers are listed in Table 1. 18S accession numbers are AF255199 for Amauroderma sp. strain MUCL40278; AF255198 for Ganoderma boninense strain FA-PP28; and AF026629 for G. australe strain RSH0705.

Phylogenetic analyses of ITS sequences ITS sequences were aligned manually. Sequences from the conserved 5.8S rRNA gene (located between the ITS 1 and ITS 2 spacers) were lacking for about half of the taxa and this region was excluded from the analyses. Regions with ambiguous sequence alignment were removed, and gaps in the alignment

Southern Hemisphere dispersal in Ganoderma applanatum-australe

427

Table 1 – Origin and GenBank accessions of the strains used in this study Strain no. GYONGYI_0150 CBS187.31 JM97/3 JM97/2 DL008 JM97/52 CBS222.48 JM97/31 JM97/56 JM98/1 CBS351.74 CBS175.30 PKB96/303 PKB96/332 PKB96/330 RSH1206 PKB93/035 TAI-01 TAI-04 RSH.0705 NIAST824 ACCC5.151 JM98/132 JM98/233 JM98/213 MUCL41812 JM98/339 JM98/19 JM95/6 JM95/5 PKB96/270 CP331 CP212 CP333 CP302 ME-GAN-14 ME-GAN-24 RV-PR10 JMCR.25 JMCR.41 JMCR.55 JMCR.142 JMCR.132 MUCL40406 MUCL40412 MUCL40324 BAFC2582 FA-EGBn1 FA-CNn1 FA-AM8 FA-AM5 JM98/338 JM98/38 Yao34456 JMCR.128 JM98/2 GanLuc1197 PKB87/267 PKB96/361 PKB96/408 PKB96/346 PKB96/380 PKB96/352 PKB94/065

Locality

Sourcea

Hungary Germany North Carolina, USA Oregon, USA North Carolina, USA Virginia, USA USA North Carolina, USA North Carolina, USA North Carolina, USA Belgium United Kingdom Japan Japan Japan Taiwan Taiwan Taiwan Taiwan Taiwan South Korea China Yunnan, China Yunnan, China Yunnan, China Cambodia Thailand Thailand Thailand Thailand Singapore Papua New Guinea Papua New Guinea Papua New Guinea Papua New Guinea Florida, USA Florida, USA Puerto Rico Costa Rica Costa Rica Costa Rica Costa Rica Costa Rica Ecuador Ecuador French Guyana Brasil Malaysia Malaysia Malaysia Malaysia Thailand Thailand U.K. Costa Rica South Africa South Africa Tasmania, Australia Australia Australia Australia Australia Australia New Zealand

G. Szleday CBS J.M. Moncalvo R. Vilgalys Duke herbarium J.M. Moncalvo GenBank J.M. Moncalvo J.M. Moncalvo J.M. Moncalvo GenBank CBS P.K. Buchanan P.K. Buchanan P.K. Buchanan R.S. Hseu P.K. Buchanan Z.Y. Yeh Z.Y. Yeh GenBank NIAST GenBank J.M. Moncalvo J.M. Moncalvo J.M. Moncalvo MUCL (C. Decock) J.M. Moncalvo J.M. Moncalvo J.M. Moncalvo J.M. Moncalvo P.K. Buchanan C. Pilotti C. Pilotti C. Pilotti C. Pilotti M. Elliott M. Elliott R. Vilgalys J.M. Moncalvo J.M. Moncalvo J.M. Moncalvo J.M. Moncalvo J.M. Moncalvo MUCL (C. Decock) MUCL (C. Decock) MUCL (C. Decock) GenBank F. Abdullah F. Abdullah F. Abdullah F. Abdullah J.M. Moncalvo J.M. Moncalvo GenBank J.M. Moncalvo A. Pringle T. Harrington P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan

G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G. G.

Original ID

GenBank no.

Reference

applanatum applanatum applanatum cplx applanatum cplx cf. applanatum applanatum cplx lobatum applanatum cplx applanatum cplx applanatum cplx adspersum applanatum australe cplx australe cplx australe cplx australe australe cplx australe IG 1 australe IG 1 australe applanatum gibbosum applanatum cplx applanatum cplx applanatum cplx australe cplx australe cplx australe cplx australe cplx australe cplx australe cplx australe cplx australe cplx australe cplx australe cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx applanatum cplx tornatum australe australe australe australe australe cplx australe cplx adspersum applanatum cplx applanatum cplx lucidum australe cplx australe cplx australe cplx australe cplx australe cplx australe cplx australe cplx

AF255092 AF255093 AF255094 AF255095 AF255096 AF255097 X78740/X78761 AF255098 AF255099 AF255100 X78742/X78763 AF255101 AF255102/3 AF255104 AF255105 AF255106/7 AF255108/9 AF255110/1 AF255112/3 X78750/X78771 AF255114 X78741/78762 AF255115 AF255116 AF255117 AF255118 AF255119 AF255120 AF255121 AF255122 AF255123/4 AF255125 AF255126/7 AF255128 AF255129 AF255130 AF255131/2 AF255133 AF255134 AF255135 AF255136 AF255137 AF255138 AF255139 AF255140 AF255141 AF169985/6 AF255142 AF255143 AF255144 AF255145 AF255146 AF255147 AJ006685 AF255148 AF255149 AF255150 AF255151/2 AF255153/4 AF255155/6 AF255157 AF255158 AF255159 AF255160

This work This work This work This work This work This work Moncalvo et al. (1995) This work This work This work Moncalvo et al. (1995) This work This work This work This work This work This work This work This work Moncalvo et al. (1995) This work Moncalvo et al. (1995) This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work This work Gottlieb et al. (2000) This work This work This work This work This work This work GenBank This work This work This work This work This work This work This work This work This work This work (continued on next page)

428

J.-M. Moncalvo, P. K. Buchanan

Table 1 – (continued) Strain no. PKB94/060 PKB91/098 PKB91/145 PKB91/144 PKB91/141 PKB95/259 IJFM.A130 IJFM.A414 BAFC2531 BAFC2532 BAFC2552 BAFC2571 BAFC2563 BAFC651 BAFC2557 BAFC2424 BAFC1172 BAFC1139 BAFC2407 BAFC2454 PKB92/040 BAFC671 BAFC1544 BAFC2370 BAFC2449 BAFC2411 BAFC2391 BAFC2764 LXT.8 LXT.6 MUCL27886 HMAS60686 TAI-05 TAI-06 FA-S0.1 ZHANG1734

Locality New Zealand New Zealand New Zealand New Zealand New Zealand New Zealand Chile Chile Chile Chile Argentina Argentina Argentina Argentina Argentina Argentina Argentina Argentina Argentina Argentina New Zealand Argentina Argentina Argentina Argentina Argentina Argentina Argentina Vietnam Vietnam Tamil Nadu, India China Taiwan Taiwan Malaysia China

Sourcea P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan P.K. Buchanan BAFC BAFC BAFC BAFC BAFC GenBank GenBank GenBank GenBank GenBank GenBank GenBank P.K. Buchanan BAFC BAFC BAFC BAFC GenBank GenBank GenBank L.X. Tham L.X. Tham MUCL (C. Decock) R.S. Hseu Z.Y. Yeh Z.Y. Yeh F. Abdullah GenBank

Original ID G. australe cplx G. australe cplx G. australe cplx G. australe cplx G. australe cplx G. australe cplx G. australe cplx G. australe cplx Ganoderma sp. Ganoderma sp. Ganoderma sp. Ganoderma sp. Ganoderma sp. G. lobatum Ganoderma sp. G. lipsiensis G. tornatum G. tornatum Ganoderma sp. G. lobatum G. australe cplx Ganoderma sp. Ganoderma sp. Ganoderma sp. Ganoderma sp. G. lobatum G. lobatum G. tornatum G. cf. australe G. cf. philippii Ganoderma sp. G. applanatum G. australe IG 2 G. australe IG 2 G. boninense G. sinense

GenBank no. AF255161/2 AF255163 AF255164/5 AF255166/7 AF255168/9 AF255170/71 AF255172/73 AF255174/5 AF255176 AF255177 AF255178/9 AF255180 AF255181/2 AF169983/4 AF169995/6 AF169977/8 AF169975/6 AF169979/80 AF169981/2 AF169987/8 AF255183 AF255184 AF255185 AF255186 AF255187 AF169989/90 AF169991/2 AF169993/4 AF255188 AF255189 AF255190 AF255191/2 AF255193/4 AF255195 AF255196/7 Z37066/37103

Reference This work This work This work This work This work This work This work This work This work This work This work This work This work Gottlieb et al. (2000) Gottlieb et al. (2000) Gottlieb et al. (2000) Gottlieb et al. (2000) Gottlieb et al. (2000) Gottlieb et al. (2000) Gottlieb et al. (2000) This work This work This work This work This work Gottlieb et al. (2000) Gottlieb et al. (2000) Gottlieb et al. (2000) This work This work This work This work This work This work This work Moncalvo et al. (1995)

a BAFC: University of Buenos Aires Fungal Culture Collection, Buenos Aires, Argentina; CBS: Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; MUCL: Mycotheque de l’Universite´ Catholique de Louvain, Louvain-la-Neuve, Belgium (strains graciously provided by C. Decock); NIAST: Korean Agricultural Culture Collection, National Institute of Agricultural Science and Technology, Suwon, Republic of Korea.

were treated as missing data. MP analyses were conducted in PAUP (Swofford 2002) with tree bisection–reconnection (TBR) branch-swapping and the following settings: heuristic searches with 100 replicates of random addition sequences, MULPARS on, MAXTREES set to 100 in each replicate, all characters of type unordered, starting tree(s) obtained via stepwise addition sequence, one tree held at each step during stepwise addition, steepest descent option not in effect, branches collapsing if minimum branch length is zero, and multistate taxa interpreted as uncertainty. Statistical support for branches were determined from 100 BS replicates (Felsenstein 1985) with one round of random addition sequence in each replicate and the search settings described above. A Bayesian analysis was run in MrBayes 3.1.1 (Ronquist & Huelsenbeck 2003) for 5M generations using four chains and a general time-reversible model with estimation of both the proportion of invariable sites and the gamma substitution rate heterogeneity parameter. Trees were sampled every 100 generations. Burn-in trees were discarded prior to computing the bayesian consensus trees of PPs. Trees were rooted with sequences from Ganoderma boninense and G. sinense (Moncalvo 2000).

A subset of 29 ITS sequences from the Southern Hemisphere was used to construct a parsimony network for a nested clade analysis (Templeton 1998). Sequences were separated into four geographic groups (New Zealand; Australia, including Tasmania; Chile and Argentine; and South Africa) and the program GeoDis (Posada et al. 2000) was used to analyse the phylogeographic pattern revealed by the parsimony network. Results were interpreted using the inference key of Templeton (1998).

Estimation of time divergence Molecular data and fossil evidence place the age of origin of the basidiomycetes at ca 440 M years and the diversification of the homobasidiomycete was estimated to have occurred 330 M years ago (Berbee & Taylor 2000). To infer whether Ganoderma could have diversified before the Gondwana and Laurasia landmasses separated (120 M years ago), or before the final separation of the Gondwanan landmasses from each other (66 M years ago), we produced 18S rDNA sequences for G. australe, G. boninense, and one species of its sister genus

Southern Hemisphere dispersal in Ganoderma applanatum-australe

Amauroderma. These sequences were incorporated in the broad homobasidiomycete phylogeny of Hibbett et al. (1997). We used ML in PAUP (Swofford 2002) to test the validity of a clock-like model of evolution for the 18S gene in the homobasidiomycetes, as well as for the polypore clade in which Ganoderma is classified (Hibbett et al. 1997). ML analyses used the F84 model of molecular evolution, with settings for base frequencies, transition:transversion ratio and gamma shape parameter estimated from the data, and the number of rate categories set to 4. A statistical test of the molecular clock was conducted by comparing ML scores between trees for which a clock was enforced or not, using the chi-square test with n-2 degrees of freedom (Felsenstein 1993).

Mating studies Two pairs of isolates from New Zealand that were found to be intersterile in preliminary mating experiments were used as tester strains against other culture isolates. These were PKB92/040 and PKB91/141, and PKB94/060 and PKB94/065, respectively. Mating intercompatibility studies were performed in malt-extract agar plates as originally described by Boidin (1986), by inoculating pairs of monokaryons (mon–mon mating) or one monokaryon and a dikaryon (di–mon mating) 1 cm apart in the same plate. The mycelia were later examined in the interaction zone and toward the edge of each colony for the presence of clamp connections, which in basidiomycetes are indicative of successful mating. Tester strains from two intersterility groups from Taiwan (Yeh et al. 2000) were also included in the study. The number of mating intercompatibility tests conducted in this work was limited by the lack of monokaryons available for many collections: we present preliminary data to serve further investigations.

429

Northern temperate strains (North America, Europe, and Japan) composed clades 1–2. Basal relationships between clades 1–8 were not well resolved; however, all equally most parsimonious trees and bayesian analysis suggest earlier divergence of clade 1 (61 % BS support and 0.98 PP, respectively), and monophyly of clades 2–7 (50 % BS; 1 PP), and 3–4 ( 0.05), making the application of a molecular clock appropriate within the latter group. Under the assumption that the divergence between G. australe and G. boninense has occurred, respectively, before the breakup of the Gondwana and Laurasia landmasses (120 M years ago), or before final separation of the Gondwanan landmasses from each other (66 M years ago), branch lengths in the phylogenetic tree indicate that diversification of the polypore clade would have taken place at least 430, respectively, 237 M years ago (Fig 3). However, these estimates are highly unlikely because they would predate the estimated date of diversification of the Agaricomycetes sensu Hibbett et al. (2007) (ca 200 M years ago) (Berbee & Taylor 2000). In contrast, if the rate of nucleotide substitution in the polypore clade is assumed to match that averaged in other fungi (1.26 % per 100 M years; Berbee

430

J.-M. Moncalvo, P. K. Buchanan

Fig 1 – Phylogenetic reconstruction of ITS sequences using MP among 96 isolates of Ganoderma australe, with G. boninense and G. sinense used as outgroup to root the tree (tree length [ 254; CI [ 0.669; RI [ 0.925). The tree depicted is one of 3607 equally parsimonious trees. Branches in bold line were also present in the strict consensus tree. Numbers above and below branches are BS statistical support >50 % and bayesian PPs >0.8, respectively.

& Taylor 2000), then the polypore clade would have diversified about 141 M years ago and an oldest possible date of origin of G. australe would be 30 M years ago.

Mating studies Results from mating intercompatibility studies using New Zealand isolates from clades 3 and 4 as tester strains are summarized in Table 2. Two intersterility groups were found in

New Zealand. All New Zealand strains cluster in clade 3 except the putative hybrid PKB92/040, which is intermediate between clade 3 and 4. One New Zealand intersterility group was composed of strains PKB94/065, PKB94/060, PKB95/145, and PKB95/ 259, and the other was composed of strains PKB92/040, PKB91/ 141, and PKB91/144. However, intersterility between the two groups may still be incomplete because formation of a few clamp connections was observed in at least one cross between members of the two groups (PKB92/040 versus PKB92/060).

Southern Hemisphere dispersal in Ganoderma applanatum-australe

PKB94/065 New Zealand

431

V

BAFC651 Argentina VIII

PKB94/060 New Zealand

PKB91/144 PKB96/352 PKB96/380 PKB96/346 PKB96/361 PKB87/267

New Zealand Australia NSW Australia Australia NSW Australia QLD Tasmania I

PKB91/141 New Zealand PKB96/408 Australia VIC BAFC2571 Argentina BAFC2563 Argentina BAFC2407 Argentina II BAFC2557 Argentina

IV

BAFC2454 Argentina BAFC1139 Argentina BAFC1172 Argentina BAFC2424 Argentina HARR1197 South Africa JM98/2 South Africa III

PKB95/259 New Zealand PKB91/145 New Zealand IJFM.A414 Chile BAFC2531 Chile BAFC2532 Chile IX BAFC2552 Argentina

PKB91/098 New Zealand VI

PKB94/060 New Zealand VII

Fig 2 – Haplotype diagram among Southern Hemisphere isolates nested in clade 3 in Fig 1. Nine distinct ITS haplotypes were found among these collections (labelled I–IX). A nested clade analysis of the network indicated restricted gene flow with isolation-by-distance among the New Zealand, Australia (including Tasmania), Chile–Argentina, and South Africa populations.

Strains from Chile (clade 3) and China (clade 4) were intercompatible with isolates of the two New Zealand intersterility groups, whereas strains from Tasmania and Argentina (clade 3) were intercompatible with one group and intersterile with the other. Strains from Taiwan intersterility group 2 (clade 4) showed various levels of intercompatibility with isolates from the two intersterility groups from New Zealand. In contrast, strains from Taiwan intersterility group 1 (clade 5) were largely intersterile with New Zealand collections, as were other isolates from clades 2 and 5.

Discussion This study reports one of the first molecular evidence that dispersal plays a significant role in the biogeographic history

of fungi in the Southern Hemisphere, at least for nonspecialized saprobes. Three lines of evidence support this conclusion: (1) ITS sequences in fungi are evolving relatively fast (Bruns et al. 1991), and it is unlikely that ITS haplotypes would have remained unchanged since the final separation of the different Gondwanan fragments (66 M years ago) (White 1990). Therefore, the presence of identical ITS haplotypes among geographically disjunct populations of Ganoderma australe in the Southern Hemisphere (see II, III and IX in Fig 2) is best explained by recent dispersal. (2) The occurrence of gene flow among the Australo–Pacific, South American, and South Africa populations was suggested by a nested clade analysis. (3) It is unlikely that G. australe diversified before the separation of the Gondwana and Laurasia landmasses (120 M years ago); therefore, only dispersal can explain the phylogenetic patterns depicted in Figs 1–2.

(430)

(120)

(237)

(66)

Lentinus tigrinus Ganoderma australe Ganoderma boninense Amauroderma sp. Trametes suaveolens Fomes fomentarius Dentocorticium sulphurellum Polyporus squamosus (A) 0 (B) 0

Fig 3 – Time divergence inference for the polyporoid clade when divergence time between Ganoderma boninense and G. australe is set to (A) 120 M years ago (Gondwana–Laurasia separation), and (B) 66 M years ago (final separation of the Gondwanan landmasses from each other).

432

J.-M. Moncalvo, P. K. Buchanan

Table 2 – Results from mating intercompatibility testsa Clade in Fig 1

3 3 3 3 3 3 3 3 3 3 3 4 4 4 4 5 5 n.d. n.d. 5 5 2 2 Outgroup

Isolate no.

PKB94/060 PKB91/141 PKB91/144 PKB91/145 PKB95/259 PKB87/267 PKB91/148 BAFC2552b BAFC2571b IJFM.A414b IJFM.A130b PKB92/040 HMAS60686b TAI-05(IGR-2) TAI-06(IGR-2) RSH1206b TAI-01(IGR-1) PKB92/011 PKB96/268 PKB96/270 PKB96/330 PKB96/303 PKB96/332 FA.SO.13b

Origin

New Zealand New Zealand New Zealand New Zealand New Zealand Tasmania Tasmania Argentina Argentina Chile Chile New Zealand China Taiwan Taiwan Taiwan Taiwan Taiwan Singapore Singapore Japan Japan Japan Malaysia

Clade 3

Clade 4

PKB94/065 New Zealand

PKB94/060 New Zealand

PKB91/141 New Zealand

PKB92/040 New Zealand

þ   þ þ þ þ þ þ þ þ  þ /þ /þ         

n.a.   þ þ þ þ þ þ þ þ /þ þ /þ /þ         

 n.a. þ   n.d. n.d.   þ þ þ þ           

/þ þ þ       þ þ n.a. þ þ þ /þ        

a Results were scored as follows: þ, compatible mycelia (numerous clamp connections observed); , incompatible mycelia (no clamp connections observed); /þ, partially compatible mycelia (only a few clamp connections observed); n.a., not applicable; n.d., not determined. b Strains used for di–mon mating only.

G. australe occupies a derived position in the ribosomal DNA phylogeny of hymenomycetes (Hibbett et al. 1997). The view that Ganoderma is an evolved, rather than a primitive taxon was already suggested from its relatively complex microanatomy (Ryvarden 1991) and a low level of sequence divergence in the large ribosomal subunit gene in comparison with other fungal genera (Moncalvo et al. 1995). This study provides further evidence for a relatively young age of the genus. The nucleotide substitution rate of the 18S rRNA gene indicates that members of the G. applanatum-australe complex may have diversified about 30 M years ago. This estimate seems reasonable because it would place the origin of the polypore clade in the Early Cretaceous (about 141 M years ago), indicating that diversification of lignin-decaying fungi accompanied the radiation of their woody plant substrate. In addition, our time divergence estimate for the radiation of G. applanatum and allies (30 M years ago) is similar to that calculated for the shiitake mushrooms (Lentinula) (34 M years ago), in which, therefore, a Gondwanan hypothesis to explain the distinctiveness of Southern Hemisphere taxa was also not supported (Hibbett 2001). Many problems are still associated with time divergence estimates, particularly regarding calibration and precision (see for instance Graur & Martin 2004), but relative order of divergence can directly be derived from phylogenies. Overall, given the currently available calibrations (see references above), it is very likely that speciation events in the G. applanatum-australe species complex are much younger than the tectonic breakdown of Gondwana.

Although dispersal rather than old age is most likely to explain the broad distribution of members of the G. applanatumaustrale species complex, our results also suggest that long distance dispersal is probably only episodic, because the ITS phylogeny also indicated strong geographic structure and overall allopatric divergence. No correlation was evident between phylogeny and host relationships (angiosperms, conifers, and palms; data not shown), which indicates that host distribution is unlikely to explain the observed geographic pattern. Fig 1 shows that two clades were composed only of collections from the temperate regions of the Northern Hemisphere (clades 1–2), two clades were composed only of collections from tropical Asia (clades 6 and 8), one clade was composed only of neotropical collections (clade 7), one clade was composed only of Eastern Asian collections (clade 5), one clade included only Southeast Asian and Southern Hemisphere collections (clade 4), and one clade included the majority of the Southern Hemisphere collections but also one collection from the UK and one collection from Costa Rica (clade 3). The presence of one collection from the UK in the latter clade is best explained by horticultural activities as that collection was from Richmond, Surrey, which is the site of the Royal Botanical Gardens Kew, that includes plants from all over the world. The collection from Costa Rica nesting in the Southern Hemisphere clade was from a high altitude (2700 m), whereas all the lowland collections from Costa Rica clustered with the other neotropical collections sampled. This indicates that climatic factors (such as temperature) may play a role in the distribution of this fungus.

Southern Hemisphere dispersal in Ganoderma applanatum-australe

Strain PKB92/040 from New Zealand stands in an intermediate position between clades 3 and 4, although statistically strongly nesting with members of the latter (86 % BS, 1 PP). Separate analyses of the ITS1 and ITS2 regions, respectively, placed this strain in clade 4 or with the Argentina isolates in clade 3 (data not shown). A closer inspection of the data matrix shows that PKB92/040 has identical ITS2 sequence with two South African and four Argentina strains of clade 3 (haplotype III in Fig 2), while differing from these strains in 15 positions in ITS1 (Fig 4). In the latter region, PKB92/040 is much more similar to Argentina isolates of clade 4 (three substitutions versus 16 in ITS2; Fig 4). These data suggest recent recombination in the 5.8S gene, probably resulting from a mixed clade 3  clade 4 parental inheritance. The only other study we are aware of that reports a natural event of recombination in the ribosomal ITS region of fungi was in Flammulina (Hughes & Petersen 2001). The observation that recombination has probably occurred between members of clades 3 and 4 reinforces the mating results shown in Table 2, that indicate intercompatibility between some members of these two clades. The origins of the taxa and succession of colonization events could not be completely determined from the ITS phylogeny because basal relationships between the nine clades were not fully resolved (Fig 1). However, our results suggest a Northern Hemisphere origin for G. australe, and an earlier split between northern temperate regions and tropical Asia. It also appears that Southeast Asia could be a centre of diversification for the group, because there was a higher number of distinct clades and higher genetic variation in this region. One of the Asian clades also occupies a basal position in the

18S-3'

433

phylogeny (clade 8). Therefore, we speculate that the major radiation and diversification events may have occurred from Southeast Asia, including radiation to temperate regions in both the Northern and Southern Hemispheres, as well as long distance colonization of the neotropics. The ITS phylogeny grouped all the Southern Hemisphere taxa in clades 3–4. This indicates a single colonization event and subsequent dispersal within the Southern Hemisphere. However, there has been at least one later instance of dispersal from the Southern Hemisphere back to Asia, as indicated by the derived position of Asian taxa in clade 4. Nested clade analysis among Southern Hemisphere members of clade 3 (Fig 2) indicated restricted gene flow with isolation-bydistance. Therefore, a biogeographic pattern could be detected within the Southern Hemisphere, but episodic long-distance dispersal still occurs. In particular, the lack of sequence variation between isolates from Argentina and South Africa (haplotype III in Fig 2), and the likely recombinant origin of ITS observed in New Zealand isolate PKB92/040 (see above), suggest recent long dispersal events between these localities. The factors responsible for recent long distance dispersal of fungi remain poorly known, and in such cases human activities are generally implicated (but not always, see Watson & de Sousa 1983). However, human migration and commerce involving Australia, for instance, occur at higher frequency with Asia than with South America or Africa, yet phylogenetic affinities of Australian G. australe are higher with collections from the latter than the former regions. This indicates the possibility that fungal spores disperse by wind within the Southern Hemisphere. Ganoderma basidiospores are commonly reported from airborne spore trap experiments (Lacey

ITS1

JM98/2_South_Africa PKB92/040_New_Zealand BAFC671_Argentina

CATTA TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTACCGGT CATTA TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGT-TACAGAT CATTA TCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGT-TACAGAT

JM98/2_South_Africa PKB92/040_New_Zealand BAFC671_Argentina

CGCGAAACGGGCTCGTTTATTCGGGCTTGTGGAGCG-CACTTGTTGCCTGCGTTTATCACAAACTCCATAAAGTATTAGAATGTGTATTGCGATGTAACG CGTGAAACGGGCTC-TTTA-CCGAGCTCGCGGAGCGCCACCTGT-GCCCGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACG CGTGAAACGGGCTC-TTTG-CTGAGCTCGCAGAGCG-CACCTGT-GCCCGCGTTTATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGATGTAACG

JM98/2_South_Africa PKB92/040_New_Zealand BAFC671_Argentina

CATCTAT ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA CATCTAT ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA CATCTAT ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA

JM98/2_South_Africa PKB92/040_New_Zealand BAFC671_Argentina

TCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAT GAAATCTTCAACTTACAAGCTCTTTGCGGGGT TCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAT GAAATCTTCAACTTACAAGCTCTTTGCGGGGT TCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAT GAAATCTTCAACCTACAAGCTCTTTTTGTGGC

JM98/2_South_Africa PKB92/040_New_Zealand BAFC671_Argentina

TTGTAGGCTTGGACTTGGAGGCTTGTCGGCCTTTAACGGTCGGCTCCTCTTAAATGCATTAGCTTGATTTCCTTGCGGATCGGCTGTCGGTGTGATAATG TTGTAGGCTTGGACTTGGAGGCTTGTCGGCCTTTAACGGTCGGCTCCTCTTAAATGCATTAGCTTGATTTCCTTGCGGATCGGCTGTCGGTGTGATAATG TCGTAGGCTTGGATTTGGAGGCTTGTTGGCCTTTATTGGTCGGCTCCTCTTAAATGCATTAGCTTAGTT-CCTTGCGGATCGGCTGTCGGTGTGATAATG

JM98/2_South_Africa PKB92/040_New_Zealand BAFC671_Argentina

TCTACTCCGCGACCGTGAAGCGTTTGGCAAGCTTCTAACCGTCTC-GTTACAGAGACAGCTTTATGACCTCT GACCTCAAATCAGG TCTACTCCGCGACCGTGAAGCGTTTGGCAAGCTTCTAACCGTCTC-GTTACAGAGACAGCTTTATGACCTCT GACCTCAAATCAGG TCTACTCCGCGACCGTGAAGTGTCTGGCAAGCTTCTAACCGTCTCTGTTACAGAGACAGCTTTATGACCTCT GACCTCAAATCAGG

5.8S rDNA

ITS2

25S-5'

Fig 4 – The probable recombinant nature of ITS in strain PKB92/040 from New Zealand. This strain clusters in an intermediate position between clades 3 and 4 in phylogenetic analyses (Fig 1). Sequences from its ITS1 region are highly similar to that of members of clade 4 (represented here by BAFC671 from Argentina) whereas its ITS2 sequences are identical to that of several members of clade 3 (represented here by isolate JM98/2 from South Africa). Black dots below the alignment indicate variable positions.

434

1996). Ganoderma spores are hard, double-walled, melanized, and echinulated, and may possibly be well adapted for wind transportation at higher altitude. The hypothesis of wind patterns to explain observed geographic distribution is not new (Walker 1996; Watson & de Sousa 1983), but has generally been neglected by most biogeographers and systematists. However, several recent molecular phylogenetic studies support that hypothesis. For instance, it has been suggested that wind patterns, not geographical proximity, best explain the distribution of lower plants in the Southern Hemisphere (Mun˜oz et al. 2004). It has also been show that the presence in New Zealand and Tasmania of a genus of higher plants (Ourisia, Plantaginaceae) is from South American origin (Meudt & Simpson 2006). The two clades composed of collections from temperate regions in the Northern Hemisphere (clades 1–2 in Fig 1) differed in both intra-clade sequence divergence and geographic patterns. The internal topology of clade 2 is strongly correlated with geography, indicating that allopatric divergence has occurred: European and Japanese collections form two distinct sister groups, well separated from North American strains. In contrast, clade 1 shows no significant molecular divergence between collections from Europe and North America. Although this clade diverged earlier than clade 2, ITS sequence divergence in this clade is lower (less than 1 % versus 3–5 %), suggesting a relatively recent colonization from Europe to North America, or vice versa. A comparison between nucleotide sequence divergence in ITS (Fig 1) and mating data (Table 1) indicate that in this group of fungi the amount of ITS sequence divergence is not directly associated with the development of intersterility. For instance, two intersterility groups were detected among New Zealand isolates clustering in clade 3, but some isolates of this clade could still mate with collections classifying in clade 4. Also, the finding that isolates from Chile (clade 3) and China (clade 4) could mate with collections from the two intersterility groups from New Zealand suggests that speciation processes in G. australe are complex, and support the view that biological species do not necessarily correspond with phylogenetic species, at least when divergence time is short (Taylor et al. 2000). With higher divergence times distinct phylogenetic groups are intersterile, regardless of geography. For instance, collections from clades 3–4 are not sexually compatible with isolates from clades 2 and 5 (Table 2), and members of two intersterility groups from the same locality (Taiwan) (Yeh et al. 2000) are segregated in clades 4 and 5, respectively (Fig 1). This study also confirms earlier observations (Moncalvo et al. 1995; Moncalvo & Ryvarden 1997; Gottlieb et al. 2000) that morphology in the G. applanatum-australe complex is of limited use for distinguishing between phylogenetic and/or intersterility groups. The combined presence of intersterility groups, genetic divergence, and phylogenetic pattern associated with geography warrants the recognition of several distinct species in the G. australe complex. The clades depicted in Fig 1 could serve as a basis for circumscribing these species. However, dealing with species concepts and the appropriate names for species under the rules of nomenclature is beyond the scope of this paper. In conclusion, this study shows that global scale vicariance models (Rosen 1978) are too simplistic to be the sole

J.-M. Moncalvo, P. K. Buchanan

explanation for the population structure and evolution of a species. Although this and many other phylogeographic studies generally support the view that genetic divergence among populations is often associated with allopatry (Avise 2000), cladistic analyses of molecular data are now beginning to reveal that many diverse taxa can episodically disperse on inter-continental scales, including freshwater fish (Waters et al. 2000), plants (Dick et al. 2007), and fungi (James et al. 2001; Takamatsu et al. 2006). Fig 1, and several other phylogenetic studies in microorganisms (reviewed in Foissner 2006), support the view that there are often distinct differences between Laurasian and Gondwanan regions, but these are also well marked between temperate and tropical areas. Overall, explanations based solely on tectonic theory do not satisfactorily explain the distinctiveness and unique biological richness in those areas that once composed Gondwana. Further biogeographic studies of Southern Hemisphere taxa should concentrate on the evolutionary history of organisms and their life strategies.

Acknowledgements We thank Cony Decock, Le Xuan Tham, Zeng-Yung Yeh, D. S. Park, Anne Pringle, Rytas Vilgalys, Alexandra Gottlieb, Tom Harrington, and Gyongy Szedlay for sending specimens or sharing DNA sequences, Paula Wilkie and Duckchul Park for laboratory help, and Brandon Matheny for critical comments on an earlier draft of the manuscript. This work was supported by the Natural Sciences and Engineering Research Council of Canada and the Canada Foundation for Innovation to J.M.M., and the Foundation for Research, Science and Technology, Auckland, to P.K.B.

references

Avise JC, 2000. Phylogeography: the History and Formation of Species. Harvard University Press, Cambridge, MA. Barker NP, Weston PH, Rutschmann F, Sauquet H, 2007. Molecular dating of the ‘Gondwanan’ plant family Proteaceae is only partially congruent with the timing of the break-up of Gondwana. Journal of Biogeography 34: 2012–2027. Berbee ML, Taylor JW, 2000. Fungal molecular evolution: gene trees and geologic time. In: McLaughlin DJ, McLaughlin EG, Lemke PA (eds), The Mycota, vol VII. Systematics and Evolution, Part B. Springer Verlag, Berlin, pp. 229–245. Bisby GR, 1933. The distribution of fungi as compared with that of phanerogams. American Journal of Botany 20: 246–254. Boidin J, 1986. La notion d’espece. III: Le critere d’interfertilite´ ou intercompatibilite´: re´sultats et proble´mes. Bulletin de la Socie´te´ Mycologique de France 96: 43–57. Bruns TD, White TJ, Taylor JW, 1991. Fungal molecular systematics. Annual Review of Ecology and Systematics 22: 525–564. Buchanan PK, 1988. A new species of Heterobasidion (Polyporaceae) from Australasia. Mycotaxon 32: 325–337. Coetzee MP, Wingfield BD, Harrington TC, Dalevi D, Coutinho TA, Wingfield MJ, 2000. Geographical diversity of Armillaria mellea s. s. based on phylogenetic analysis. Mycologia 92: 105–113. Coetzee MP, Wingfield BD, Harrington TC, Steimel J, Coutinho TA, Wingfield MJ, 2001a. The root rot fungus Armillaria mellea

Southern Hemisphere dispersal in Ganoderma applanatum-australe

introduced into South Africa by early Dutch settlers. Molecular Ecology 10: 387–396. Coetzee MPA, Wingfield BD, Bloomer P, Ridley GS, Kile GA, Wingfield MJ, 2001b. Phylogenetic relationships of Australian and New Zealand Armillaria species. Mycologia 93: 887–896. Cook LG, Crisp MD, 2005. Directional asymmetry of long-distance dispersal and colonization could mislead reconstructions of biogeography. Journal of Biogeography 32: 741–754. Dick CW, Bermingham E, Lemes MR, Gribel R, 2007. Extreme longdistance dispersal of the lowland tropical rainforest tree Ceiba pentandra L. (Malvaceae) in Africa and the Neotropics. Molecular Ecology 16: 3039–3049. Felsenstein J, 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791. Felsenstein J, 1993. PHYLIP: phylogeny inference package., Version 3.5. University of Washington, Seattle. Flood J, Bridge PD, Holderness M (eds), 2000. Ganoderma Diseases of Perennial Crops. CAB International, Wallingford. Foissner W, 2006. Biogeography and dispersal of microorganisms: a review emphasizing protists. Acta Protozoologica 45: 11–136. Geml J, Laursen GA, O’Neill K, Nusbaum HC, Taylor DL, 2006. Beringian origins and cryptic speciation events in the fly agaric (Amanita muscaria). Molecular Ecology 15: 225–239. Goodwin SB, Legard DE, Smart CD, Levy M, Fry WE, 1999. Gene flow analysis of molecular markers confirms that Phytophtora mirabilis and P. infestens are separate species. Mycologia 91: 796–810. Gottlieb AM, Ferrer E, Wright JE, 2000. rDNA analysis as an aid to the taxonomy of species of Ganoderma. Mycological Research 104: 1033–1045. Graur D, Martin W, 2004. Reading the entrails of chickens: molecular timescales of evolution and the illusion of precision. Trends in Genetics 20: 80–86. Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ, 1997. Evolution of gilled mushrooms and puffballs inferred from ribosomal DNA sequences. Proceedings of the National Academy of Sciences, USA 94: 12002–12006. Hibbett DS, 2001. Shiitake mushrooms and molecular clocks: historical biogeography of Lentinula. Journal of Biogeography 28: 231–241. Hibbett DS, 66 others, 2007. A higher-level phylogenetic classification of the fungi. Mycological Research 111: 509–547. Horak E, 1981. Notes on taxonomy and biogeography of Rozites Karsten. Sydowia 34: 94–108. Horak E, 1983. Mycogeography in the south Pacific region: Agaricales, Boletales. Australian Journal of Botany, Supplementary Series 10: 1–41. Hughes KW, Petersen RH, 2001. Apparent recombination or gene conversion in the ribosomal ITS region of a Flammulina (Fungi, Agaricales) hybrid. Molecular Biology and Evolution 18: 94–96. Isikhuemhen S, Moncalvo JM, Nerud F, Vilgalys R, 2000. Mating compatibility and phylogeography in Pleurotus tuberregium. Mycological Research 104: 732–737. James TY, Moncalvo JM, Li S, Vilgalys R, 2001. Polymorphism at the ribosomal DNA spacers and in its relation to breeding structure of the widespread mushroom Schizophyllum commune. Genetics 157: 149–161. Johnston PR, Whitton SR, Buchanan PK, Park D, Pennycook SR, Johnson JE, Moncalvo JM, 2006. The basidiomycete genus Favolaschia in New Zealand. New Zealand Journal of Botany 44: 65–87. Keast A (ed), 1981. Ecological Biogeography of Australia. W. Junk, The Hague. Knapp M, Sto¨ckler K, Havell D, Delsuc F, Sebastiani F, Lockhart PJ, 2005. Relaxed molecular clock provides evidence for

435

long-distance dispersal of Nothofagus (Southern Beech). PLoS Biology 3: e14. Korf RP, 1983. Cyttaria (Cyttariales): coevolution with Nothofagus, and evolutionary relationship to the Boedijnopezizeae (Pezizales, Sarcoscyphaceae). Australian Journal of Botany, Supplementary Series 10: 77–87. Lacey J, 1996. Centenary review: spore dispersal d its role in ecology and disease: the British contribution to fungal aerobiology. Mycological Research 100: 641–660. Ladiges PY, Humphries CJ, Martinelli LW (eds), 1991 Austral biogeography. Australian Journal of Systematic Botany, 4, pp. 1–227. McGlone MS, 2005. Goodbye Gondwana. Journal of Biogeography 32: 739–740. Meudt HM, Simpson BB, 2006. The biogeography of the austral, subalpine genus Ourisia (Plantaginaceae) based on molecular phylogenetic evidence: South American origin and dispersal to New Zealand and Tasmania. Biological Journal of the Linnean Society 87: 479–513. Moncalvo JM, Ryvarden L, 1997. A Nomenclatural Study of the Ganodermataceae Donk. Fungiflora, Oslo. Moncalvo JM, Wang HH, Hseu RS, 1995. Phylogenetic relationships in Ganoderma inferred from the internal transcribed spacers and 25S ribosomal DNA sequences. Mycologia 87: 223–238. Moncalvo JM, 2000. Systematics of Ganoderma. In: Flood J, Bridge PD, Holderness M (eds), Ganoderma Diseases of Perennial Crops CAB International, Wallingford, pp. 23–45. Moreira-Mun˜oz A, 2007. The Austral floristic realm revisited. Journal of Biogeography 34: 1649–1660. Moyersoen B, Beever RE, Martin F, 2003. Genetic diversity of Pisolithus in New Zealand indicates multiple long-distance dispersal from Australia. New Phytologist 160: 569–579. Mun˜oz J, Felicı´simo AM, Cabezas F, Burgaz AR, Martı´nez I, 2004. Wind as a long-distance dispersal vehicle in the Southern Hemisphere. Science 304: 1144. O’Donnell K, Cigelnik E, Nirenberg HI, 1998. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90: 465–493. O’Donnell K, Kistler HC, Tacke BK, Casper HH, 2000. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium gramineum, the fungus causing wheat scab. Proceedings of the National Academy of Sciences of the United States of America 97: 7905–7910. Peintner U, Bougher NL, Castellano MA, Moncalvo JM, Moser M, Trappe JM, Vilgalys R, 2001. Multiple origins of sequestrate fungi related to Cortinarius (Cortinariaceae). American Journal of Botany 88: 2168–2179. Peintner U, Moser M, Vilgalys R, 2002a. Thaxterogaster is a taxonomic synonym of Cortinarius: new combinations and new names. Mycotaxon 81: 177–184. Peintner U, Horak E, Moser M, Vilgalys R, 2002b. Rozites, Cuphocybe and Rapacea are taxonomic synonyms of Cortinarius: new combinations and new names. Mycotaxon 83: 447–451. Posada D, Crandall KA, Templeton AR, 2000. GeoDis: a program for the cladistic nested analysis of the geographical distribution of genetic haplotypes. Molecular Ecology 9: 487–488. Raven PH, 1979. Plate tectonics and southern hemisphere biogeography. In: Larsen K, Holm-Nielsen LB (eds), Tropical Botany Academic Press, London, pp. 3–24. Raven PH, Axelrod DI, 1974. Angiosperm biogeography and past continental movements. Annals of the Missouri Botanical Garden 61: 539–673. Ronquist F, Huelsenbeck JP, 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. Rosen DE, 1978. Vicariant patterns and historical explanation in biogeography. Systematic Zoology 27: 159–188. Ryvarden L, 1991. Genera of Polypores. Fungiflora, Oslo.

436

Sanmartin I, Ronquist F, 2004. Southern Hemisphere biogeography inferred by event-based models: plant versus animal patterns. Systematic Biology 53: 216–243. Smith BJ, Sivasithamparam K, 2000a. Internal transcribed spacer ribosomal DNA sequence of five species of Ganoderma from Australia. Mycological Research 104: 943–951. Smith BJ, Sivasithamparam K, 2000b. Isozymes of Ganoderma species from Australia. Mycological Research 104: 952–961. Smith BJ, Sivasithamparam K, 2003. Morphological studies of Ganoderma (Ganodermataceae) from the Australasian and Pacific regions. Australian Systematic Botany 16: 487–503. Swenson U, Hill RS, Mcloughlin S, 2001. Biogeography of Nothofagus supports the sequence of Gondwana break-up. Taxon 50: 1025–1042. Swofford DL, 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), Version 4.0b10. Sinauer Associates, Sunderland, MA. Takamatsu S, Matsuda S, Niinomi S, Havrylenko M, 2006. Molecular phylogeny supports a Northern Hemisphere origin of Golovinomyces (Ascomycota: Erysiphales). Mycological Research 110: 1093–1101. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC, 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32.

J.-M. Moncalvo, P. K. Buchanan

Templeton AR, 1998. Nested clade analyses of phylogeographic data: testing hypotheses about gene flow and population history. Molecular Ecology 7: 381–397. Vilgalys R, Sun BL, 1994. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences. Proceedings of the National Academy of Sciences of the United States of America 91: 4599–4603. Walker J, 1996. Biogeography of fungi with special reference to Australia. In: Grgurinovic C, Mallett K (eds), Fungi of Australia vol. 1A. Australian Resources Study, Canberra. pp. 263–320. Waters JM, Dijkstra LH, Wallis GP, 2000. Biogeography of a southern hemisphere freshwater fish: how important is marine dispersal? Molecular Ecology 9: 1815–1821. Watson IA, de Sousa CN, 1983. Long distance transport of spores of Puccinia graminis tritici in the southern hemisphere. Proceedings of the Linnean Society of New South Wales 106: 311–321. White ME, 1990. The Flowering of Gondwana: the 400 million year story of Australia’s plants. Princeton University Press, Princeton, NJ. Yeh ZY, Chen ZC, Kimbrough JW, 2000. Ganoderma australe from Florida. Mycotaxon 75: 233–240. Zervakis G, Moncalvo JM, Vilgalys R, 2004. Molecular phylogeny, biogeography and speciation in the mushroom species Pleurotus cystidiosus and allied taxa. Microbiology 150: 715–726.