[Cancer Biology & Therapy 6:3, 354-359; March 2007]; ©2007 Landes Bioscience
Research Paper
IGFBP7 Plays a Potential Tumor Suppressor Role in Colorectal Carcinogenesis Wenjing Ruan1,† Enping Xu1,† Fangying Xu1,4 Yu Ma1 Hong Deng1 Qiong Huang1 Bingjian Lv1 Hu Hu1 Jie Lin1 Jing Cui1 Meijuan Di2 Jiankang Dong3 Maode Lai1,*
Abstract
OT D
Introduction
IST
RIB
UT E
.
Insulin‑like growth factor binding protein‑7 (IGFBP7) is a gene identified as being low expressed in colorectal adenocarcinoma (CRC) cell lines. In the current study, we investi‑ gated the function of IGFBP7 in CRC by transfection studies. We found that IGFBP7 could inhibit cell growth, decrease soft agar colony formation activity and induce apoptosis in RKO and SW620 cells. Correlation analysis between the expression of IGFBP7 in CRC tissue and the prognosis in 218 patients showed that high expression of IGFBP7 was associated with favorable prognosis. Based on above results, we conclude that IGFBP7 plays a potential tumor suppressor role in colorectal carcinogenesis.
2Department of Pathology; the People's No.1 Hospital of Xiaoshan; Hangzhou, China
4Department of Basic Medicine; Hangzhou Teachers College; Hangzhou, China
IEN
3Xiaoshan Center for Disease Control and Prevention; Hangzhou, China
CE
1Department of Pathology; School of Medicine; Zhejiang University; Hangzhou, China
.D
ON
The insulin‑like growth factor (IGF) system is central to many important pathways regulating cell growth and apoptosis in cells.1 The IGF system is a finely tuned network formed by IGFs and insulin‑like growth factor binding‑proteins (IGFBPs), which cooperate in regulating signals from insulin receptors and IGF receptors. Specifically, IGFBPs prolong IGF half‑life in the circulation and the extracellular space, and may influence the delivery of IGFs to signaling receptors on the cell surface.2 However, in neoplasia, especially during the transition from the benign to the malignant state, qualitative and quantitative abnormalities of the IGF system are frequently observed: for example, high levels of expression IGF‑1 and IGFBP3 have been correlated with high risk of several epithelial cancers, including breast and prostate cancer, and possibly lung cancer.3 There is increasing evidence showing that IGFs and IGFBPs could be included in the panel of specific markers used for histopathological diagnosis and serological surveillance procedures in various malignancies.4 IGFBP7 has been cloned independently and variously named mac25, tumor‑derived adhesion factor (TAF), prostacyclin‑stimulating factor (PSF), and insulin‑like growth factor binding‑protein‑related protein 1(IGFBP‑rP1), respectively.5‑8 IGFBP7 was originally cloned as a gene whose expression was decreased in meningioma cell lines.9 Subsequently, it was shown to be a senescence‑associated gene in human mammary epithelial cells.10 IGFBP7 exhibited low affinity for the known IGFBP ligands, IGF‑I, and IGF‑II, indicating that its individual characteristics differ from the other members of the IGFBP family.11 IGFBP7 expression has been reported in many tumors. However, the expression pattern varies with tumor type. For example, upregulated expression of IGFBP7 is observed in cerebrospiral fluid of children with acute lymphoblasma leukemia,12 while downregulated expression of IGFBP7 is common in tumors from liver and in meningiomas.13,14 With regard to breast cancer and prostate cancer, both up‑ and downregulation of IGFBP7 have been reported.15‑18 In colorectal carcinoma (CRC) tissue, IGFBP7 was reported to be overexpressed.19 In a previous study, we separated the cDNA fragments of IGFBP7 from colonic adenocarcinoma and normal mucosa cDNA subtraction libraries by suppressive subtractive hybridization (SSH).20 By using reverse transcription polymerase chain reaction (RT‑PCR) and immunohistochemistry, we confirmed the overexpression of IGFBP7 in CRC tissue, compared to the paired normal tissue.21 It has also been reported that the expression of IGFBP7 in invading tumor cells correlates with poor prognosis in human CRC,22 suggesting that IGFBP7 may play a positive role in tumor progression. However, our in vitro experiments performed in CRC cell lines showed that the expression of IGFBP7 was only detectable in the SW480 cell line, but not in most other cell lines, including SW620, RKO, Hce8693 and HT29.23 It thus raises the question, whether the functional role of
†These authors contributed equally to the work.
ES
Original manuscript submitted: 10/29/06 Manuscript accepted: 12/12/06
BIO
SC
*Correspondence to: Maode Lai; Department of Pathology; School of Medicine; Zhejiang University; Hangzhou 310058 China; Tel.: +86.571.88208197; Fax: +86.571.87951358; Email:
[email protected]
LA
Key words
ND
Previously published online as a Cancer Biology & Therapy E-publication: http://www.landesbioscience.com/journals/cc/abstract.php?id=3702
07
IGFBP7, colorectal cancer, growth inhibition, decreased colony formation, apoptosis, favourable prognosis, tumor suppressor gene
20
Acknowledgements
©
See page 358.
354
Cancer Biology & Therapy
2007; Vol. 6 Issue 3
IGFBP7: A Tumor Suppressor Gene in CRC
IGFBP7 in CRC can be determined merely by its expression pattern. In the current study, we therefore transfected and expressed IGFBP7 at a significant level in RKO cells and SW620 cells, two CRC cell lines which lack endogenous IGFBP7, to determine the functional role of IGFBP7 on CRC cells. Furthermore, we analyzed the clinical significance of the expression of IGFBP7 in CRC tissue, to help better define the exact role of IGFBP7 in CRC.
OT D
IST
RIB
UT E
Figure 1. Analysis of IGFBP7 expression in PcDNA3.1(IGFBP7)‑RKO and PcDNA3.1 (IGFBP7)‑SW620 transfectants. SW480, a CRC cell line express‑ ing endogenous IGFBP7 was used as a positive control. (A) RT‑PCR analysis of total RNA from the cells. Transcript of IGFBP7 is detected at 240kb as expected in PcDNA3.1(IGFBP7) transfected RKO cells and SW620 cells. The lower panel is for G3PDH. (B) Western blot analysis using anti‑IGFBP7 against culture medium from the cells. Mr 31,000 protein was detected in conditioned medium from PcDNA3.1(IGFBP7) transfected RKO cells and SW620 cells.
The proliferation rate of SW480 cells, a cell line with endogenous IGFBP7, which derived from the same patient as the SW620 cell line, was measured simultaneously. The experiments were carried out three times, with the same results. Anchorage‑independent growth assay. Stable PcDNA3.1 (IGFBP7) transfectants and control vector transfectants (500/well) were seeded into 0.3% Bacto‑agar (Sigma, St Louis, MO, USA) over a 0.6% agar bottom layer in triplicate in 6‑well plates. Both layers contained RPMI 1640 supplemented with 10% FBS. Plates were incubated in a 37˚C/5% CO2, humid atmosphere for three weeks. Colonies were counted using a dissecting microscope. The wells were then analyzed for colony number and size. Colonies >100 mm in diameter were counted under a dissecting microscope. Three independent experiments were conducted. The experiments were carried out three times, with the same result. Cellular apoptosis assays. Cells were collected at 48 h after transient transfection. The floating cells were collected by centrifugation, whereas adherent cells were harvested by trypsin‑EDTA solution. The harvested cells were washed with phosphate‑buffered saline (PBS) twice. For annexin/V and PI double staining assay, the cells were resuspended in pre-diluted binding buffer and stained with Annexin V/ FITC (Becton Dicknson, San Jose, CA, USA) for 10 min at room temperature, protected from light. Cells were then washed and resuspended in binding buffer. After adding PI (Becton Dickinson), cells were analyzed immediately by flow cytometry using ModFit 3.0 LTTM Software (Verity Software House). For DNA content analysis, cells were treated with PBS containing 0.25 mg/ml RNase at 37˚C for 15 min and then incubated with 50 mg/ml PI at 4˚C for 15 min in the dark. The stained cells were analyzed using Cell Quest software 6.0. Cellular apoptosis was also confirmed by transmission electron microscopy. Briefly, cells were fixed in 2.5% glutaraldehyde for 2h at 4˚C and then 1% osmium tetroxide for 1h at 4˚C. After dehydration in a graded series of ethanol and infiltration in propylene oxide, cells were embedded in Epon 812. Sixty‑nm ultrathin sections were stained with uranyl acetate and lead citrate, and examined in a +Philips Tecnai 10 transmission electron microscopy at 80 KV. Three independent experiments were conducted for the above apoptosis detection assay.
©
20
07
LA
ND
ES
BIO
SC
IEN
CE
.D
ON
Samples. Human CRC RKO cells, SW620 cells and SW480 cells were maintained in RPMI 1640 (GIBCO, Grand Island, NY, USA) supplemented with 10% FBS (HyClone Laboratories, Logan, UT, USA) in a 37˚C/5% CO2 atmosphere. Two hundred and eighteen patients with primary CRC taken from the Xiaoshan tumor registry system during 1990‑2000 were included in this study. Those dying within 30 days of surgery or of causes other than CRC were excluded. Detailed clinical and pathologic data were retrieved from a computerized database of the Xiaoshan tumor registry system. Among the 218 cases, there were 117 men and 101 women, and the mean age at the time of operation was 59 (range 26‑85). There were 70 colon cancers and 148 rectal cancers. Follow‑up period ranged from 1 to 152 months, with a median 50 months and mean 56 months follow‑up. This study had the approval of the local research ethics committee. Transfection. Full length IGFBP7 coding sequence was digested by BamHI from PL(BP7)SN (from Dr. Swisshelm, University of Washington, Seattle, USA) and ligated into the BamHI site of the PcDNA 3.1/myc‑His(‑B) expression vector(from Dr. Cao, institute of immunology, Zhejiang University) to generate PcDNA3.1(IGFBP7). DNA sequencing analysis confirmed the fidelity of the constructs. Transfection of PcDNA3.1(IGFBP7) into RKO cells and SW620 cells was performed using polyfect transfection reagent (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. Control cells were produced by transfecting with PcDNA3.1/myc‑His(‑B) alone. Stable transfectants were obtained after selection in 500 µg/ml G418 for two weeks. RT‑PCR and Western blot. Details of procedures for RT‑PCR detection of IGFBP7 have been previously described.21 The primers for IGFBP7 were sense (exon 2) 5'‑cactggtgcccaggtgtact‑3' and antisense (exon 4) 5'‑ttggatgcatggcactcatat‑3'. The primers for G3PDH were 5'‑accacagtccatgccatcac‑3' and 5'‑tccaccaccctgttgctgta‑3'. PCR amplification was performed for 5 min at 95˚C, followed by 24 cycles of denaturation (95˚C, 30 s), annealing (59˚C, 30 s) and extension (72˚C, 30 s). Concentrated culture medium (20 ml from 7 ml culture medium) was loaded onto 12% SDS‑polyacrylamide gels, transferred onto nitrocellulose membranes, and subjected to Western blot analysis.24 Polyclonal antibody of IGFBP7 was purchased from Santacruz Biologicals (CA, USA). Horseradish peroxidase‑conjugated secondary antibodies were purchased from Zymed (San Francisco, CA, USA). Cell proliferation assay. Cell proliferation of stably transfected RKO and SW620 cells was measured using the cell counting kit‑8 (CCK‑8, Dojindo Laboratories, Japan). In brief, stable PcDNA3.1(IGFBP7) transfectants, control vector transfectants, and parental cells were plated in sextuple in 96‑well microtitre plates at 3 x 103/well. Ten microliters of CCK8 was added to each well at the time of harvest, according to the manufacturer’s instructions. Two hours after adding CCK8, cellular viability was determined by measuring the absorbance of the converted dye at 450 nm.
.
Materials and Methods
www.landesbioscience.com
Cancer Biology & Therapy
355
IGFBP7: A Tumor Suppressor Gene in CRC
©
20
07
LA
ND
ES
BIO
SC
IEN
CE
.D
ON
OT D
IST
RIB
UT E
.
microscope until agreement was achieved. Intensity of staining was designated as negative (0), positive (1), strongly positive (2) and the percentage of positive cells was scored as less than 5% (0), 5–25% (1), 26–50% (2), 51–75% (3) or over 75% (4) of cells stained. These values were multiplied together to provide composite score for IGFBP7 expression. According to the composite score, cases were finally grouped as 0 (0, 1), 1( 2, 3, 4) and 2 (6, 8). We designated composite score of 0 as IGFBP7 negative, and 1 and 2 as IGFBP7 positive. Prognostic variables. Prognostic variables analyzed in this study included: 1) clinical factors: age (≤60, 61–75, ≥75), sex, family cancer history, smoking and drinking history, location of tumor (colon and rectum), size of tumor (≤4 cm, 4–6 cm, ≥6 cm), presence or absence of distant metastasis, management protocol (surgery, surgery with chemotherapy, surgery with radiotherapy), presence of clinical bleeding (+, ++, +++, ++++), urine glucose, plasma glucose, serum carcinoembryonic antigen (CEA) level (100 m of PcDNA3.1 (IGFBP7) transfectants and control cells is shown. ****p = analysis was performed using SPSS 10.0 for 0.0004 for RKO transfectants versus control, *****p = 0.0026 for SW620 transfectants versus control). Windows. Cumulative 5‑year survival rate Values are mean ± S.D for data from three independent experiments. was calculated using life‑table methods and Kaplan‑Meier survival curves and the log Immunohistochemical staining and scoring of IGFBP7 in CRC rank test were used to analyze survival difference. The Cox’s proportissue. Immunohistochemical staining for IGFBP7 was performed as tional hazards model was used to assess the independent prognostic previously described.21 The intensity and proportion of the staining significance of factors. Factors significant (p < 0.05) in the univariate of tissue slides was evaluated independently by three patholo- study were introduced to multivariate Cox proportional hazard gists who were blinded to patients’ characteristics and survival. model. The Fisher’s exact test was used for testing relationships Cases with disagreement were discussed using a multi‑headed between the IGFBP7 expression and clinicopathological factors. 356
Cancer Biology & Therapy
2007; Vol. 6 Issue 3
IGFBP7: A Tumor Suppressor Gene in CRC
IST
RIB
UT E
.
Figure 3. Effect of IGFBP7 overexpression on apoptosis of RKO cells and SW620 cells. Forty‑eight hours post transfection, the cells were harvested and analyzed. (A) Flow cytometric analysis of cellular apoptosis using Annexin V/PI double staining. Percentages of early apop‑ totic cells (Annexin V positive, PI negative) and late apoptotic or necrotic cells (Annexin V/PI double positive) were calculated. (B) Analysis of the DNA content of cells using PI staining. The data of the sub‑G1 area indicated that 48 h after transfection, PcDNA3.1(IGFBP7) transfected cells had a significant population of cell apop‑ tosis in the sub‑G1 area compared with control. (C) Detection of IGFBP7‑induced apoptosis in RKO cells and SW620 cells by transmission electron microscopy analysis. Chromatin con‑ densation and margination were observed after transfection of IGFBP7 into RKO cells and SW620 cells. The displayed result above is representive of three independent experiments.
OT D
Results
©
20
07
LA
ND
ES
BIO
SC
IEN
CE
.D
ON
IGFBP7 inhibited the growth and decreased soft agar colony formation of RKO cells and SW620 cells. Expression of IGFBP7 in the PcDNA3.1(IGFBP7) transfectants was verified by RT‑PCR and Western Table 1 Univariate analysis and multivariate analysis of IGFBP7 blot. SW480 cells with the expression of endogenous expression in colorectal carcinoma IGFBP7 was used as positive control (See Fig. 1). The proliferation rate of IGFBP7 transfectants Univariate Analysis Multivariate Analysis † decreased significantly (p = 0.0066 for RKO/IGFBP7 Variable versus control, p < 0.0001 for SW620/IGFBP7 versus Relative 95% CI P Relative 95% CI P control (Fig. 2A). Interestingly, the proliferation rate of Risk Risk SW480 cells, which normally expressed IGFBP7 and IGFBP7 0.381 0.174‑0.834 0.016 0.319 0.132‑0.773 0.011 derived from the same patient as SW620, was signifi- positive* cantly slower than SW620 (p = 0.0108). Colony‑forming † activity in the IGFBP7 transfectants was significantly *The value shown of IGFBP7 positive was in comparision with IGFBP7 negative. IGFBP7 was adjusted for prognostic variables (ages, sex, chemotherapy, histological type, histological grade, the depth of infiltration degree, vessel invasion, perineural lower than the control empty vector transfectants (p invasion, peritumor lymphocyte, the Crohn’s like reaction, tumor budding, metastasis in lymph node, metastasis, TNM stage) = 0.0004 for RKO/IGFBP7 versus control, p = 0026 in multivariate analysis. for SW620/IGFBP7 versus control; (Fig. 2B and D). Expression of IGFBP7 correlates with favorable prognosis in Clone size was smaller in IGFBP7‑RKO and IGFBP7‑SW620 transfectants in comparison to the control (Fig. 2C), which confirmed CRC. Immunostaining of IGFBP7 was detected in 205 (94.0%) of that IGFBP7 could reduce the proliferation rate of these two types 218 colorectal cancer tumors. According to the composite scores, 12 (5.5%), 145 (66.5%) and 61 (28.0%) carcinomas were accorded of CRC cells. IGFBP7 induced apoptosis in both RKO cells and SW620 cells. scores of 0, 1, 2, with overall five‑year survival rates of 41.67%, To assess if IGFBP7 could induce apoptosis in RKO cells and SW620 68.49% and 68.51%, respectively (p = 0.019 for 0 score group versus cells, we performed FITC‑conjugated annexin V/PI staining followed 1 score group, p = 0.015 for 0 versus 2 group, p = 0.778 for 1 versus by flow cytometry (FCM) analysis. The percentages of annexin V 2 group). Univariate analysis showed that distant metastasis, positive positive cells (apoptotic cells, including PI+ and PI‑) are shown in urine glucose, higher histological grade, deeper invasion, vascular and neural invasion, increased tumor budding, peritumoral‑lymphocytic Figure 3A. Early (lower right) and late apoptotic (upper right) cells infiltration, Crohn’s like reactivity, and later TNM stage correlated were prominent in cell cultures 48 h post‑transfection with IGFBP7, with poorer survival. When factors significant in the univariate study while this was relatively rare in control vector‑transfected cells. FCM were introduced to the multivariate Cox proportional hazard model, analysis of PI‑stained cells was also performed to investigate the apop- distant metastasis, urine glucose, tumor budding, peritumoral‑lymtosis induced by IGFBP7 in RKO cells and SW620 cells. Forty eight phocytic infiltration, lymph node metastasis and the composite hours after transfection, a sub‑G1 (apoptotic) peak occurred in the scores of IGFBP7 expression were identified as independent factors IGFBP7 transfected cells, while this was relatively rare in the control for prognosis. Univariate analysis and multivariate analysis of empty vector transfected cells (Fig. 3B). Chromatin condensation and IGFBP7 expression in CRC is shown in Table 1. Patients with posimargination were also observed by electron microscopy after transfec- tive IGFBP7 expression had a better survival rate compared with tion of IGFBP7 into RKO cells and SW620 cells (Fig. 3C). patients with negative IGFBP7 expression (p = 0.012, Fig. 4). www.landesbioscience.com
Cancer Biology & Therapy
357
IGFBP7: A Tumor Suppressor Gene in CRC
Discussion
IST
ON
Our study demonstrated that overexpression of IGFBP7 reduced the growth proliferation and decreased the soft agar colony formation activity in two types of CRC cells, RKO cells and SW620 cells. Increased apoptotic rate may contribute to the growth inhibition process. Correlation analysis between the expression of IGFBP7 in CRC tissue and its clinical significance indicated that high expression of IGFBP7 correlated with favorable prognosis in CRC. Both the findings about IGFBP7 in CRC cell lines and CRC tissue indicated that IGFBP7 played a potential tumor suppressor role in colorectal carcinogenesis. To our knowledge, this is the first study to investigate the functional role of IGFBP7 in CRC. Studies from other laboratories also demonstrated that IGFBP7 could inhibit the growth of other human cancer cells, including breast cancer cells,24 human prostate cancer cells,27 human cervical carcinoma cells (HeLa) and murine embryonic carcinoma cells (P19), as well as osteosarcoma cells (Saos‑2).28 Up to now, in vitro studies on the role of IGFBP7 in cancer cells reached the same conclusion, that IGFBP7 has a negative effect on the growth of cancer cells. These results are consistent with the postulation of a tumor‑suppressor role of IGFBP7 from its derivation as a senescence‑associated gene.10 Interestingly, other research also demonstrated that IGFBP7 was a potential apoptosis inducible gene in prostate cancer,15,27 indicating that inducing apoptosis may be one of the mechanisms inhibiting the tumor cell growth. The present finding that IGFBP7 possesses growth‑inhibitory and apoptosis‑inducing roles in CRC cell lines indicated that IGFBP7 plays a potential tumor suppressor role in CRC cells. These results were in agreement with our previous finding that IGFBP7 was almost absent in CRC cell lines. The high expression of IGFBP7 in CRC tissue correlating with favorable prognosis can be argued as the tumor suppressor role of IGFBP7. However, our finding is in contrast to the results of Adachi et al.22 They found that high expression of IGFBP7 in invasive tumor cells was associated with poor prognosis. This discrepancy may be due to the difference in the immunohistochemical scoring. Adachi et al. judged the sections with
OT D
Figure 4. Survival analysis of colorectal cancer patients with IGFBP7 positive and IGFBP7 negative expression. According to the composite score, cases were finally grouped as 0 (0, 1), 1 (2, 3, 4) and 2 (6, 8). We designated 0 in composite score as IGFBP7‑, 1 and 2 in composite score as IGFBP7+. The analysis was generated according to the Kaplan‑Meier method.
RIB
UT E
.
cytoplasmic immunostaining signals in > 30% of carcinoma cells in the invasive front to be positive for IGFBP7. This represents a rather restrictive measure since only a limited and poorly defined tumor compartment is assessed. In our study, we used the composite score to evaluate the expression of IGFBP7, which seems to be one of the most promising and accurate scoring systems currently defined.29 Moreover, the number of patients analyzed by Adachi et al. was 89, rather smaller than that of our study (n = 218). It is interesting that the potential tumor suppressor protein IGFBP7 we demonstrated above was overexpressed in CRC tissue compared to normal colon tissue. However, relying on only the expression pattern of a gene in cancer tissue is insufficient to reach a conclusion on its exact functional role. Interestingly, the protein maspin, which was identified with strong, almost uniform IHC staining, as well as high expression in an expanded set of pulmonary carcinomas, has also been considered a suppressor protein.30 As for IGFBP7, this may be an antitumor self‑defense mechanism, whose secretion may slow down the growth of cancer cells as a protection to the human body, which ultimately leads to the overexpression of IGFBP7 in CRC tissue. In summary, our results demonstrated that IGFBP7 inhibited growth and induced apoptosis in RKO cells and SW620 cells. High expression of IGFBP7 in CRC tissue was associated with favorable prognosis. These results indicated that IGFBP7 plays a potential tumor suppressor role in colorectal carcinogenesis. Further research exploring the molecular mechanism is needed. Acknowledgements
©
20
07
LA
ND
ES
BIO
SC
IEN
CE
.D
We would like to thank Dr. Karen Swisshelm, The University of Washington, at Seattle, for the generous gift of the plasmid PL(BP7)SN, Mari Swift, the University of Washington, at Seattle, Janice Lee, Harvard University and Tao Wang for stimulating discussions and revision of the manuscript. This work was supported by grants from the National Natural Science Foundation of China (NSFC 30200333, 30570840).
358
Reference
1. Hwa V, Oh Y, Rosenfeld RG. The insulin‑like growth factor‑binding protein (IGFBP) superfamily. Endocr Rev 1999; 20:761‑87. 2. Clemmons DR. Role of insulin‑like growth factor binding proteins in controlling IGF actions. Mol Cell Endocrinol 1998; 140:19‑24. 3. Voskuil DW, Vrieling A, van’t Veer LJ, Kampman E, Rookus MA. The insulin‑like growth factor system in cancer prevention: Potential of dietary intervention strategies. Cancer Epidemiol Biomarkers Prev 2005; 14:195‑203. 4. Zumkeller W. IGFs and IGFBPs: Surrogate markers for diagnosis and surveillance of tumour growth? Mol Pathol 2001; 54:285‑8. 5. Akaogi K, Okabe Y, Funahashi K, Yoshitake Y, Nishikawa K, Yasumitsu H, Umeda M, Miyazaki K. Cell adhesion activity of a 30‑kDa major secreted protein from human bladder carcinoma cells. Biochem Biophys Res Commun 1994; 198:1046‑53. 6. Yamauchi T, Umeda F, Masakado M, Isaji M, Mizushima S, Nawata H. Purification and molecular cloning of prostacyclin‑stimulating factor from serum‑free conditioned medium of human diploid fibroblast cells. Biochem J 1994; 303:591‑8. 7. Akaogi K, Okabe Y, Sato J, Nagashima Y, Yasumitsu H, Sugahara K, Miyazaki K. Specific accumulation of tumor‑derived adhesion factor in tumor blood vessels and in capillary tube‑like structures of cultured vascular endothelial cells. Proc Natl Acad Sci USA 1996; 93:8384‑9. 8. Oh Y, Nagalla SR, Yamanaka Y, Kim HS, Wilson E, Rosenfeld RG. Synthesis and characterization of insulin‑like growth factor‑binding protein (IGFBP)‑7: Recombinant human mac25 protein specifically binds IGF‑I and ‑II. J Biol Chem 1996; 271:30322‑5. 9. Murphy M, Pykett MJ, Harnish P, Zang KD, George DL. Identification and characterization of genes differentially expressed in meningiomas. Cell Growth Differ 1993; 4:715‑22. 10. Swisshelm K, Ryan K, Tsuchiya K, Sager R. Enhanced expression of an insulin growth factor‑like binding protein (mac25) in senescent human mammary epithelial cells and induced expression with retinoic acid. Proc Natl Acad Sci USA 1995; 92:4472‑6. 11. Kim HS, Nagalla SR, Oh Y, Wilson E, Roberts Jr CT, Rosenfeld RG. Identification of a family of low‑affinity insulin‑like growth factor binding proteins (IGFBPs): Characterization of connective tissue growth factor as a member of the IGFBP superfamily. Proc Natl Acad Sci USA 1997; 94:12981‑6.
Cancer Biology & Therapy
2007; Vol. 6 Issue 3
UT E RIB IST OT D
©
20
07
LA
ND
ES
BIO
SC
IEN
CE
.D
ON
12. How HK, Yeoh A, Quah TC, Oh Y, Rosenfeld RG, Lee KO. Insulin‑like growth factor binding proteins (IGFBPs) and IGFBP‑related protein 1‑levels in cerebrospinal fluid of children with acute lymphoblastic leukemia. J Clin Endocrinol Metab 1999; 84:1283‑7. 13. Komatsu S, Okazaki Y, Tateno M, Kawai J, Konno H, Kusakabe M, Yoshiki A, Muramatsu M, Held WA, Hayashizaki Y. Methylation and downregulated expression of mac25/insulin‑like growth factor binding protein‑7 is associated with liver tumorigenesis in SV40T/t antigen transgenic mice, screened by restriction landmark genomic scanning for methylation (RLGS‑M). Biochem Biophys Res Commun 2000; 267:109‑17. 14. Watson MA, Gutmann DH, Peterson K, Chicoine MR, Kleinschmidt‑DeMasters BK, Brown HG, Perry A. Molecular characterization of human meningiomas by gene expression profiling using high‑density oligonucleotide microarrays. Am J Pathol 2002; 161:665‑72. 15. Sprenger CC, Damon SE, Hwa V, Rosenfeld RG, Plymate SR. Insulin‑like growth factor binding protein‑related protein 1 (IGFBP7) is a potential tumor suppressor protein for prostate cancer. Cancer Res 1999; 59:2370‑5. 16. Degeorges A, Wang F, Frierson Jr HF, Seth A, Chung LW, Sikes RA. Human prostate cancer expresses the low affinity insulin‑like growth factor binding protein IGFBP7. Cancer Res 1999; 59:2787‑90. 17. Seth A, Kitching R, Landberg G, Xu J, Zubovits J, Burger AM. Gene expression profiling of ductal carcinomas in situ and invasive breast tumors. Anticancer Res 2003; 23:2043‑51. 18. Bieche I, Lerebours F, Tozlu S, Espie M, Marty M, Lidereau R. Molecular profiling of inflammatory breast cancer: Identification of a poor‑prognosis gene expression signature. Clin Cancer Res 2004; 10:6789‑95. 19. Umeda F, Ono Y, Sekiguchi N, Hashimoto T, Masakado M, Nakamura K, Chijiiwa Y, Nawata H. Increased mRNA expression of a novel prostacyclin‑stimulating factor in human colon cancer. J Gastroenterol 1998; 33:213‑7. 20. Luo MJ, Lai MD. Identification of differentially expressed genes in normal mucosa, adenoma and adenocarcinoma of colon by SSH. World J Gastroenterol 2001; 7:726‑31. 21. Shao LN, Huang Q, Luo M, Lai M. Detection of the differentially expressed gene IGF‑binding protein‑related protein‑1 and analysis of its relationship to fasting glucose in Chinese colorectal cancer patients. Endocr Relat Cancer 2004; 11:141‑8. 22. Adachi Y, Itoh F, Yamamoto H, Arimura Y, Kikkawa‑Okabe Y, Miyazaki K, Carbone DP, Imai K. Expression of angiomodulin (tumor‑derived adhesion factor/mac25) in invading tumor cells correlates with poor prognosis in human colorectal cancer. Int J Cancer 2001; 95:216‑22. 23. Shao LN, Huang Q, Luo MJ, Lai MD. Study of B2 gene structure and its expression in colorectal cancer. Zhonghua Bing Li Xue Za Zhi 2003; 32:14‑9, [Article in Chinese]. 24. Wilson HM, Birnbaum RS, Poot M, Quinn LS, Swisshelm K. Insulin‑like growth factor binding protein‑related protein 1 inhibits proliferation of MCF‑7 breast cancer cells via a senescence‑like mechanism. Cell Growth Differ 2002; 13:205‑13. 25. �������������������������������������������������������������������������������������� Lu BJ, Lai M, Cheng L, Xu JY, Huang Q. ����������������������������������������������� Gastric medullary carcinoma, a distinct entity associated with microsatellite instability‑H, prominent intraepithelial lymphocytes and improved prognosis. Histopathology 2004; 45:485‑92. 26. Ueno H, Murphy J, Jass JR, Mochizuki H, Talbot IC. Tumour ‘budding’ as an index to estimate the potential of aggressiveness in rectal cancer. Histopathology 2002; 40:127‑32. 27. Mutaguchi K, Yasumoto H, Mita K, Matsubara A, Shiina H, Igawa M, Dahiya R, Usui T. Restoration of insulin‑like growth factor binding protein‑related protein 1 has a tumor‑suppressive activity through induction of apoptosis in human prostate cancer. Cancer Res 2003; 63:7717‑23. 28. Kato MV. A secreted tumor‑suppressor, mac25, with activin‑binding activity. Mol Med 2000; 6:126‑35. 29. Spano JP, Lagorce C, Atlan D, Milano G, Domont J, Benamouzig R, Attar A, Benichou J, Martin A, Morere JF, Raphael M, Penault‑Llorca F, Breau JL, Fagard R, Khayat D, Wind P. Impact of EGFR expression on colorectal cancer patient prognosis and survival. Ann Oncol 2005; 16:102‑8. 30. Welsh JB, Sapinoso LM, Kern SG, Brown DA, Liu T, Bauskin AR, Ward RL, Hawkins NJ, Quinn DI, Russell PJ, Sutherland RL, Breit SN, Moskaluk CA, Frierson Jr HF, Hampton GM. Large scale delineation of secreted protein biomarkers overexpressed in cancer tissue and serum. Proc Natl Acad Sci USA 2003; 100:3410 5.
.
IGFBP7: A Tumor Suppressor Gene in CRC
www.landesbioscience.com
Cancer Biology & Therapy
359
