Reproductive Toxicology 26 (2008) 138–145
Contents lists available at ScienceDirect
Reproductive Toxicology journal homepage: www.elsevier.com/locate/reprotox
Endosulfan modulates estrogen-dependent genes like a non-uterotrophic dose of 17-estradiol ˜ Jorgelina Varayoud, Lucas Monje, Tania Bernhardt, Mónica Munoz-de-Toro, Enrique H. Luque, Jorge G. Ramos ∗ Laboratorio de Endocrinología y Tumores Hormonodependientes, School of Biochemistry and Biological Sciences, Universidad Nacional del Litoral, Santa Fe, Argentina
a r t i c l e
i n f o
Article history: Received 28 May 2008 Received in revised form 28 July 2008 Accepted 15 August 2008 Available online 23 August 2008 Keywords: Endosulfan Uterus 17-Estradiol Progesterone receptor Estrogen receptor Complement factor-3 Xenoestrogens
a b s t r a c t The estrogenic activity of environmentally relevant doses of endosulfan was investigated using an animal model. Ovariectomized adult rats were injected once a day for 3 days with sesame oil (control), 0.02 mg/kg/day 17-estradiol (an uterotrophic dose; UE2 ), 0.0002 mg/kg/day 17-estradiol (a nonuterotrophic dose; NUE2 ), or 0.006, 0.06, 0.6 or 6 mg/kg/day endosulfan. After 24 h of treatment, the uteri were weighed (uterotrophic assay) and the luminal epithelial cell height (LECH) and progesterone receptor (PR), and estrogen receptor alpha (ER␣) protein levels were measured. PR, ER␣, and complement factor-3 (C3) mRNAs were evaluated using real-time PCR. Uterine weight and LECH were only increased in UE2 -treated rats. PR, ER␣ and C3 expression levels were modified in most of the endosulfan-treated groups, showing an identical pattern of expression to the NUE2 -group. Our results show that the pesticide endosulfan mimics non-uterotrophic E2 actions, strengthening the hypothesis that endosulfan is a widespread xenoestrogen. © 2008 Elsevier Inc. All rights reserved.
1. Introduction Environmental estrogens (xenoestrogens) are a diverse group of chemicals that have been associated with adverse effects on wildlife and domestic animals, and may potentially produce adverse health effects on humans by interfering with the endocrine system [1–4]. Endosulfan is a manufactured organochlorine pesticide that is used to control a number of insects on food crops such as grains, tea, fruits, and vegetables, and on nonfood crops such as tobacco and cotton. Human exposure to organochlorine compounds has been extensively documented in different world regions, especially those with intensive agricultural activity [4–7]. An acceptable oral reference dose (RfD) of 0.006 mg/kg/day endosulfan has been set by different regulatory agencies [8]. The RfD and the acceptable daily intake (ADI) were established on the basis of a no observed effect level (NOEL) of 0.6 mg/kg/day and the application of an uncertainty factor of 100 to account for inter- and intra-species variability [8,9].
∗ Corresponding author at: Laboratorio de Endocrinología y Tumores Hormonodependientes, School of Biochemistry and Biological Sciences, Universidad Nacional del Litoral, Casilla de Correo 242, 3000 Santa Fe, Argentina. Tel.: +54 342 4575207; fax: +54 342 4575207. E-mail address:
[email protected] (J.G. Ramos). 0890-6238/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.reprotox.2008.08.004
Some in vitro approaches have demonstrated that endosulfan shows estrogenic properties. Endosulfan was able to activate the AF2 function of ER␣ in vitro and showed agonist activity in estrogen-responsive myometrial cells as determined by the induction of proliferation and increased PR message levels [10]. Using an ER␣-transfected HELN cell line, it has been shown that endosulfan competes with estradiol for binding to ER␣, and that it is able to transactivate ER␣ and induce the transcription of an EREdependent gene construct [11]. In contrast, very few reports have tackled the problem of endosulfan’s estrogenic activity using in vivo conditions and doses mimicking human exposure. Using immature CD-1 mice subcutaneously injected with a wide range of doses of endosulfan, Newbold et al. have shown that this pesticide did not increase the uterine wet weight or the epithelial cell height [12]. However, using a very high dose (10 mg/kg/day) the authors showed that endosulfan was able to increase the uterine gland number, lactoferrin and C3 protein expression, and PCNA-labelled cells. These results suggest that endosulfan acts as an estrogen at very high doses; however, little is known about the hormone activity of this compound at environmentally relevant low doses. A previous study evaluated the reproductive effects of perinatal exposure to endosulfan on the male offspring born from Wistar rats exposed to 1.5 and 3.0 mg/kg/day from day 15 of pregnancy to postnatal day (PND) 21 of lactation [13]. The authors reported adverse reproductive effects (e.g., decreases in the daily sperm production
J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
and percentage of seminiferous tubules with complete spermatogenesis) in the male offspring of rats exposed to 3.0 mg/kg/day of endosulfan. Surprisingly, in another report these authors showed a significant increase in the relative epididymis weight in the male offspring pre- and post-natally exposed to 0.5 mg/kg/day of endosulfan, but not in the offspring exposed to a higher dose (1.5 mg/kg/day) [14]. These results suggest the hypothesis that low doses of endosulfan, like many other endocrine disruptors, may interfere with endocrine-related processes. The in vivo estrogenic activity of an endocrine disruptor is often determined by comparing the tested compound with a positive control substance (like 17-estradiol or diethylstilbestrol). The doses used in positive control groups are selected to effectively produce the classic and expected estrogenic response. However, the low dose effects of endocrine disruptor compounds are often difficult to interpret due to, at least in part, the design of the positive controls [15,16]. In this report, we demonstrate that, at a molecular level of organization, an uterotrophic dose of E2 produces different responses than a non-uterotrophic dose. Moreover, endosulfan is able to mimic the sub-uterotrophic E2 actions, strengthening the hypothesis that this compound is a widespread xenoestrogen. 2. Materials and methods 2.1. Chemicals 17-Estradiol was purchased from Sigma Chemical Co. (St. Louis, MO, USA) and endosulfan (98% of purity) was provided by Chem Service (West Chester, PA, USA). 2.2. Experimental design Sexually mature female rats (90 days old) of an inbred Wistar-derived strain bred at the Department of Human Physiology (Santa Fe, Argentina) were used. Animals were maintained under a controlled environment (22 ± 2 ◦ C; lights on from 06:00 to 20:00 h) and had free access to pellet laboratory chow (Cooperación, Buenos Aires, Argentina) and tap water. All rats were handled in accordance with the principles and procedures outlined in the Guide for the Care and Use of Laboratory Animals issued by the US National Academy of Sciences. The concentration of phytoestrogens in the diet was not evaluated; however, because feed intake was equivalent for control and experimental rats (unpublished observations) we assumed that all animals were exposed to the same levels of phytoestrogens. To minimize additional exposures to endocrine-disrupting chemicals, rats were housed in stainless steel cages with wood bedding, and tap water was supplied ad libitum in glass bottles with rubber stoppers surrounded by a steel ring. All experimental rats were ovariectomized (OVX) and then rested for 14 days. Those animals that exhibited at least 7 days of atrophic vaginal smears [17] were sc injected for three consecutive days with one of the following treatments: sesame oil (control group: 100 l/animal), E2 (with an uterotrophic dose of 0.02 mg/kg/day in the UE2 group or a non-uterotrophic dose of 0.0002 mg/kg/day in the NUE2 group); or varying doses of endosulfan: 0.006, 0.06, 0.6 or 6 mg/kg/day (Endo0.006, Endo0.06, Endo0.6, and Endo6 groups, respectively). All animals (6–8 rats/group) were sacrificed 24 h after the last injection and uteri were isolated. One uterine horn from each rat was placed immediately in liquid nitrogen and stored at −80 ◦ C for RNA extraction. The other uterine horn (1.5 cm) was weighed (uterotrophic assay) and then fixed by immersion in 10% formalin buffer for 6 h at 4 ◦ C, embedded in paraffin, and used for immunohistochemical staining. 2.3. RNA extraction and reverse transcription Each experimental group was comprised of 6–8 uterine horns. Individual uterine horns were homogenized in TRIzol reagent and total RNA was extracted following the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). The concentration of total RNA was assessed by A260 and the sample was stored at −80 ◦ C until needed. Equal quantities (4 g) of total RNA were reverse-transcribed in three independent experiments for 90 min at 37 ◦ C using 200 pmol of random hexamer primers (Promega, Madison, WI, USA), 100 nmol deoxynucleotide triphosphates and 300 U Moloney Murine Leukemia Virus reverse transcriptase (Promega) in a final volume of 30 l of 1× MMLV-RT buffer. Each reverse-transcribed product was diluted with RNase-free water to a final volume of 60 l.
139
were selected as classical targets of estrogen action in the OVX rat uterus [18]. Two genes were tested to normalize RNA inputs: ribosomal protein L19 (L19) and 18S rRNA. Gene-specific primer sequences are shown in Table 1 and were synthesized by Invitrogen. For amplifications, 5 l of diluted cDNA were combined with a mixture containing 2.5 U Platinum Taq-DNA polymerase (Invitrogen), 2 mM MgCl2 (Invitrogen), 0.2 mM of each of the four dNTPs (Promega), 1 l of 10× SYBR Green I and 10 pmol of each primer (Invitrogen) in a final volume of 25 l of 1× PCR buffer. The cycling conditions were as follows: after initial denaturation at 97 ◦ C for 1 min, the reaction mixture was subjected to successive cycles of denaturation at 97 ◦ C for 30 s, annealing at 60 ◦ C for 30 s, and extension at 72 ◦ C for 30 s. Product purity was confirmed by dissociation curves and random agarose gel electrophoresis. Controls containing no template DNA were included in all assays, yielding no consistent amplification. All PCR products were cloned using the TA cloning kit (Invitrogen) and specificity was confirmed by DNA sequencing (data not shown). For each analysis, a standard curve was prepared from eight serial dilutions of a standard sample containing equal amounts of cDNA from the different experimental groups. All standards and samples of each independent experiment were assayed in triplicate. 2.5. ER˛ and PR quantitative immunohistochemistry Uterine sections (5 m in thickness) were deparaffinized and dehydrated in graded ethanols. A standard immunohistochemical technique (avidin–biotinperoxidase) was used to visualize ER␣ and PR immunostaining intensity and distribution following a previously described protocol [18,19]. Immunostaining of steroid receptors was performed using a rabbit anti-human PR (A/B isoforms) antibody (1:500 dilution; Dako Corp., Carpinteria, CA, USA) and a mouse antihuman ER␣ antibody (clone 6F-11, 1:200 dilution; Novocastra, Newcastle upon Tyne, UK). Anti-rabbit/anti-mouse secondary antibodies (biotin conjugated) were purchased from Sigma. Reactions were developed using a streptavidin–biotin peroxidase method and diaminobenzidine (Sigma) as a chromogen substrate. Negative controls were performed by replacing the primary antibody with non-immune goat serum (Sigma). A well-established quantitative approach was performed whereby total ER␣ and PR protein expression was measured as a linear combination of the relative area occupied by the immunostained cells and the optical density as shown by immunostaining [20,21]. This linear combination constitutes the integral optical density (IOD) value, which is proportional to the protein content of each histological compartment [22]. The IOD was evaluated in digital images of each tissue section using a Spot Insight V3.5 color video camera (Diagnostic Instruments, Sterling Heights, MI, USA) attached to an Olympus BH2 microscope (illumination: 12-V halogen lamp, 100 W, equipped with a stabilized light source) with a Dplan 40× objective (numerical aperture = 0.65) (Olympus Optical Co. Ltd., Tokyo, Japan). The IODs of ER␣ and PR immunostaining were evaluated in the entire luminal and glandular epithelium of each tissue section and in the subepithelial stroma defined as a 300-m-wide area adjacent to the epithelium, from the basement membrane toward the outer layers. The image analysis was performed using the Image Pro-Plus 4.1.0.1® system (Media Cybernetics, Silver Spring, MA, USA), as previously described [21]. At least 10 fields of each histological compartment were recorded in each section and two sections per animal were evaluated. Correction of unequal illumination (shading correction) and calibration of the measurement system were performed with a reference slide. 2.6. Luminal epithelial cell height Uterine epithelial cell height was measured in Harris hematoxylin-stained uterine sections from the apical (luminal) surface to the basement membrane. All measurements were made in areas where luminal folds were not present and care was taken to avoid measuring sections that were cut obliquely. To spatially calibrate the Image Pro-Plus analyzer square grids from Neubauer chamber images were captured as in the above-described experimental conditions. 2.7. Data analysis All data were calculated as the mean ± S.E.M. We performed Kruskal–Wallis analysis to obtain the overall significance (testing the hypothesis that the response was not homogeneous across treatments), and differences between groups were determined using the Dunn post hoc test. P < 0.05 was accepted as significant.
3. Results 3.1. Uterotrophic assay
2.4. Quantitative real-time polymerase chain reaction (QPCR) ER␣, PR and C3 mRNA expression was quantified by real-time RT-PCR using the Real-Time DNA Engine Opticon System (Bio-Rad Laboratories Inc., Waltham, MA, USA) and SYBR Green I dye (Cambrex Corp., East Rutherford, NJ, USA). These genes
The results of the uterotrophic assay are summarized in Table 2. It is interesting to note that only the high dose of E2 (UE2 ) induced a significant increase (threefold) in the uterine wet weight (P < 0.05).
140
J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
Table 1 Primers and PCR products for gene expression analysis by Real-Time QPCR Gene
Primer sequence (5 –3 )
Estrogen receptor ␣ (ER␣) Progesterone receptor (PR) Complement component 3 (C3) Ribosomal protein L19 (L19)
Forward: ACTACCTGGAGAACGAGCCC Reverse: CCTTGGCAGACTCCATGATC Forward: GACCAGTCTCAACCAACTAGGC Reverse: ACACCATCAGGCTCATCCAG Forward: CTACCCCTTACCCCTCACTC Reverse: GTCTCTTCACTCTCCAGCCG Forward: AGCCTGTGACTGTCCATTCC Reverse: TGGCAGTACCCTTCCTCTTC Forward: TAAGTCCCTGCCCTTTGTACACA Reverse: GATCCGAGGGCCTCACTAAAC
18s rRNA
Neither the low dose of E2 (NUE2 ) nor the varying doses of endosulfan resulted in a positive uterotrophic assay.
Product size (bp)
Genbank accession no.
153
NM 012689
137
L16922
169
NW 047936
99
NM 031103
71
M11188
PR gene expression (Fig. 1B). It is important to emphasize that all endosulfan-treated animals showed significant differences in C3 and PR mRNA expression with UE2 -treated rats, however no differences could be detected between any endosulfan-treated group and the NUE2 group (Fig. 1A and B). Moreover, both doses of E2 and all endosulfan-treated groups showed a clear down-regulation of ER␣ mRNA compared with control rats (P < 0.05, Fig. 1C).
3.2. Morphometric analysis In the uterus of the OVX rodent, the increase in LECH is a hallmark of estrogen action and correlates with uterine wet weight induction. An approximate twofold increase in epithelial cell height was measured in the UE2 -treated animals compared with vehicleinjected, NUE2 and endosulfan-treated rats (P < 0.05, Table 2). No differences were obtained between NUE2 , endosulfan-treated rats and control animals (Table 2).
3.4. ER˛ and PR protein expression in different uterine histological compartments To determine if the influence of different E2 and endosulfan doses on estrogen-sensitive genes mRNA expression were extensive to protein expression, we quantified the relative ER␣ and PR protein levels in uterine horns of all experimental animals. In accordance with previous results [18], the high dose of E2 down-regulated ER␣ protein in all histological compartments as compared to vehicle-treated animals (P < 0.05, Fig. 2A–C). On the other hand, the non-uterotrophic dose of E2 down-regulated ER␣ only in the subepithelial stroma (P < 0.05, Fig. 2C). It is very interesting to note that most of the endosulfan-treated groups showed an identical pattern of changes when compared to the NUE2 -group (P > 0.05), exhibiting a down-regulation of ER␣ protein in the subepithelial stroma without changes in the luminal or glandular epithelium compared with control animals (P < 0.05, Fig. 2A–C). Fig. 4A–D shows ER␣ changes in different cellular compartments of the uterus. The immunohistochemical analysis showed that PR protein was strongly induced in the stroma of UE2 -treated animals, while a clear down-regulation was observed in the luminal and glandular epithelia (P < 0.05, Fig. 3A–C). In contrast, in NUE2 -treated animals, a significant decrease in PR was detected only in glandular epithelial cells without changes in the luminal epithelium or stroma compared with vehicle injected animals (P < 0.05). Once again, in all endosulfan-treated groups, the PR protein was modulated as in the non-uterotrophic E2 -treated rats (P > 0.05), with a decrease in the glandular epithelial expression (P < 0.05, Fig. 3A–C). Fig. 4E–H illustrates the PR protein changes observed in different cellular compartments.
3.3. Changes in the uterine estrogen-dependent genes elicited by estradiol and endosulfan Relative changes in uterine gene expression were determined using real-time RT-PCR analysis. Two control genes (L19 and 18S rRNA) were tested to confirm that RNA concentrations were similar across groups. L19 varied by no more than 1.2-fold across groups, whereas 18S rRNA showed an increase of 2.5-fold in the UE2 -treated animals (data not shown). Taking into account these results the L19 ribosomal protein cDNA was selected as an adequate internal control. Complement factor-3 is a classical estrogen regulated gene; its transcription is induced in the presence of estrogens via estrogen response elements in the promoter region [23]. As expected, the UE2 group had more than fourfold the uterine C3 mRNA content as control (P < 0.05, Fig. 1A). Surprisingly, the non-uterotrophic dose of E2 induced a significant decrease in C3 expression (NUE2 -treated animals compared to controls, P < 0.05, Fig. 1A). The same result was observed in most of the endosulfan-treated groups, where the C3 mRNA expression was significantly reduced (Fig. 1A). Only the highest dose of endosulfan (Endo6) did not cause differences in C3 mRNA expression compared to control rats. A very similar profile was obtained when the PR mRNA expression was examined. E2 was able to induce a 2.5-fold increase in PR mRNA in the UE2 -treated animals (P < 0.05, Fig. 1B), while samples from animals treated with the low dose of E2 and all endosulfan doses showed a decrease in Table 2 Uterine wet weights after 3 day administration of E2 or endosulfan to OVX adult rats Experimental group
Dose (mg/kg/day)
Control (vehicle) UE2 (high dose of E2 ) NUE2 (low dose of E2 ) Endo6 Endo0.6 Endo0.06 Endo0.006
– 0.02 0.0002 6 0.6 0.06 0.006
Uterine wet weight (mg/kg BW) 113.92 340.14 98.20 70.97 73.29 73.62 77.14
± ± ± ± ± ± ±
6.93a 38.27b 8.66a 12.33a 12.49a 6.57a 7.89a
Values are means ± S.E.M. (n = 6–8 rats/group). Different letters indicate statistically significant differences (p < 0.05).
Epithelial cell height (m) 12.39 25.41 12.28 12.54 12.52 13.64 12.72
± ± ± ± ± ± ±
0.93a 1.37b 1.27a 0.81a 0.96a 1.05a 0.83a
J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
Fig. 1. Real-time RT-PCR analysis was done to determine uterine expression levels of C3 (A), PR (B), and ER␣ (C) after treatment. Controls were injected with vehicle, UE2 and NUE2 rats were injected with uterotrophic and non-uterotrophic doses of E2 , respectively. Endosulfan-treated rats received 0.006, 0.06, 0.6 or 6 mg/kg/day. The vertical axis corresponds to the relative mRNA level of each target gene normalized to L19 expression. The mRNA level of the control group is expressed as 1. Values are showed as mean ± S.E.M. (6–8 rats/group) and significant effects are depicted with different letters (p < 0.05).
4. Discussion A growing body of evidence demonstrates that endocrine disruptors can interfere with endocrine-related systems at environmentally relevant doses [24–26]. These findings demand studies
141
Fig. 2. Quantification of ER␣ protein in the uterine luminal epithelium (A), glandular epithelium (B), and stroma (C). Data are expressed as IOD, which is measured as a linear combination between the average immunostained density and the relative area occupied by positive cells in each histological compartment. Each column represents the mean ± S.E.M. of 6–8 rats/group (means with different letters represent statistically significant differences p < 0.05).
that investigate biological effects of hormonally active compounds using a wide range of doses and with appropriate positive controls [16]. In this work, we show that endosulfan is able to modulate uterine estrogen-sensitive genes at the mRNA and protein levels using a model of adult OVX rats. An interesting result is the observation that endosulfan mimics the effects of a non-uterotrophic low dose of E2 but fails to reproduce the effects observed after the injection of a high, uterotrophic dose of the hormone. To our knowledge this is the first report that demonstrates that endosul-
142
J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
Fig. 3. Quantification of PR protein expression in uterine sections of experimental animals. Data are expressed as IOD in the luminal epithelium (A), glandular epithelium (B), and stroma (C). Each column represents the mean ± S.E.M. of 6–8 rats/group and significant effects are depicted with different letters (p < 0.05).
fan can influence ER␣ and PR expression in the rat uterus at doses 100 times smaller than the NOEL dose and similar to the acceptable daily intake level established by the US Environmental Protection Agency [8,9]. Our results have to be interpreted with care since we are unaware if endosulfan exposure produces alterations in the reproductive tract physiology. However, since ER␣ and PR are crucial molecules in the endocrine control of many uterine processes, and due to the widespread use of endosulfan in many agriculturebased economies, our results might be used as a starting point for in vivo experiments investigating the effects of low doses of endo-
sulfan in the development and function of the female reproductive tract. Most of the previous works have shown that endosulfan interferes with reproductive processes at doses several orders of magnitude over the Rfd or the tolerated daily intake [12,13]. This kind of work is useful to establish the endocrine action of endosulfan and the possible biological targets influenced by its hormonal activity using in vivo conditions. However, low dose studies are essential to clarify whether exposure to environmentally relevant doses of hormonally active compounds constitutes a public health problem. The effects of endocrine disruptors, like endosulfan, have to be evaluated at different levels of organization [27]. In the present work, the uterotrophic assay was selected as a classic test to evaluate estrogenic activity at a level of organization that includes the whole organ. In accordance with previous findings [12], endosulfan was not able to increase the uterus wet weight at any of the evaluated doses. The uterotrophic actions of estrogenic substances involve multiple events like fluid imbibition, hypertrophy/hyperplasia, secretory protein production, and cellular proliferation [28,29]. The events that contribute to the increase in uterine wet weight are regulated by different gene cascades and multiple molecular pathways. The uterotrophic bioassay implies that an estrogenic compound must act at most of the molecular and cellular levels that lead to an increase in uterine wet weight. It is well known that activating most or all of these low level mechanisms is dependent not only of the chemical properties of the substance but the dose utilized in the experiment. In this work, we observed that a low dose of E2 was not able to induce changes in biological responses at a high level of organization (such as uterine wet weight and epithelial cell height), but was very active in inducing changes in individual estrogen-responsive genes such as ER␣, C3 and PR. While the UE2 dose of E2 induced an increase in PR and C3 mRNA expression, the non-uterotrophic dose produced a down-regulation of these genes. The mechanisms underlying these effects are unknown; however, the similarities observed between NUE2 and endosulfan actions on estrogen-sensitive genes suggest that both substances could activate similar molecular pathways. Several molecules have been implicated in the control of estrogen-sensitive gene transcription [30]. Although in vitro studies have shown that many chemicals such as phthalates, alkylphenols, bisphenol A and dichlorodiphenyltrichloroethane (DDT) display estrogenic actions, mainly through their binding to estrogen receptors [31], it is not clear how endocrine disruptors directly affect hormonal functions through receptor-mediated transcription in vivo. These receptors form homodimers or heterodimers with other members of the nuclear receptor superfamily and directly associate with specific DNA sequences known as hormone-responsive elements located in the promoters of specific genes [32,33]. The DNA–receptor complex interacts with basal transcriptional machinery and nuclear receptor coactivator proteins, resulting in the ligand-dependent induction of transcription [33,34]. Some elegant studies have demonstrated that many endocrine disruptor chemicals and selective estrogen receptor modulators (SERMs) can change transcription cofactor levels in the promoter region of estrogen-dependent genes, modifying the transcription rate and the association with repressors [35,36]. An active repressor action as a result of changes in corepressor recruitment in the promoter region of C3 and PR genes could explain the diminished expression observed in endosulfan and NUE2 -treated animals. Previous works have demonstrated that endosulfan can transactivate ER␣ in vitro [10]. In our experiments, the down-regulation of ER␣ protein observed in the UE2 , NUE2 and endosulfan-treated animals suggests that ER␣ is involved in endosulfan action. Many experiments are being performed in our lab to elucidate these hypotheses.
J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
143
Fig. 4. Representative photomicrographs of immunohistochemical detection of uterine ER␣ (A–D) and PR (E–H) from adult OVX rats injected with: sesame oil (control; A and E), E2 in an uterotrophic dose of 0.02 mg/kg/day (UE2 group; B and F), E2 in a non-uterotrophic dose of 0.0002 mg/kg/day (NUE2 group; C and G); or 0.006 mg/kg/day of endosulfan (Endo0.006; D and H). Control rats showed a high constitutive expression of ER␣ (A); in contrast the UE2 rats showed a down-regulation of ER␣ protein in all histological compartments (B). NUE2 (C) and endosulfan-treated rats (D) only exhibited ER␣ down regulation in the subepithelial stroma. PR protein was strongly induced in the stroma of UE2 -treated while the luminal and glandular epithelium showed a clear down regulation compared to controls (E vs. F). In NUE2 (G) and Endo0.006 (H) rats a significant decrease in PR was detected only in glandular epithelial cells without changes in the luminal epithelium and stroma. LE, luminal epithelium; GE, glandular epithelium; St, subepithelial stroma. Scale bar: 50 m.
144
J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
Another possible mechanism involved in the xenoestrogenmediated disruption is differential promoter usage of ER target genes. In a previous work, we showed that perinatal exposure to xenoestrogens can change the promoter region that regulates ER␣ gene transcription in the rat preoptic brain [19]. In other work, we demonstrated that low and high doses of E2 can differentially regulate the splicing of the rat ER␣ mRNA coding region [18]. Selective promoter usage and alternative mRNA splicing events are estrogen-dependent mechanisms of ER␣ gene variation, and could be involved in the differential response of estrogen-sensitive genes to different doses of E2 or to hormonally active substances. It has been demonstrated that an estrogen-sensitive gene could be differentially regulated depending on the composition and kinetics of the transcription machinery assembly on the promoter regions of the gene [30,37]. SERMs are able to interact with estrogen receptors, but produce different biological actions than natural estrogens like E2 . One of the mechanisms that underlie these events is the differential cofactor recruitment of the transcription control machinery that SERMs substances could induce in the regulatory regions of estrogen-dependent targets [36,38]. In addition, it has been shown that the differential occupancy of the two described estrogen receptors (ER␣ and ER) could be a possible mechanism of action of SERMs that influences the recruitment patterns of coregulators [39]. Taking into account our results, it will be interesting to know whether endosulfan and estradiol at non-uterotrophic doses recruit the same cofactors in the promoter regions of PR and C3. Endosulfan exposure during critical reproductive events like early gestation could disrupt many molecular interactions between the uterine wall and the embryos. Previous results showed that endosulfan exposure to pregnant mice affects the implantation rate, however the mechanisms underlying this disruption is not well understood [40]. According to our results an altered expression of critical genes like ER␣ and/or PR in different uterine compartments of endosulfan exposed animals could contribute to an increase in the implantation failures. It is interesting to comment that women harboring uterine neoplasias have higher serum burdens of some organochlorine pesticides, such as endosulfan, than unaffected women [41]. A common feature of organochlorines is their persistence and tendency to accumulate in fatty tissues, a characteristic that makes them arguably suspect as etiological agents in cancer of reproductive tissues. Endocrine disruptor toxicology has brought new insights in the comprehension of hormone action at different levels of tissue organization. The actions of hormonally active substances at very low doses and the importance of the careful selection of the biological targets constitute new paradigms that demonstrate the complexity of the interactions between the environment and the individual components of an ecosystem. Conflict of interest The authors declare that there are no conflicts of interest. Acknowledgements The authors thank Mr. Juan C. Villarreal and Mr. Juan Grant for their technical assistance and animal care. This study was supported by grants from the Argentine National Council for Science and Technology (CONICET, CIC Grant 652/04), the Argentine National Agency for the Promotion of Science and Technology (ANPCyT) (PICT 2003, No. 13-4737) and the Universidad Nacional del Litoral (CAI+D 2005 019/118 and 019/119). L.M. and T.B are fellows of the CONICET and the Universidad Nacional del Litoral
respectively. J.V., E.H.L., and J.G.R. are career investigators of the CONICET. References [1] Colborn T, vom Saal FS, Soto AM. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ Health Perspect 1993;101:378–84. ˜ [2] Ramos JG, Varayoud J, Kass L, Rodriguez H, Costabel L, Munoz-de-Toro M, Luque EH. Bisphenol A induces both transient and permanent histofunctional alterations of the hypothalamic–pituitary–gonadal axis in prenatally exposed male rats. Endocrinology 2003;144:3206–15. [3] Stoker C, Rey F, Rodriguez H, Ramos JG, Sirosky P, Larriera A, Luque EH, ˜ Munoz-de-Toro M. Sex reversal effects on Caiman latirostris exposed to environmentally relevant doses of the xenoestrogen bisphenol A. Gen Comp Endocrinol 2003;133:287–96. ˜ [4] Munoz-de-Toro M, Beldomenico HR, Garcia SR, Stoker C, De Jesus JJ, Beldomenico PM, Ramos JG, Luque EH. Organochlorine levels in adipose tissue of women from a littoral region of Argentina. Environ Res 2006;102:107–12. [5] Sutherland TD, Home I, Weir KM, Russell RJ, Oakeshott JG. Toxicity and residues of endosulfan isomers. Rev Environ Contam Toxicol 2004;183:99–113. [6] Blasco C, Lino CM, Pico Y, Pena A, Font G, Silveira MI. Determination of organochlorine pesticide residues in honey from the central zone of Portugal and the Valencian community of Spain. J Chromatogr A 2004;1049:155–60. ˜ J, Rivas A, Granada A, Jose Lopez-Espinosa M, Mariscal M, Olea N, Olea[7] Carreno Serrano F. Exposure of young men to organochlorine pesticides in Southern Spain. Environ Res 2007;103:55–61. [8] ATSDR Toxicological profile for endosulfan. Agency for Toxic Substances and Disease Registry, Division of Toxicology, Atlanta, GA, 2000. [9] Marshall I, Rutherford S. Health investigation level for endosulfan in soil. In: Proceedings of the fifth national workshop on the assessment of site contamination. 2003. p. 217–23. [10] Hunter DS, Hodges LC, Vonier PM, Fuchs-Young R, Gottardis MM, Walker CL. Estrogen receptor activation via activation function 2 predicts agonism of xenoestrogens in normal and neoplastic cells of the uterine myometrium. Cancer Res 1999;59:3090–9. [11] Lemaire G, Mnif W, Mauvais P, Balaguer P, Rahmani R. Activation of alpha- and beta-estrogen receptors by persistent pesticides in reporter cell lines. Life Sci 2006;79:1160–9. [12] Newbold RR, Jefferson WN, Padilla-Banks E, Walker VR, Pena DS. Cell response endpoints enhance sensitivity of the immature mouse uterotropic assay. Reprod Toxicol 2001;15:245–52. [13] Dalsenter PR, Dallegrave E, Mello JRB, Langeloh A, Oliveira RT, Faqi AS. Reproductive effects of endosulfan on male offspring of rats exposed during pregnancy and lactation. Hum Exp Toxicol 1999;18:583–9. [14] Dalsenter PR, de Araujo SL, de Assis HC, Andrade AJ, Dallegrave E. Pre and postnatal exposure to endosulfan in Wistar rats. Hum Exp Toxicol 2003;22:171–5. [15] Ashby J, Tinwell H, Odum J, Lefevre P. Natural variability and the influence of concurrent control values on the detection and interpretation of low-dose or weak endocrine toxicities. Environ Health Perspect 2004;112:847–53. [16] vom Saal FS, Welshons WV. Large effects from small exposures. II. The importance of positive controls in low-dose research on bisphenol A. Environ Res 2006;100:50–76. [17] Montes GS, Luque EH. Effects of ovarian steroids on vaginal smears in the rat. Acta Anat (Basel) 1988;133:192–9. ˜ [18] Varayoud J, Ramos JG, Monje L, Bosquiazzo V, Munoz-de-Toro M, Luque EH. The estrogen receptor alpha sigma3 mRNA splicing variant is differentially regulated by estrogen and progesterone in the rat uterus. J Endocrinol 2005;186:51–60. [19] Monje L, Varayoud J, Luque EH, Ramos JG. Neonatal exposure to bisphenol A modifies the abundance of estrogen receptor {alpha} transcripts with alternative 5 -untranslated regions in the female rat preoptic area. J Endocrinol 2007;194:201–12. [20] Ramos JG, Varayoud J, Sonnenschein C, Soto AM, Munoz De Toro M, Luque EH. Prenatal exposure to low doses of bisphenol A alters the periductal stroma and glandular cell function in the rat ventral prostate. Biol Reprod 2001;65:1271–7. ˜ [21] Ramos JG, Varayoud J, Bosquiazzo VL, Luque EH, Munoz-de-Toro M. Cellular turnover in the rat uterine cervix and its relationship to estrogen and progesterone receptor dynamics. Biol Reprod 2002;67:735–42. [22] Castleman KR. Digital image processing. Englewood Cliffs, NJ: Prentice Hall Press; 1996. [23] Vik DP, Amiguet P, Moffat GJ, Fey M, Amiguet-Barras F, Wetsel RA, Tack BF. Structural features of the human C3 gene: intron/exon organization, transcriptional start site, and promoter region sequence. Biochemistry 1991;30:1080–5. [24] vom Saal FS, Hughes C. An extensive new literature concerning low-dose effects of bisphenol A shows the need for a new risk assessment. Environ Health Perspect 2005;113:926–33. ˜ [25] Durando M, Kass L, Piva J, Sonnenschein C, Soto AM, Luque EH, Munoz-deToro M. Prenatal bisphenol A exposure induces preneoplastic lesions in the mammary gland in Wistar rats. Environ Health Perspect 2007;115:80–6. [26] Kilian E, Delport R, Bornman MS, Jager C. Simultaneous exposure to low concentrations of dichlorodiphenyltrichloroethane, deltamethrin, nonylphenol and phytoestrogens has negative effects on the reproductive parameters in male Spraque–Dawley rats. Andrologia 2007;39:128–35.
J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145 [27] Vandenberg LN, Wadia PR, Schaeberle CM, Rubin BS, Sonnenschein C, Soto AM. The mammary gland response to estradiol: monotonic at the cellular level, non-monotonic at the tissue-level of organization? J Steroid Biochem Mol Biol 2006;101:263–74. [28] Branham WS, Zehr DR, Sheehan DM. Differential sensitivity of rat uterine growth and epithelium hypertrophy to estrogens and antiestrogens. Proc Soc Exp Biol Med 1993;203:297–303. [29] Buchanan DL, Setiawan T, Lubahn DB, Taylor JA, Kurita T, Cunha GR, Cooke PS. Tissue compartment-specific estrogen receptor-alpha participation in the mouse uterine epithelial secretory response. Endocrinology 1999;140:484–91. [30] Barnes CJ, Vadlamudi RK, Kumar R. Novel estrogen receptor coregulators and signaling molecules in human diseases. Cell Mol Life Sci 2004;61:281–91. [31] Cooper RL, Kavlock RJ. Endocrine disrupters and reproductive development: a weight-of-evidence overview. J Endocrinol 1997;152:159–66. [32] Evans RM. The steroid and thyroid hormone receptor superfamily. Science 1988;240:889–95. [33] Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell 1995;83:841–50. [34] McKenna NJ, O’Malley BW. Combinatorial control of gene expression by nuclear receptors and coregulator. Cell 2002;108:465–74. [35] Inoshita H, Masuyama H, Hiramatsu Y. The different effects of endocrinedisrupting chemicals on estrogen receptor-mediated transcription through
[36]
[37] [38]
[39]
[40] [41]
145
interaction with coactivator TRAP220 in uterine tissue. J Mol Endocrinol 2003;31:551–61. Fleming FJ, Hill AD, McDermott EW, O’Higgins NJ, Young LS. Differential recruitment of coregulator proteins steroid receptor coactivator-1 and silencing mediator for retinoid and thyroid receptors to the estrogen receptor-estrogen response element by beta-estradiol and 4-hydroxytamoxifen in human breast cancer. J Clin Endocrinol Metab 2004;89:375–83. Martini PG, Katzenellenbogen BS. Modulation of estrogen receptor activity by selective coregulators. J Steroid Biochem Mol Biol 2003;85:117–22. Sasaki H, Hayakawa J, Terai Y, Kanemura M, Tanabe-Kimura A, Kamegai H, SeinoNoda H, Ezoe S, Matsumura I, Kanukura Y, Sakata M, Tasaka K, Ohmichi M. Difference between genomic actions of estrogen versus raloxifene in human ovarian cancer cell lines. Oncogene 2008;27:2737–45. Chang EC, Charn TH, Park SH, Helferich WG, Komm B, Katzenellenbogen JA, Katzenellenbogen BS. Estrogen receptors alpha and beta as determinants of gene expression: influence of ligand, dose, and chromatin binding. Mol Endocrinol 2008;22:1032–43. Hiremath MB, Kaliwal BB. The anti-implantation action of endosulfan in albino mice: possible mechanisms. J Basic Clin Physiol Pharmacol 2002;13:329–40. Saxena SP, Khare C, Farooq A, Murugesan K, Buckshee K, Chandra J. DDT and its metabolites in leiomyomatous and normal human uterine tissue. Arch Toxicol 1987;59:453–5.
