Endosulfan and flutamide, alone and in combination, target ovarian growth in juvenile catfish, Clarias batrachus

Comparative Biochemistry and Physiology, Part C 155 (2012) 491–497

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Endosulfan and flutamide, alone and in combination, target ovarian growth in juvenile catfish, Clarias batrachus S. Chakrabarty 1, A. Rajakumar 1, K. Raghuveer, P. Sridevi, A. Mohanachary, Y. Prathibha, L. Bashyam 2, A. Dutta-Gupta, B. Senthilkumaran ⁎ Department of Animal Sciences, School of Life Sciences-Centre for Advanced Studies, University of Hyderabad, P. O. Central University, Hyderabad - 500 046, Andhra Pradesh, India

a r t i c l e

i n f o

Article history: Received 29 July 2011 Received in revised form 18 December 2011 Accepted 20 December 2011 Available online 28 December 2011 Keywords: Ovarian aromatase Brain aromatase Catfish Endocrine disruption Endosulfan Flutamide Ovarian development Tph2 immunoreactivity

a b s t r a c t Juvenile Catfish(es), Clarias batrachus of 50 days post hatch (dph) were exposed to endosulfan (2.5 parts per billion [ppb]) and flutamide (33 ppb), alone and in combination for 50 days to access their impact on ovarian development. The doses used in this study were nominal considering pervious reports. Sampling was done at 100 dph to perform histology and measurement of various transcripts, estradiol-17β and aromatase activity. In general, treatments enhanced expression of ovary-specific transcription factors, steroidogenic enzymes steroidogenic acute regulatory protein and aromatases while transcripts of tryptophan hydroxylase2 (tph2) and catfish gonadotropin-releasing hormone declined in the brain of all treated groups with maximum reduction in the endosulfan group. Significant reduction of tph2 immunoreactivity in the forebrain/telencephalon–preoptic area endorsed our results. Increased number of pre-vitellogenic and less immature oocytes in the treated groups indicated hastened ovarian growth. Elevated ovarian aromatase activity and plasma estradiol-17β levels were noticed in the treated groups with maximum being in the endosulfan group. These data together demonstrate that the exposure of endosulfan causes synchronous precocious ovarian development better than flutamide, alone or in combination. Our results suggest that both endosulfan and flutamide alter ovarian growth by triggering precocious development in catfish. © 2011 Elsevier Inc. All rights reserved.

1. Introduction Endosulfan (6,7,8,9,10,10-hexachloro-1,5,5α,6,9,9α-hexahydro6,9-methano-2,4,3-benzodioxathiepin-3-oxide) is a cyclodiene pesticide which is a commercial mixture of endosulfan I (α) and endosulfan II (β) isomers in the ratios of 2:1 (Wan et al., 2005). It was widely used in many parts of the world until it was banned recently. Many nations including India has agreed for phase-out/ban for endosulfan in Stockholm convention on persistent organic pollutants held at Geneva in April 2011. Endosulfan can transform into a diol and a more toxic sulfate form which can persist long in the environment (Hose et al., 2003). Several studies (Rao and Pillala, 2001; Begum et al., 2009) reported the presence of endosulfan and its byproducts in many Indian surface water and sediments in the range of 0.5-191 parts per billion or ppb (1 ppb = 1 μg/L), which affect aquatic organisms including fishes. Endosulfan causes deleterious effects on fishes causing reproductive failure and neurotoxicity (Jonsson and Toledo, 1993). However, tolerance for endosulfan varies among fish species as evidenced from a wide range of LC50 values (1–100 μg/L), for example, 1.6 μg/L for Danio rerio (Jonsson and Toledo, 1993), 0.8 μg/L for ⁎ Corresponding author. Tel.: + 91 40 23134562; fax: + 91 40 23010307/23010120. E-mail addresses: [email protected], [email protected] (B. Senthilkumaran). 1 These authors contributed equally. 2 Genomics facility of School of Life Sciences. 1532-0456/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2011.12.007

Oreochromis niloticus (Hose et al., 2003) and 60 μg/L for Clarias batrachus (Tripathi and Verma, 2004). Endosulfan acts in a dose-dependent manner, causing regression of ovary in Lepomis macrochirus (Dutta and Dalal, 2008). It competes with estradiol for binding to estrogen receptor (ER) β and subsequently induce transcriptional response (Lemaire et al., 2006). Taken together, it is possible to propose that endosulfan mimics the action of estrogens. In this regard, the antiandrogens like flutamide may also have an estrogenic effect by interfering with the action of androgens. Flutamide (2-methyl-N-[4-nitro-3-(trifluoromethyl)phenyl]propanamide) is an acetanilide, non-steroidal anti-androgen. It competitively binds to androgen receptor (AR) and prevents androgen uptake (Wilson et al., 2007). It can impair hypothalamic regulation by blocking the inhibitory action of endogenous androgens in hypothalamus (Jensen et al., 2004). It can create an ‘estrogenic environment’, leading to similar phenotypic effect as estrogens, including increased plasma estradiol (E2) levels (Jensen et al., 2004). In mammals, it alters the expression of genes involved in sex steroid biosynthesis and hypothalamo–hypophyseal–thyroid and hypothalamo–hypophyseal–interrenal axes (Ohsako et al., 2003). In fathead minnow, Pimephales promelas, it alters the expression of steroidogenic enzymes genes like cytochrome P450 17α-hydroxylase/c1720 lyase (P450c17), 11β-hydroxysteroid dehydrogenase and insulin like growth factor-1 and its receptor (Filby et al., 2007). Recently, more emphasis has been placed on studies employing different chemicals/drugs/pesticides, which give synergistic/

492

S. Chakrabarty et al. / Comparative Biochemistry and Physiology, Part C 155 (2012) 491–497

Table 1 List of primers used for qRT-PCR analysis. Gene name

Forward Primer (5′–3′)

Reverse Primer (5′–3′)

cyp19a1a FOXL2 Ad4BP/SF-1 sox9b P450c17 star GnRH cyp19a1b tph2 β-actin

AGGTCCCTGGTTTTGTCTG CATGGCTATACGCGACAGCTC TCACTATGCACCTGCCT GAGACCCAGTCAGGCCACAG CCATGGCTCCAGCTCTTTCC TCGTCCGAGCCGAGAACGG AGCGTGCCGTGATGCAGGAG CCAGGTCCATACTGGTTACTG CAGTTCTCACAGGAAATTGG ACCGGAGTCCATCACAATACCAGT

TGCAGATGGCCTGCTGAGG CCAGTAGTTCCCCTTCCTCTC CGCTTGTACATGGGGCCGAAC AGGGTCTCGATGTGGGCCA CAGTAAGACCAACATCCTGAGTGC TGCCTCCTCCACTCCACTG TCTCTCCCAGCGACAGGCGT CACAGCAGATGACTTGCTTAG TGACTTTCTCTTTGGCATCTTC GAGCTGCGTGTTGCCCCTGAG

development using low doses. In the present study, after exposing to low dose of endosulfan and flutamide, alone and in combination, we analyzed the expression pattern of certain steroidogenic enzyme genes such as ovarian aromatase (cyp19a1a), cytochrome P450 17αhydroxylase/c17-20 lyase (P450c17) and cholesterol mobilizing steroidogenic acute regulator protein (star), and certain transcription factors such as Ad4BP/SF-1, FOXL2 and sox9b which play a vital role in catfish ovarian development. In addition, the expression pattern of (catfish) gonadotropin-releasing hormone (GnRH), brain aromatase (cyp19a1b) and tryptophan hydroxylase2 (tph2) along with tph2 immunoreactivity (ir-) were analyzed to check any changes in the brain (Goos et al., 1999; Sudhakumari et al., 2010). 2. Materials and methods

antagonistic effects. As the fishes are exposed simultaneously with many environmental xenoestrogens, it is valuable to study the combinatorial effect. On this perspective, in the present study, we have used endosulfan and flutamide, alone and in combination to check whether any synergism exists between these two compounds. Though the presence of flutamide was not reported by any field studies, we assume that, the usage of flutamide in many drug formulations for various complications may create a possible endocrine disruption in near future. This may not be an exact situation of the environment. However, our intention is to probe the influence of a pesticide that mimics like estrogen and an anti-androgenic flutamide during ovarian development. Fishes are sensitive to xenosteroids and serve as best biomarkers for studying endocrine disruption (Nagahama et al., 2004). In this study, the catfish, Clarias batrachus (Clariidae, Siluriformes; fishbase.org) was chosen as our animal model, as it can withstand higher toxicity than other teleosts as evidenced from high LC50 values for endosulfan (Tripathi and Verma, 2004) and flutamide (Hagino et al., 2001). Most of the earlier studies in a variety of teleosts were on genotoxicity, embryotoxicity, vitellogenesis (Willey and Krone, 2001; Palma et al., 2009) using high dose of treatments and not specifically on gonadal

2.1. Animals and experimental setup Clarias batrachus larva were obtained by in vitro fertilization and reared by the method explained previously for C. gariepinus (Raghuveer et al., 2011a). From the pool of cultured catfish fingerlings, 50 days post hatch (dph) juvenile larva were collected and divided into four groups of 50 each. Each group was maintained in well-aerated aquarium tanks (25 L) containing filtered water with or without treatment compounds. Group I comprised of catfish larva maintained in filtered water as control. Group II comprised of catfish larva maintained in filtered water containing 2.5 ppb of endosulfan (Parrysulfan 35 EC, Coromandel fertilizers Ltd. Secunderabad, India). Group III comprised of catfish larva maintained in filtered water containing 33 ppb of flutamide (Sigma-Aldrich, MO, USA). Group IV comprised of catfish larva maintained in filtered water with 2.5 ppb of endosulfan and 33 ppb of flutamide. Each group was maintained with a replicate. Both control and treatment groups were handled similarly. The dose was finalized based on our pilot studies and reported values for the presence of endosulfan in surface waters and previous studies on flutamide (Filby et al., 2007;

Fig. 1. Representative hematoxyloin–eosin stained histological sections demonstrating changes in ovarian tissues (n = 5) following treatments, (A) control, (B) endosulfan, (C) flutamide, (D) endosulfan and flutamide [E+ F]. Arrows indicates type of oocytes. IM—Immature, PI, PII—Pre-vitellogenic oocytes.

S. Chakrabarty et al. / Comparative Biochemistry and Physiology, Part C 155 (2012) 491–497 Table 2 Effects of endosulfan and/or flutamide, on the frequency distribution of oocytes in juvenile catfish (100 dph). Name of the Group

Group Group Group Group

I Control II Endosulfan III Flutamide IV E + F

Stages of oocytes IM

PI + PII

42.9 ± 1.7 22.1** ± 3.2 31.1* ± 2.3 30.8** ± 1.6

57.1 ± 1.2 77.9* ± 3.3 68.9* ± 2.6 69.2* ± 3.6

IM—Immature, PI, PII—Pre-vitellogenic oocytes. E+F - Endosulfan and Flutamide, in combination. The data (n=5) represented as mean±SEM. Significant differences from control are denoted as follows: *Pb 0.05, **Pb 0.001 (ANOVA followed by Student– Newman–Keuls' post hoc test).

Begum et al., 2009). Present study aimed to understand the impact of a low dose of endosulfan/flutamide on ovarian development and not on performing dose-dependency of toxicity and hence the tissue levels of endosulfan/flutamide were not measured experimentally. Endosulfan was diluted directly with milliQ water. Flutamide (Sigma) was first dissolved in absolute ethanol, air-dried completely and then re-dissolved with milliQ water. Working stocks of endosulfan (commercial grade) and flutamide were prepared immediately prior to treatments everyday. Filtered water was replenished daily followed by the addition of respective doses of endosulfan and/or flutamide as per the groups mentioned above. 2.2. Sample collection All juveniles (100 dph) of main and replica groups were sacrificed after 50 days of treatment by anesthetizing with MS 222 (Sigma) as per general animal ethical guidelines. Then from female juvenile fishes, ovaries and brains were dissected out carefully using fine sterile scissors and forceps. The tissues were then snap frozen with liquid N2 and stored at −80 °C for the isolation of total RNA. For histological studies, the ovary and brain tissues were fixed in Bouin's fixative for about 2–3 hours. Prior to sacrifice, blood was collected by caudal

493

puncture, using heparinized syringe, centrifuged and the plasma obtained, was used for the estimation of estradiol-17β (E2) by using an enzyme immuno assay (EIA) kit (Cayman, MI, USA). Plasma from five fishes for each group along with replica group was pooled to get sufficient quantities to perform EIA. Likewise five biological samples were analyzed for each group (n = 5). 2.3. Ovarian histology and tph2 immunocytochemistry (ICC) Bouin's fixed ovarian tissues were processed with graded alcohol series and finally embedded in paraplast (Sigma). Sections of 5– 6 μm were cut using a rotatory microtome (Leitz, Wetzlar, Germany). The sections were deparaffinized in xylene and haematoxylin–eosin (HE) staining was carried out following rehydration and then dehydrated with series of graded alcohol and xylene to finally mount using DPX mountant (SRL, Mumbai, India). Microscopic examination and photomicrographs were taken using an Olympus CX41 bright field microscope CFX41 (Tokyo, Japan) fitted with a Kodak (DX 7630) digital camera. The different stages of oocytes were also counted carefully and analyzed statistically. Bouin's fixed brain tissues were processed for tph2 ICC. ICC procedure followed in the present study was reported in detail in our earlier studies (Sudhakumari et al., 2010; Raghuveer et al., 2011b). 2.4. EIA for plasma E2 Levels of E2 in plasma were measured by EIA by following manufacturer's (Cayman) protocol. Intra- and inter-assay variations were within the limits specified in the manufacturer's protocol. The crossreactivity of the E2 antisera for estrone is 12%, estradiol-17glucoronide (10%), and estriol (0.3%). The minimal detection threshold for E2 was 20 pg/mL (Rasheeda et al., 2010). 2.5. Ovarian aromatase (EC 1.14.14.1) assay Ovarian microsomal fractions of control and treatment groups were prepared by homogenizing 0.7–1 g of tissue in potassium phosphate buffer (10 mM KPO4, 100 mM KCl and 1 mM EDTA, pH 7.4) followed by high speed ultracentrifugation. The microsomal pellet was then resuspended in 100 μL of potassium phosphate buffer containing 0.1 mM EDTA and 20% glycerol. The microsomal fraction obtained was used for the measurement of aromatase activity as per the method described by Rasheeda et al. (2010). Heat inactivated microsomal fraction was used as a mock to check assay sensitivity. 2.6. Quantitative real-time PCR (qRT-PCR)

Fig. 2. (A) Aromatase activity in the control and treated ovary (n=5) of juvenile catfish (100 dph) (B) Plasma E2 levels of control and treated catfish (n=5). Significant differences from control are denoted as follows: *Pb 0.05, **Pb 0.001 (ANOVA followed by Student–Newman– Keuls' post hoc test). Mock was used to test the sensitivity of aromatase activity assay.

Total RNA was prepared from brain and ovarian tissues using TRI reagent (Sigma) following the manufacturer's protocol. The quality and quantity of isolated total RNA was assessed by using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, DE, USA). The first strand cDNA template was prepared using 1 μg of ovarian or brain total RNA using iscript reverse transcriptase (Bio-rad, CA, USA) according to the manufacturer's instructions. Successful reverse transcription was confirmed for all samples by performing PCR amplification of internal control β-actin (Raghuveer and Senthilkumaran, 2009). All the gene expression patterns were analyzed by relative qRT-PCR using SYBR Green detection method except for tph2, where Taqman probes were used as per the detailed method reported earlier (Raghuveer et al., 2011b). The real-time PCR specific primers for all the target genes and internal control β-actin were designed such that, at least one of the primers spanned the intron–exon boundary to exclude the amplification from genomic DNA. The primers used were designed initially for the closely related species C. gariepinus. Later, the suitability of these primers was tested in C. batrachus by sub-cloning and subsequent nucleotide sequence analysis. The

494

S. Chakrabarty et al. / Comparative Biochemistry and Physiology, Part C 155 (2012) 491–497

Fig. 3. Relative mRNA levels of (A) Ad4BP/SF-1 (B) FOXL2 (C) sox9b (D) cyp19a1a (E) P450c17 (F) star in the control and treated ovary of juvenile catfish (100 dph) using qRT-PCR. The relative expression was normalized with β-actin in samples was calculated using comparative Ct method. Data (n = 5) for real-time PCR were expressed as mean± SEM. Significant differences from control are denoted as follows: *P b 0.05, **P b 0.001 (ANOVA followed by Student–Newman–Keuls' post hoc test).

cDNA fragments amplified by using these real-time PCR primers (Table 1) in C. batrachus had identical nucleotide sequences for each of the partial cDNA fragments of CYP19A1 (cyp19a1a; GU220075), Ad4BP/SF-1 (HQ680985), FOXL2 (HQ680981), sox9b (HM149259), P450c17 (FJ790422), star (FJ793811), GnRH (X78049), CYP19A2 (cyp19a1b; GU220076) and tph2 (GU290195) of C. gariepinus. Specific cDNA amplification was then carried out in triplicate using power SYBR Green PCR master mix (Applied Biosystems, CA, USA) in a 7500 fast real-time PCR machine (Applied Biosystems) according to the manufacturer's universal thermal cycling conditions. Melting curve analysis was performed for each sample to check the specificity of PCR amplification. Controls containing no template cDNA were included in all assays, which yielded no amplification. All the assays were repeated using five different samples in duplicates from both main and replica groups to get statistical significance. Cycle threshold (Ct) values were obtained from the exponential phase of PCR amplification and gene expression was normalized against expression of β-actin, generating a ΔCt value (Ct of target gene—Ct of β-actin). Relative expression was calculated by comparative Ct method, where control was taken as a calibrator. 2.7. Statistical analysis Statistical significance was assessed by one-way analysis of variance (ANOVA) followed by Student–Newman–Keuls' post hoc test.

All statistical analyses were performed using SigmaPlot 11.0 software (Systat Software Inc., IL, USA). All the experimental data (n = 5) were presented as mean ± SEM. A probability of P b 0.05 was considered statistically significant. 3. Results 3.1. Ovarian histology, plasma E2 levels and ovarian aromatase activity Control fishes had more immature (IM) oocytes with relatively less pre-vitellogenic (PI + PII) oocytes (Fig. 1A) indicating normal ovarian development. Endosulfan treatment enhanced the ovarian diameter with more intact pre-vitellogenic (arbitrarily staged as PI and PII) and less IM oocytes depicting hastened ovarian growth (Fig. 1B). Further the ovary was also densely packed with large number of previtellogenic oocytes. The flutamide group had higher pre-vitellogenic (PI + PII) than the immature oocytes (Fig. 3C) with less intact ovarian morphology. Likewise, the combination group, endosulfan and flutamide (E + F) also had similar type of ovarian morphology (Fig. 3D). Percentage of immature and pre-vitellogenic (PI + PII) oocytes for each group were provided in Table 2. In accordance with our histological analysis, ovarian aromatase activities showed a considerable increase in the treated groups (Fig. 2A). The aromatase activity was found to be higher in the endosulfan and E + F groups than that of flutamide. Further, plasma E2 levels were increased in all the treatment

S. Chakrabarty et al. / Comparative Biochemistry and Physiology, Part C 155 (2012) 491–497

495

3.4. Changes in the expression of tph2, GnRH and cyp19a1b, and tph2 immunoreactivity A significant reduction in transcript levels of tph2 (Fig. 4A) and GnRH (Fig. 4B) was seen in the brain of all treated fishes than controls. Among the treatments, endosulfan and E + F groups showed a higher reduction in the transcript levels when compared to flutamide (Fig. 4A and B). In the case of cyp19a1b (Fig. 4C), the expression was increased in all the treated fishes than the controls. Endosulfan and flutamide alone groups showed a higher elevation in the transcript levels when compared to the E + F group (Fig. 4C). ICC of all the treated fishes exhibited reduced tph2 ir- in the forebrain/telencephalon-preoptic area (T-P) compared to control (Fig. 5), correlating well with decreased tph2 transcripts in all the treated groups. Present study compared ir- region-wise and the qualitative difference between the control and treated groups in the forebrain/T-P area indicated in the results (Fig. 5) were apparent. 4. Discussion

Fig. 4. Relative mRNA levels of (A) tph2 (B) GnRH (C) cyp19a1b in the control and treated brain of juvenile catfish (100 dph) using qRT-PCR. Other details are as in Fig. 3.

groups than the control with a maximal increase in the endosulfan group (Fig. 2B). 3.2. Changes in the expression of Ad4BP/SF-1, FOXL2 and sox9b Treatment of endosulfan and flutamide, alone and in combination significantly elevated the expression of Ad4BP/SF-1 (Fig. 3A) and FOXL2 (Fig. 3B). Transcription factor, sox9b expression (Fig. 3C) was elevated in endosulfan and E + F groups but not in the flutamide group. However, the magnitude of effect varies among the treatment groups. The transcript levels of Ad4BP/SF1 and sox9b in endosulfan treated fishes were comparable with E + F treated fishes while the levels were marginally reduced in the flutamide group. 3.3. Changes in the expression of cyp19a1a, P450c17 and star The expression of cyp19a1a and star was significantly increased in the ovaries of treated fishes compared to control with maximum expression after treatment with flutamide (Fig. 3D and F). On the other hand, transcript levels of P450c17 showed no significant change in the treated groups (Fig. 3E).

The aim of this study was to understand the physiological and molecular changes caused by endosulfan and flutamide during ovarian development of catfish. Real-time PCR analysis results showed that the expression of many target genes of ovary was elevated by the treatments along with increased aromatase activity and plasma E2 levels. However, GnRH and tph2 (both transcripts and/or ir-) in the brain declined considerably which in turn suggests an indirect or direct action of these compounds. Histological analysis of ovary warrants precocious ovarian development in all the treated groups with the effect being more pronounced when these compounds were given alone, and more specifically after endosulfan treatment. Present study was first of its kind to demonstrate that low dose of endosulfan and/or flutamide bring about physiological and molecular level changes to impart precocious ovarian growth in any juvenile fish. Endosulfan competes with E2 for binding to the ER however, with low binding affinity (Lemaire et al., 2006) thereby inducting estrogenic response. Based on this, it is conceivable to endorse that endosulfan hastened the oocyte growth vis-à-vis ovarian differentiation, which was evidenced by the synchronous increase of densely packed previtellogenic oocytes with very less immature oocytes. Flutamide competes with androgen binding and irreversibly block AR (Wilson et al., 2007) thereby allowing an increase in the levels of precursor androgen(s) for estrogen(s) biosynthesis. Endosulfan also can bind to ligand binding domain of AR specifically but their antagonistic potential is lower than that of flutamide (Lemaire et al., 2004). In accordance to these findings, treatment of flutamide and endosulfan, individually elevated the percentage share of pre-vitellogenic oocytes with distorted ovarian morphology. The treatment of endosulfan and flutamide in combination had a similar effect on ovary. Improper ovarian morphology in all the treated groups indicated that the juvenile catfishes might have succumbed to adverse estrogenicity. Treatment of adult fish with high doses of endosulfan and flutamide often had deleterious effects on ovarian recrudescence (Haider and Inbaraj, 1986; Pandey, 1988; Jensen et al., 2004). Present study employed a low dose of endosulfan and/or flutamide treatment to juveniles that might explain precocious development of oocytes. As expected from the results of histology, cyp19a1a expression and aromatase activity were elevated in treated fishes which might have enhanced the E2 biosynthesis to promote precocious oocyte growth. More specifically, endosulfan treated fishes had high aromatase activity with E2 levels which might explain the selective increase of pre-vitellogenic oocytes. The increase in E2 levels by flutamide in this study was similar to the results observed by Jensen et al. (2004) in fathead minnows. In addition, the brain aromatase (cyp19a1b) expression was also analyzed for its role in brain sex differentiation and ovarian development. To probe the increase in cyp19a1a and cyp19a1b transcripts and ovarian aromatase activity, we analyzed the expression of Ad4BP/SF-1 and FOXL2 that have been

496

S. Chakrabarty et al. / Comparative Biochemistry and Physiology, Part C 155 (2012) 491–497

Fig. 5. Immunocytochemical localization (ir-) of tph2 in forebrain/telencephalon-preoptic area of control and treated brain of juvenile catfish (100 dph). (A) control (B) endosulfan (C) flutamide (D) endosulfan and flutamide [E + F]. Arrows indicate representative ir- of tph2.

implicated in both the aromatase regulation and ovarian development (Yoshiura et al., 2003; Wang et al., 2007; Ijiri et al., 2008; Sridevi and Senthilkumaran, 2011; Sridevi et al., 2012). Ovarian and brain aromatase catalyze the production of estrogen(s) from androgen(s), which plays a vital role in teleostean ovarian development (Chang et al., 1997; Sudhakumari et al., 2003, 2005; Guiguen et al., 2010; Rasheeda et al., 2010). Orphan nuclear receptor, Ad4BP/SF-1/ FTZ-F1, is a key transcriptional regulator of cyp19a1a and cyp19a1b (Yoshiura et al., 2003; Sridevi et al., 2012) while FOXL2 plays a crucial role in early ovarian differentiation/maintenance by interacting with the ligand-binding domain of Ad4BP/SF-1 and enhances the cyp19a1a and cyp19a1b transcription (Wang et al., 2007; Sridevi et al., 2012). Increased expression of Ad4BP/SF-1 and FOXL2 might have stimulated the expression of cyp19a1a and ovarian aromatase activity in the treated fishes which contributed to the increase in E2 levels. The expression of cyp19a1b in teleost brain is estrogeninducible, which can be modulated by both estrogens and xenoestrogens (Kishida et al., 2001; Greytak et al., 2005; Sawyer et al., 2006). Melo and Ramsdell (2001) showed E2-dependent elevation of brain aromatase activity. This positive feedback of E2 on aromatase might also be a reason for drastic increase in E2 levels of endocrine disrupted fishes. Our results of increased brain aromatase (cyp19a1b) transcripts in all the treated fishes compared to control strengthen the findings reported above. The treatments modulated expression of sox9b, which is an ortholog of sox9, a transcription factor that is critical for ovarian differentiation (Raghuveer and Senthilkumaran, 2010). By the end of treatment i.e. 100 dph, sox9b expression was naturally in the declining trend after a peak during 50–90 dph (Raghuveer et al., 2011a). Hence, the effects of these compounds might not have been severe to enhance the expression of sox9b drastically except a marginal increase was seen after endosulfan and E + F treatments. This might also explain the synchronous development of pre-vitellogenic oocytes in the endosulfan group. P450c17 did not show any change after the treatments, as its role in early ovarian development is not clear at least in catfish. P450c17 is single enzyme with both 17α-hydroxylase and 17,20-lyase activities which produce precursor steroids for steroidogenesis (Wang and Ge,

2004; Sreenivasulu and Senthilkumaran, 2009). Unlike P450c17, expression of star increased in all the treated groups along with aromatase activity, as more cholesterol is needed to support the demand of enhanced E2 production. Sterol transfer protein, star delivers cholesterol from cytoplasm to mitochondria, which is a rate-limiting step in steroidogenesis (Stocco, 2000). Having found that endosulfan and flutamide create adverse estrogenecity by specifically enhancing the E2 production, our study also aimed to analyze the impact on catfish GnRH and tph2 as they are potential targets to reveal altered E2 feedback (Tsai et al., 2000; Swapna and Senthilkumaran, 2009; Sudhakumari et al., 2010; Raghuveer et al., 2011b). Tph, a homotetrameric enzyme, is involved in the rate-limiting step of serotonin (5-HT) biosynthesis (Boadle-Biber, 1993). 5-HT is well known to modulate the release of GnRH in teleosts (Senthilkumaran et al., 2001). The reduction in the expression of GnRH and tph2, and tph2 ir- in the forebrain/T-P of the treated fishes might have been caused by elevated levels of E2. This can be further explained that a drop in tph2 expression vis-à-vis 5-HT biosynthesis might have affected GnRH expression in part (Goos et al., 1999; Senthilkumaran et al., 2001). Nevertheless, direct effects of endosulfan and flutamide at the level of brain cannot be ruled out as the expression of sex steroid receptors during early brain development is well demonstrated (Sudhakumari et al., 2005; Ijiri et al., 2008). The exposure of endosulfan and/or flutamide in juvenile catfish even for a short period of exposure resulted in precocious ovarian growth with distorted ovarian morphology in addition to molecular level changes. These results tend to highlight the impact of disarray compared to natural ovarian development. India's agreement to phase-out/ban with an exemption of some crops in Stockholm convention on persistent organic pollutants may ease endosulfan-related pollutant crisis in India. Present study may create awareness and also provide better understanding of post-effects of endosulfan exposure in aquatic system. 5. Conclusions In this study, treatments of endosulfan and flutamide, alone and in combination, during the early ovarian development elevated the

S. Chakrabarty et al. / Comparative Biochemistry and Physiology, Part C 155 (2012) 491–497

expression of few steroidogenic enzymes and certain transcription factors. Corroboratively, increased aromatase activity and plasma E2 levels in the treated fishes substantiated estrogenic effects. Decreased expression of catfish GnRH and tph2 with a reduction in tph2 ir- in the forebrain/T-P after the treatments indicated that the effects of endosulfan and/or flutamide might target GnRH-serotonergic system in the brain, either directly or indirectly. Taken together, usage of endosulfan even at low dose may pose potential threat to ovarian growth mainly by triggering precocious development in catfish. Flutamide, alone and in combination with endosulfan caused hastened ovarian development with distorted morphology. Acknowledgements This work was completely supported by Grant-in-Aid (BT/PR11263/ AAQ/03/419/2008) from Department of Biotechnology, India to BS. AR, KR, PS and YP acknowledge Council of Scientific and Industrial Research/University Grant Commission (UGC) for junior/senior research fellowships. We also acknowledge Department of Science and Technology (DST)-PURSE, DST-FIST, UGC-SAP and UGC-Center for Advanced Studies programs for the instrumentation facility. References Begum, A., Harikrishna, S., Khan, I., 2009. A survey of persistant organochlorine pesticides residues in some streams of the Cauvery River, Karnataka, India. Int. J. Chem. Tech. Res. 1, 237–244. Boadle-Biber, M.C., 1993. Regulation of serotonin synthesis. Prog. Biophys. Mol. Biol. 60, 1–15. Chang, X.T., Kobayashi, T., Kajiura, H., Nakamura, M., Nagahama, Y., 1997. Isolation and characterization of the cDNA encoding the tilapia (Oreochromis niloticus) cytochrome P450 aromatase (P450arom): changes in P450arom mRNA, protein and enzyme activity in ovarian follicles during oogenesis. J. Mol. Endocrinol. 18, 57–66. Dutta, H.M., Dalal, R., 2008. The effect of endosulfan on the ovary of bluegill sunfish (Lepomis macrochirus): a histopathological study. Int. J. Environ. Res. 2, 215–224. Filby, A.L., Thorpe, K.L., Maack, G., Tyler, C.R., 2007. Gene expression profiles revealing the mechanisms of anti-androgen- and estrogen-induced feminization in fish. Aquat. Toxicol. 81, 219–231. Goos, H.J., Senthilkumaran, B., Joy, K.P., 1999. Neuroendocrine integrative mechanisms in the control of gonadotropin secretion in teleosts. In: Joy, K.P., Krishna, A., Haldar, C. (Eds.), Comparative endocrinology and reproduction. Narousa Publishing House, New Delhi, India, pp. 113–136. Greytak, S.R., Champlin, D., Callard, G.V., 2005. Isolation and characterization of two cytochrome P450 aromatase forms in killifish (Fundulus heteroclitus): differential expression in fish from polluted and unpolluted environments. Aquat. Toxicol. 71, 371–389. Guiguen, Y., Fostier, A., Piferrer, F., Chang, C.F., 2010. Ovarian aromatase and estrogens: a pivotal role for gonadal sex differentiation and sex change in fish. Gen. Comp. Endocrinol. 165, 352–366. Hagino, S., Kagoshima, M., Asida, S., 2001. Effects of ethinylestradiol, diethylstilbestrol, 4-t-pentylphenol, 17-β-estradiol, methyltestosterone and flutamide on sex reversal in S-rR strain medaka (Oryzias latipes). Environ. Sci. 8, 75–87. Haider, S., Inbaraj, R.M., 1986. Relative toxicity of technical material and commercial formulation of malathion and endosulfan to a freshwater fish, Channa punctatus (Bloch). Ecotoxicol. Environ. Saf. 11, 347–351. Hose, G.C., Lim, R.P., Hyne, R.V., 2003. The transport, fate and effects of endosulfan in the australian freshwater environment. Austr. J. Ecotoxicol. 9, 101–111. Ijiri, S., Kaneko, H., Kobayshi, T., Wang, D.S., Sakai, F., Paul-Prasanth, B., Nakamura, M., Nagahama, Y., 2008. Sexual dimorphic expression of genes during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol. Reprod. 78, 333–341. Jensen, K.M., Kahl, M.D., Makynen, E.A., Korte, J.J., Leino, R.L., Butterworth, B.C., Ankley, G.T., 2004. Characterization of responses to the antiandrogen flutamide in a shortterm reproduction assay with the fathead minnow. Aquat. Toxicol. 70, 99–110. Jonsson, C.M., Toledo, M.C.F., 1993. Acute toxicity of endosulfan to the fish Hyphessobrycon bifasciatus and Brachydanio rerio. Arch. Environ. Contam. Toxicol. 24, 151–155. Kishida, M., McLellan, M., Miranda, J.A., Callard, G.V., 2001. Estrogen and xenoestrogens upregulate the brain aromatase isoform (P450aromB) and perturb markers of early development in zebrafish (Danio rerio). Comp. Biochem. Physiol. B 129, 261–268. Lemaire, G., Terouanne, B., Mauvais, P., Michel, S., Rahmani, R., 2004. Effect of organochlorine pesticides on human androgen receptor activation in vitro. Toxicol. Appl. Pharmacol. 196, 235–246. Lemaire, G., Mnif, W., Mauvais, P., Balaguer, P., Rahmani, R., 2006. Activation of α and β estrogen receptors by persistent pesticides in reporter cell lines. Life Sci. 79, 1160–1169. Melo, A.C., Ramsdell, J.S., 2001. Sexual dimorphism of brain aromatase activity in medaka: induction of a female phenotype by estradiol. Environ. Health Perspect. 109, 257–264. Nagahama, Y., Nakamura, M., Kitano, T., Tokumoto, T., 2004. Sexual plasticity in fish: a possible target of endocrine disrupter action. Environ. Sci. 11, 73–82. Ohsako, S., Kubota, K., Kurosawa, S., Takeda, K., Qing, W., Ishimura, R., Tohyama, C., 2003. Alterations of gene expression in adult male rat testis and pituitary shortly after subacute administration of the antiandrogen flutamide. J. Reprod. Dev. 49, 275–290.

497

Palma, P., Palma, V.L., Fernandes, R.M., Soares, A.M.V.M., Barbosa, I.R., 2009. Endosulfan sulphate interferes with reproduction, embryonic development and sex differentiation in Daphnia magna. Ecotoxicol. Environ. Saf. 72, 344–350. Pandey, A.C., 1988. Impact of endosulfan (thiodan) EC 35 on behavior and dynamics of oocyte development in the teleostean fish, Colisa (Trichogaster) fasciatus. Ecotoxicol. Environ. Saf. 15, 221–225. Raghuveer, K., Senthilkumaran, B., 2009. Identification of multiple dmrt1s in catfish: localization, dimorphic expression pattern, changes during testicular cycle and after methyltestosterone treatment. J. Mol. Endocrinol. 42, 437–448. Raghuveer, K., Senthilkumaran, B., 2010. Differential expression pattern of sox9 duplicates during gonadal development, recrudescence and hCG-induced up regulation of sox9 in testis of catfish, Clarias gariepinus. Reproduction 140, 477–487. Raghuveer, K., Senthilkumaran, B., Sudhakumari, C.C., Sridevi, P., Rajakumar, A., Singh, R., Murugananthkumar, R., Majumdar, K.C., 2011a. Dimorphic expression of various transcription factor and steroidogenic enzyme genes during gonadal ontogeny in the air-breathing catfish, Clarias gariepinus. Sex. Dev. 5, 213–223. Raghuveer, K., Sudhakumari, C.C., Senthilkumaran, B., Kagawa, H., Dutta-Gupta, A., Nagahama, Y., 2011b. Gender differences in tryptophan hydroxylase-2 mRNA, serotonin, and 5-hydroxytryptophan levels in the brain of catfish, Clarias gariepinus, during sex differentiation. Gen. Comp. Endocrinol. 171, 94–104. Rao, A.S., Pillala, R.R., 2001. The concentration of pesticides in sediments from kolleru lake in India. Pest Manag. Sci. 57, 620–624. Rasheeda, M.K., Sridevi, P., Senthilkumaran, B., 2010. Cytochrome P450 aromatases: impact on gonadal development, recrudescence and effect of hCG in the catfish, Clarias gariepinus. Gen. Comp. Endocrinol. 167, 234–245. Sawyer, S., Gerstner, K.A., Callard, G.V., 2006. Real-time PCR analysis of cytochrome P450 aromatase expression in zebrafish: gene specific tissue distribution, sex differences, developmental programming and estrogen regulation. Gen. Comp. Endocrinol. 147, 108–117. Senthilkumaran, B., Okuzawa, K., Gen, K., Kagawa, H., 2001. Effects of serotonin, GABA and neuropeptide Y on seabream GnRH hormone release in vitro from preoptic-anterior hypothalamus and pituitary of red seabream, Pagrus major. J. Neuroendocrinol. 13, 395–400. Sreenivasulu, G., Senthilkumaran, B., 2009. A role for cytochrome P450 17αhydroxylase and c17-20 lyase during shift in steroidogenesis occurring in ovarian follicles prior to oocyte maturation. J. Steroid Biochem. Mol. Biol. 115, 77–85. Sridevi, P., Senthilkumaran, B., 2011. Cloning and differential expression of FOXL2 during ovarian development and recrudescence of the catfish, Clarias gariepinus. Gen. Comp. Endocrinol. 174, 259–268. Sridevi, P., Chaitanya, R.K., Dutta-Gupta, A., Senthilkumaran, B., 2012. FTZ-F1 and FOXL2 up-regulate catfish brain aromatase gene transcription by specific binding to the promoter motifs. Biochim. Biophys. Acta 1819, 57–66. Stocco, D.M., 2000. The role of the StAR protein in steroidogenesis: challenges for the future. J. Endocrinol. 164, 247–253. Sudhakumari, C.C., Senthilkumaran, B., Kobayashi, T., Wang, D.S., Chang, X.T., Nagahama, Y., 2003. Expression of cytochrome P450 aromatases in the sex-reversed Nile tilapia. Fish Physiol. Biochem. 28, 177–178. Sudhakumari, C.C., Kobayashi, T., Kajiura-Kobayashi, H., Wang, D.S., Yoshikuni, M., Nagahama, Y., Senthilkumaran, B., 2005. Ontogenic expression patterns of several nuclear receptors and cytochrome P450 aromatases in brain and gonads of the Nile tilapia, Oreochromis niloticus suggests their involvement in sex differentiation. Fish Physiol. Biochem. 31, 129–135. Sudhakumari, C.C., Senthilkumaran, B., Raghuveer, K., Wang, D.S., Kobayashi, T., Kagawa, H., Krishnaiah, Ch., Dutta-Gupta, A., Nagahama, Y., 2010. Dimorphic expression of tryptophan hydroxylase in the brain of XX and XY Nile tilapia during early development. Gen. Comp. Endocrinol. 166, 320–329. Swapna, I., Senthilkumaran, B., 2009. Influence of ethynylestradiol and methyltestosterone on the hypothalamo-hypophyseal-gonadal axis of adult air-breathing catfish, Clarias gariepinus. Aquat. Toxicol. 9, 222–229. Tripathi, G., Verma, P., 2004. Endosulfan-mediated biochemical changes in the freshwater fish Clarias batrachus. Biomed. Environ. Sci. 17, 47–56. Tsai, C.L., Wang, L.H., Chang, C.F., Kao, C.C., 2000. Effects of gonadal steroids on brain serotonergic and aromatase activity during the critical period of sexual differentiation in tilapia, Oreochromis mossabicus. J. Neuroendocrinol. 12, 894–898. Wan, M.T., Kuo, J.-N., Buday, C., Schroeder, G., Aggelen, G.V., Pasternak, J., 2005. Toxicity of α-, β-, and (α+β)-endosulfan and their formulated and degredation products to Daphnia magna, Hyalella azteca, Oncorhynchus mykiss, Oncorhynchus kisutch, and biological implications in streams. Environ. Toxicol. Chem. 24, 1146–1154. Wang, Y., Ge, W., 2004. Cloning of zebrafish ovarian P450c17 (CYP17, 17αhydroxylase/17,20-lyase) and characterization of its expression in gonadal and extra-gonadal tissues. Gen. Comp. Endocrinol. 135, 241–249. Wang, D.S., Kobayashi, T., Zhou, L.Y., Paul-Prasanth, B., Ijiri, S., Sakai, F., Okubo, K., Morohashi, K., Nagahama, Y., 2007. Foxl2 up-regulates aromatase gene transcription in a female-specific manner by binding to the promoter as well as interacting with ad4 binding protein/steroidogenic factor 1. Mol. Endocrinol. 21, 712–725. Willey, J.B., Krone, P.H., 2001. Effects of endosulfan and nonylphenol on the primordial germ cell population in pre-larval zebrafish embryos. Aquat. Toxicol. 54, 113–123. Wilson, V.S., Cardon, M.C., Gray Jr., L.E., Hartig, P.C., 2007. Competitive binding comparison of endocrine-disrupting compounds to recombinant androgen receptor from fathead minnow, rainbow trout, and human. Environ. Toxicol. Chem. 26, 1793–1802. Yoshiura, Y., Senthilkumaran, B., Watanabe, M., Oba, Y., Kobayashi, T., Nagahama, Y., 2003. Synergistic expression of Ad4BP/SF-1 and cytochrome P-450 aromatase (ovarian type) in the ovary of Nile tilapia, Oreochromis niloticus, during vitellogenesis suggests transcriptional interaction. Biol. Reprod. 68, 1545–1553.