Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette

MIMET-04033; No of Pages 8 Journal of Microbiological Methods xxx (2012) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth

4 5 6

F

Q1 3

Edyta Szewczyk a, Takao Kasuga b, c, Zhiliang Fan a,⁎ a b c

Biological and Agricultural Engineering Department, University of California, Davis, One Shields Avenue, Davis, CA 95616, USA Department of Plant Pathology, University of California, Davis, One Shields Avenue, Davis, CA 95616, USA United States Department of Agriculture—Agricultural Research Service, USA

7

a r t i c l e

i n f o

a b s t r a c t

Article history: Received 8 November 2012 Received in revised form 7 December 2012 Accepted 7 December 2012 Available online xxxx

D

P

Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing β-recombinase acting on six recognition sequences (β-rec/six) in N. crassa, which allowed repetitive site-specific gene deletion and marker recycling. We report generating the mus-51 deletion strain using this system, recycling the marker cassette, and subsequently deleting the global transcriptional regulator gene cre-1. © 2012 Published by Elsevier B.V.

32

C

31

1. Introduction

34 35

Progress in molecular genetics and genetic engineering requires precise manipulation of genomes. Advances in genome sequencing and the development of selective markers and transformation techniques have facilitated work with many filamentous fungi (Kück and Hoff, 2010). For over 70 years, Neurospora crassa, a model filamentous ascomycete, has been studied to understand biological processes and phenomena relevant to higher eukaryotes (Borkovich et al., 2004; Davis, 2000; Davis and Perkins, 2002). Taking advantage of its well-characterized genetics, researchers have developed advanced methods for manipulating genes in N. crassa. Various nutrient complementation selective markers such as qa-2 (Case et al., 1979), am (Kinsey and Rambosek, 1984), pyr4 and pyrG (Turner et al., 1997), pan-2 (Low and Jedd, 2008), his-3 (Ebbole, 1990; Ebbole and Sachs, 1990; Lee et al., 2003; Margolin et al., 2000) as well as dominant selective markers, such as the bacterial hygromycin B resistance gene hphr, the bleomycin resistance gene ble, and the glufosinate resistance gene barr, were successfully developed for this microorganism (Austin et al., 1990; Avalos et al., 1989; Staben et al., 1989; Straubinger et al., 1992). For a long time, efficient gene targeting was hindered by the low frequency (10–30%) of integration events at the homologous site (Ninomiya et al., 2004; Paietta and Marzluf, 1985). This problem was overcome by utilizing mus-51, mus-52, (Ninomiya et al., 2004), or mus-53 deletions (Ishibashi et al., 2006), which were inactivated homologues of human Ku70, Ku80, or Lig4, respectively, and were defective

42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

R

R

N C O

40 41

U

38 39

E

33

36 37

22 23 24 25 26 27 28

E

Keywords: Neurospora crassa β-Recombinase Repetitive gene deletion Recyclable self-excising marker

T

8 9 10 11 12 13 15 14 16 17 18 19 20 21

O

2

Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette

R O

1

⁎ Corresponding author. Tel.: +1 530 754 0317; fax: +1 530 752 2640. E-mail address: [email protected] (Z. Fan).

30 29

in the non-homologous end-joining (NHEJ) mechanism. Together, these new tools and mutations revolutionized the genetic engineering of N. crassa and allowed high-throughput gene knockout procedures and the construction of a single gene knockout library (Colot et al., 2006, 2007). When multiple gene deletions are needed in N. crassa, one of the approaches is to combine the different gene deletions by genetic crossing, which takes advantage of the existing single knockout library and the known operational sexual cycle of N. crassa. Triple and sextuple, knockout strains were successfully constructed using this method (Fan et al., 2012; Znameroski et al., 2012). However, the increased number of mutations that need to be incorporated makes it very laborious to screen a big library for progeny that have the correct combination of multiple gene deletions. In addition, this approach is not suitable for combining genes that are genetically tightly linked. Another approach is sequential targeted gene deletion. Due to the limited availability of desired selective markers, it is preferable to use a recyclable marker system, which allows repetitive rounds of gene deletions and subsequent marker recycling. The bacteriophage P1-derived Cre/loxP-induced recombination system has been extensively used in Aspergillus. fumigatus (Krappmann et al., 2005), A. nidulans (Forment et al., 2006), A. oryzae (Mizutani et al., 2012), Trichoderma reesei (Steiger et al., 2011), and other ascomycetes (Florea et al., 2009). It was successfully applied on N. crassa as well (Honda and Selker, 2009). The disadvantage of this method is the necessity of at least two rounds of transformations per gene deletion/marker rescue event. First, Cre recombinase needs to be introduced to the fungus. For many other ascomycetes, Cre recombinase can be transiently expressed from

0167-7012/$ – see front matter © 2012 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.mimet.2012.12.004

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86

136

Genetic manipulations using a Zero Blunt TOPO PCR Cloning Kit (Invitrogen, Carlsbad, CA, USA) and a GENEART Seamless Cloning and Assembly Kit (Invitrogen) were performed in One Shot TOP10 Chemically Competent Escherichia coli cells (Invitrogen). Media used for E. coli growth were as described in those two kits. Kanamycin or ampicillin was added as required, to a final concentration of 50 or 100 μg/ml, respectively. N. crassa strains used in this research are listed in Table 1. For general cultivation of N. crassa, Vogel's medium (Vogel, 1956) supplemented with 2% sucrose and solidified with 1.5% agar was used. For selective plates after N. crassa transformation, Vogel's –N (nitrogen free) medium supplemented with 0.5% proline as a nitrogen source and solidified with 1.5% agar was used. Additionally, 2% sorbose, 0.05% glucose, and 0.05% fructose were added to restrict colonial growth (Brockman and de

112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132

137 138 139 140 141 142 143 144 145 146 147 148 149

C

110 111

E

108 109

R

106 107

R

104 105

O

102 103

C

100 101

N

98 99

U

96 97

t1:3

(Mylyk et al., 1974) (Fan et al., 2012)

t1:4 t1:5

This This This This

t1:6 t1:7 t1:8 t1:9

F5 F5 F5 F5

mus-51::bar mus-51::six mus-51::six cre-1::bar mus-51::six cre-1::six

work work work work

Serres, 1963; Perkins, 2006). Selection of the barr gene was performed using 400 μg/ml of phosphinothricin (PPT) (GoldBio, St. Louis, MO, USA). Vogel's medium with 2% xylose was used to induce the xylP promoter and to express β-recombinase, allowing excision of the marker cassette.

150 151

2.2. Plasmids and PCR constructs

155

F

2.1. Strains and media

94 95

Reference

FGSC #2489 bgl-1::hph bgl-2::hph bgl-3::hph bgl-4::hph bgl-6::hph bgl-7::hph F5 mus-51::β-rec(bar) F5 mus-51::six F5 mus-51::six cre-1::β-rec(bar) F5 mus-51::six cre-1::six

O

135

93

Genotype

WT F5

R O

2. Materials and methods

91 92

Strain name

Plasmid pSK529, a derivative of pSK485 (Hartmann et al., 2010) carrying functional elements of β-rec/six self-excising marker cassette and the hygromycin resistance gene (hph r), was kindly provided by Dr. Sven Krappmann. Using a fusion PCR technique (Szewczyk et al., 2006), the new self-excising cassette with hph r replaced by bar r suitable for our work in N. crassa was constructed. The first six site— codon-optimized β-recombinase under control of xylP promoter from Penicillium chrysogenum (Zadra et al., 2000) and transcriptional terminator trpC from A. nidulans—was amplified from plasmid pSK529 using fusion primers ES006JF and ES007JF (all primers are listed in Table 2). The bar r gene was amplified from plasmid pBARGEM7-1 (Pall, 1993) using fusion primers ES008JF and ES009JF. The second flanking six site was amplified from plasmid pSK529 using fusion primers ES010JF and ES011JF. Unique restriction EcoRV sites were

P

134

89 90

t1:1 t1:2

Table 1 Neurospora crassa strains used in this study.

T

133

an autonomously replicating plasmid that is subsequently lost under non-selective culture conditions (Krappmann et al., 2005). However, no widely used stable autonomously replicating nuclear plasmids are available for either N. crassa or T. reesei (Buxton and Radford, 1984; Grant et al., 1984; Stohl et al., 1984; Suzci and Radford, 1983). The cre gene must be introduced into the genome of the recipient strain, and either the proper strain of altered background or additional selective markers are needed for detecting the insertion of cre. In some cases, the insertion of cre into the genome led to an unfavorable phenotype. For example, homokaryotic N. crassa strains with insertion of cre at the his-3 site display growth and conidiation defects (Honda and Selker, 2009). Another disadvantage of the trans-acting Cre/loxP system is a possible recombination between the loxP sites remaining in the genome after each round of Cre-mediated marker removal, creating the potential risk of unwanted chromosomal rearrangements (Shaikh and Sadowski, 1997). For this reason, the inserted cre gene must be deleted after the strain engineering work is completed, and a third round of transformation and selection is needed. Recently, great advances in the serial deletion of genes in filamentous fungi was achieved by utilizing self-excising marker cassettes using either the FLP/FRT system (Khrunyk et al., 2010; Kopke et al., 2010) or β serine recombinase (β-rec) acting on six recognition sequences (Hartmann et al., 2010). Such flipper cassettes can enable one-step marker and recombinase excision. Working with the filamentous fungus A. fumigatus, Hartmann et al. (2010) successfully employed a codon-optimized prokaryotic small β serine recombinase acting on six recognition sequences (β-rec/six), which was previously shown to operate in Bacillus subtilis and in plant and mammalian cells (Canosa et al., 1996; Díaz et al., 1999; Grønlund et al., 2007). The self-excising resistance marker cassette allowed repetitive deletions of genes with only one round of transformation per gene deletion. Notably, β-rec acts in a strict cis-action manner, which enables only intramolecular recombination events (Alonso et al., 1995; Rojo and Alonso, 1994, 1995) and eliminates the risk of chromosome rearrangement, as occurs in the Cre/loxP or FLP/FRT systems (Cox, 1983). Using β-rec, Hartmann et al. (2010) successfully deleted the abr2 and pksP genes, which are located on the same chromosome and are separated by only 8 kb (Hartmann et al., 2010). However, proof of the functionality of such a system in N. crassa has not yet been provided. The purpose of this study is to demonstrate the functionality of the β-rec/six system in N. crassa. We started with N. crassa strain F5, in which six of seven β-glucosidase (bgl) genes were deleted through genetic crossing (Fan et al., 2012). In this study we describe the generation of the mus-51 deletion strain, recycling of the marker cassette, and the subsequent deletion of the global transcriptional regulator cre-1 responsible for carbon catabolite repression.

D

87 88

E. Szewczyk et al. / Journal of Microbiological Methods xxx (2012) xxx–xxx

E

2

152 153 154

156 157 158 159 160 161 162 163 164 165 166 167 168 169

Table 2 t2:1 PCR primers used in this study. Unique restriction EcoRV sites and the remaining t2:2 half-sites are underlined. t2:3 Primer name

Primer sequence (5′→3′)

t2:4

a1F a1R A1F A1R ES006JF ES007JF ES008JF ES009JF ES010JF ES011JF ES025JF ES026JF ES027JF ES028JF ES032JF ES033JF ES040JF ES041JF ES042JF ES043JF ES044JF ES045JF ES046JF ES047JF ES052JF ES053JF ES054JF ES055JF mus51 fw mus51 rev Sv739 Sv740

AGGAAATGGATGATGGTTGC CCTGAGCGATCATGTTCTGA AAGGAGAGATCGCCCTTCAT AAGCTTGGCGATGACAGAGT ATTCGAGCTCGGTACGATATCTCACTCAGGTCCTATAGG CATGTAATGCATAGTACCGAGAAAAAGAAGGATTACCTCTAAACAAGT ACTTGTTTAGAGGTAATCCTTCTTTTTCTCGGTACTATGCATTACATG ATAAGTATACTCTATTGACCTATACTAGACTCGACAGAAGATGAT ATCATCTTCTGTCGAGTCTAGTATAGGTCAATAGAGTATACTTAT CCAAGCTTGCATGCCGATATCACTAGATGGACCATATTA AATTCGAGCTCGGTACGATATCTCAGGCTGTTCTGGTGC GGACCTGAGTGAGATCATTTTGAAAGGACTTTTAAGCC TGGTCCATCTAGTGATGGGAGGGTTGCTTGTTAGC GCCAAGCTTGCATGCCGATATCGTAGCCGTTTTGGGTATCGC CATTTATTTCAGTGACCAGGG GAATGGAATGAACATGAACGC AATTCGAGCTCGGTACGATATCGAATTTCCACTTCAACAACCC GGACCTGAGTGAGATTAGATGTCCCAATTAACGTCC TGGTCCATCTAGTGATGTTGTAAAGCAACATCAGTGG GCCAAGCTTGCATGCCGATATCTCTCACTGTTTCAATCAAGCC AACGCAAGCCTTATCATGGG AGTGTGTAGTGTACTGCACC CAGGATGAGAGACTAGACGG TAGCTCAGCCTTCCTACCG CAATCTGCTGAATCCATCCG AAGAGTTCCTGACACTTGGG CCAACTCCTGTCCACTGGC ATAACCAGAGGAGAGATGGG CAGGGACAGAGAGTGACGC TATGGACCGCACTTCAGGG ACAAATAAGTATACTCTATTGACC AGAGTAGGTCATTTAAGTTGAGC

t2:5 t2:6 t2:7 t2:8 t2:9 t2:10 t2:11 t2:12 t2:13 t2:14 t2:15 t2:16 t2:17 t2:18 t2:19 t2:20 t2:21 t2:22 t2:23 t2:24 t2:25 t2:26 t2:27 t2:28 t2:29 t2:30 t2:31 t2:32 t2:33 t2:34 t2:35 t2:36

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

E. Szewczyk et al. / Journal of Microbiological Methods xxx (2012) xxx–xxx

P

R O

O

F

195 196

D

185

Plasmids from E. coli were isolated using QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). PCR products were cleaned using either a QIAquick PCR Purification Kit or a QIAquick Gel Extraction Kit (Qiagen). Genomic DNA of N. crassa for use in diagnostic PCR reactions was isolated by homogenizing macroconidia in lysis buffer (0.05 M

E

183 184

194

T

181 182

2.3. Nucleic acid manipulations

C

179 180

E

177 178

R

176

186 187

R

174 175

facilitate release of the fragment from the pUC19 vector in plasmid pmus51-βrec(bar)11. The 5′ and 3′ flanking regions of cre-1 gene (each 1.5 kb long) were amplified from genomic WT DNA using primer pair ES040JF and ES041JF and primer pair ES042JF and ES043JF, respectively. Unique restriction EcoRV sites were introduced at the ends of the deletion construct in the primers ES040JF and ES043JF (underlined) to facilitate release of the fragment from the pUC19 vector in plasmid pcre1-βrec(bar)26.

N C O

172 173

introduced at the ends of the cassette in the primers ES006JF and ES011JF (underlined in Table 2) to facilitate future release of the cassette from the vector. The resulting fusion PCR product was cloned into pCR-Blunt II-TOPO vector using a Zero Blunt TOPO PCR Cloning Kit, sequenced to confirm correct PCR amplification of the fragments, and named pβrec(bar)TOPO1. DNA constructs for mus-51 and cre-1 gene deletions were generated using GENEART Seamless Cloning and Assembly Kit, as shown in Fig. 1. Self-excising β-rec/six marker cassette was released from the plasmid pβrec(bar)TOPO1 using EcoRV restriction enzyme (Fermentas, Vilnius,. Lithuania). Two 5′ and 3′ flanking regions of mus-51 gene (each 2 kb long) were amplified from genomic DNA of N. crassa WT strain FGSC #2489 (McCluskey et al., 2010; Mylyk et al., 1974) using primer pair ES025JF and ES026JF and primer pair ES027JF and ES028JF, respectively. Unique restriction EcoRV sites were introduced at the ends of the deletion construct in the primers ES025JF and ES028JF (underlined) to

U

170 171

3

Fig. 1. Schematic illustration of deletion cassette and strain construction with subsequent marker recycling. For more details, see Materials and Methods. goi – gene of interest; X – unique restriction site releasing linear deletion cassette used in transformation of N. crassa.

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

188 189 190 191 192 193

197 198 199

224

2.5. Homokaryon purification

225

234

Knockout strains obtained after transformation and screened by PCR for eviction of the marker cassette were finally purified through genetic crossing to the F5 strain of the opposite mating type following a standard mating protocol (Perkins, 1986, 2005). Homokaryotic knockout strains with desired genotypes were selected using a PCRgenotyping method. Primers mus51 fw and mus51 rev were used for genotyping the mus-51 gene, and primers ES054JF and ES055JF were used for genotyping the cre-1 gene. Mating type of the obtained progeny was determined by primer pairs a1F and a1R for mat a, and by primer pairs A1F and A1R for mat A.

235

3. Results

236

3.1. Construction of the β serine recombinase/six(bar) cassette

237

242

The starting strain F5 already had six bgl genes replaced by the hph r marker cassettes. Hence, we could not use hph r as the selective marker in the β serine recombinase/six sequence system. Using fusion PCR technology, we successfully replaced the hph r marker in the original plasmid pSK529 with the bar r marker. The correctness of the insertion and the sequence were confirmed by DNA sequencing.

243 244

3.2. Deletion of the mus-51 gene using the β serine recombinase/six sequence system

245

To improve the efficiency of gene replacement by homologous recombination and to facilitate multiple targeted deletions in strain F5, mus-51 (NCU08290.5) was chosen as the first target for deletion. After introducing the cassette containing the β serine recombinase/ six(bar r) sequence, 40 phosphinothricin-resistant transformants were chosen and analyzed for correct gene replacement by diagnostic PCR. Primer pair ES032JF and Sv739 and primer pair ES033JF and Sv740 (Table 2; Sven Krappmann, personal communication), where one primer was located in the genome region outside of the transforming fragment and another primer was unique to the marker cassette (Fig. 2A), were used to test for the presence of the marker module at the mus-51 locus (data not shown).

232 233

238 239 240 241

246 247 248 249 250 251 252 253 254 255 256

C

230 231

E

228 229

R

226 227

R

221 222

O

219 220

C

217 218

N

211 212

U

209 210

3.3. Subsequent deletion of the cre-1 gene using the β serine recombinase/six sequence system

297 298

To validate the suitability of our system for multiple gene targeting events, the gene cre-1 (NCU08807.5) was chosen as the next target gene to knock out. The cre-1 deletion cassette was released from plasmid pcre1-βrec(bar)26 using the enzyme EcoRV. Transformation of the strain F5 mus-51::six was performed as described previously, and several transformants resistant to phosphinothricin were screened by diagnostic PCR using primer pair ES044JF and Sv739 and primer pair ES045JF and Sv740 (Fig. 3A, Table 2). All 23 transformants (100%) showed correct replacement of cre-1. However, only four transformants were homokaryotic for the deletion, as shown by diagnostic PCR specific for the coding region of the cre-1 gene (primer pair ES052JF and ES053JF; data not shown). Conidia of two of the transformants that lacked the cre-1 gene were transferred three times onto fresh medium and diluted; the single colonies formed under inducible conditions of xylose and no selective pressure of phosphinothricin were screened by diagnostic PCR for eviction of the β-rec/six(bar r) cassette. One isolate showed a PCR product of the correct size, confirming complete excision of the marker cassette. Fig. 3B shows diagnostic PCR with two different primer pairs (ES044JF and ES045JF, and ES054JF and ES055JF; Fig. 3A). The resulting 1.2-kb and 3.2-kb amplicons, respectively, are in agreement with β-rec mediated marker excision that left behind one six recombination site at the

299

F

223

One Shot TOP10 Chemically Competent E. coli cells were transformed as described by the manufacturer (Invitrogen). N. crassa conidia were transformed by electroporation according to the method of Margolin et al. (1997, 2000) and as described by Navarro-Sampedro et al. (2007). After the electroshock, 1 ml of Vogel's –N medium containing 1 M sorbitol was added, and the conidia were incubated at 30°C for 3 h with gentle shaking. Transformed conidia were plated on selective plates using molten 0.8% top agar medium (Colot et al., 2007; Pall and Brunelli, 1993).

207 208

O

215 216

Q2 206

R O

2.4. Transformation

204 205

257 258

P

214

202 203

Eight strains showed correct replacement events and were further tested by Southern hybridization (representative strains are shown in Fig. 2B). Six transformants showed the correct pattern of restriction digests and hybridization for homologous integration of a single deletion cassette. One transformant, denoted F5 mus-51::bar, was further diluted to obtain single colonies. Several single colonies were tested by diagnostic PCR (primers mus51 fw and mus51 rev; Fig. 2A and Table 2) for the successful replacement of mus-51 by the β-rec/six(barr) cassette (visible in Fig. 2C as the increase in PCR product size between parent strain F5 and deletant F5 mus-51::bar); successful replacement was found in most of the tested colonies. However, other smaller PCR products are also visible in strain F5 mus-51::bar, and the size of one of them (1.2 kb) suggests excision and eviction of the β-rec/six(bar r) cassette before induction on xylose. Single colonies were also confirmed by diagnostic PCR (primers ES046JF and ES047JF located inside the mus-51 coding region; Fig. 2A and Table 2) to contain no wild type mus-51 sequence; these colonies were subsequently induced by 2% xylose without the presence of phosphinothricin to promote β-recombinase expression and cassette excision (a 1.2-kb band in F5 mus-51::six strain; Fig. 2C). This 1.2-kb PCR band was isolated from both strains (F5 mus-51::bar and F5 mus-51::six) and sequenced, and the correct excision and presence of only one six site between mus-51 flanking regions was confirmed, suggesting that the colony has already started cassette eviction. Due to the multinuclear nature of N. crassa macroconidia and the possibility that they are heterokaryotic, three rounds of transfer to fresh media and dilution to obtain single colonies under inducible conditions were necessary to obtain homokaryotic culture due to the lack of selective pressure at this stage. Each time, after ensuring the absence of the wild type mus-51 gene, several colonies were tested by diagnostic PCR for an excision of the β-rec/six(bar r) cassette (primers mus51 fw and mus51 rev) and for the absence of the bar r gene (primers ES008JF and ES009JF; Fig. 2A and Table 2). Final strain F5 mus-51::six showed correct gene replacement and regained sensitivity to phosphinothricin (Fig. 2D), confirming excision of the marker cassette. To obtain pure homokaryons, strain F5 mus-51::six was crossed to the parental F5 strain of the opposite mating type. The resulting homokaryotic ascospores with the genotype F5 mus-51::six of both mating types were obtained.

T

213

NaOH, 1 mM EDTA, 1% Triton X-100) using a FastPrep FP120 System (Bio-101, Thermo Savant; Q-Biogene, Carlsbad, California, USA). Diagnostic PCR was performed using Taq DNA Polymerase (NEB, Beverly, MA, USA) according to the manufacturer's instructions. For fusion PCR amplification of the flanking regions and for Southern analysis, fungal genomic DNA was isolated using method of Lee et al. (1988), Lee and Taylor (1990). Fusion PCR was performed using Phusion High-Fidelity DNA Polymerase (Finnzymes, Espoo, Finland) according to the manufacturer's instructions. Southern analysis (Southern, 2006) utilized the Amersham Gene Images AlkPhos Direct Labelling and Detection System (GE Healthcare Life Sciences, Piscataway, NJ, USA) according to the manufacturer's instructions. Other molecular biology techniques were performed as described in Sambrook et al. (1989).

D

200 201

E. Szewczyk et al. / Journal of Microbiological Methods xxx (2012) xxx–xxx

E

4

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296

300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320

5

C

T

E

D

P

R O

O

F

E. Szewczyk et al. / Journal of Microbiological Methods xxx (2012) xxx–xxx

321

N C O

R

R

E

Fig. 2. Validation of site-specific recombination by the β-rec/six blaster cassette in N. crassa, resulting in marker recycling. (A) Schematic presentation of mus-51 locus after β-rec/ six(barr) replacement and subsequent marker excision. Positions of priming oligonucleotides and the restriction sites are schematically indicated. (B) Representative Southern analysis of genomic DNA isolated from parental F5 strain and one of the transformants resistant to phosphinothricin and showing correct mus-51 replacement event. The whole DNA fragment mus-51::β-rec(bar) used for transformation of N. crassa (Fig. 1) was also used as a hybridization probe. (C) Diagnostic PCR of genomic DNA isolated from corresponding strains (Fig. 2A): parental F5 strain, F5 mus-51::bar deletant, and one of the descendants purified under inducible conditions of 2% xylose and no selective pressure of phosphinothricin (F5 mus-51::six). The expected calculated sizes of DNA fragments or hybridization signals are specified in kb. (D) Growth phenotypes of the validated isolate confirm marker rescue accompanied by restoration of phosphinothricin (PPT) sensitivity. Shown are the parental F5 strain, F5 mus-51::bar deletant, and its descendant after induction of β-rec expression via passage on xylose-containing culture medium (F5 mus-51::six). Strains were point inoculated on Vogel's minimal medium with sorbose to obtain compact colony growth in the presence (+PPT) or absence (−PPT) of phosphinothricin.

336

4. Discussion

337

N. crassa, despite a long history as a model organism, has limited tools for sequential gene deletions that recycle a single selective marker.

324 325 326 327 328 329 330 331 332 333 334

338

U

335

cre-1 locus, resulting in the cre-1::six genotype. Moreover, the strain has regained sensitivity toward phisphinothricin, as demonstrated by the absence of growth when inoculated on a medium containing phosphinothricin (Fig. 3C). To confirm that no rearrangement occurred between the six sites at the cre-1 and mus-51 loci, diagnostic PCR for the mus-51 locus was also performed (Fig. 3B; primers mus51 fw and mus51 rev). Presence of the expected 1.2-kb amplicon indicated that marker excision by the β-recombinase was restricted to the six acceptor sites associated with the deletion marker at the cre-1 locus, and that marker excision did not extend to the mus-51::six “scar.” To ensure the homokaryotic nature of the deletants, the resulting F5 mus-51::six cre-1::six strain was crossed to the parental F5 strain of the opposite mating type; the progeny with the genotype F5 mus-51:: six cre-1::six of both mating types were obtained.

322 323

The first described use of the Cre/loxP recombination system required the introduction of the Cre recombinase encoding gene at the his-3 locus in the genome of N. crassa by an additional round involving transformation and analysis of transformants (Honda and Selker, 2009). Promoter ccg-1, used to drive expression of cre, was described as intensely induced by glucose deprivation or stress (McNally and Free, 1988). The frequency of complete marker excision was about 20%, which is similar to the frequency in A. fumigatus (25%) (Krappmann et al., 2005), where Cre expression was also initiated by introduction of the cre gene by transformation. A similar approach was employed by Steiger et al. (2011) in T. reesei, where the cre gene is introduced into the genome at the pyr-4 locus. However, in this case repetitive deletions are possible, as Cre expression is under tight control of the native xyn1 promoter: induction by xylan or xylose and repression by glucose (Mach-Aigner et al., 2008; Mach et al., 1996). Nevertheless, both systems are threatened by unwanted chromosomal rearrangements between loxP sites remaining in the genome after multiple rounds of deletions, when the cre recombinase gene remains in the genome. The prokaryotic β-recombinase system described here was shown to be successful in A. fumigatus and is speculated to be functional

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358

E. Szewczyk et al. / Journal of Microbiological Methods xxx (2012) xxx–xxx

R

R

E

C

T

E

D

P

R O

O

F

6

C

O

Fig. 3. Validation of sequential gene targeting and marker rescue by deletion of the cre-1 gene in a F5 mus-51::six strain. (A) Schematic representation of the cre-1 locus after β-rec/six(bar) replacement and subsequent marker excision (indicating location of the six “scar” at the mus-51 locus 2.65 Mbp upstream from cre-1 on chromosome I). Positions of priming oligonucleotides for diagnostic PCR are schematically indicated and the calculated sizes of DNA fragments are marked. (B) Diagnostic PCR with genomic DNA isolated from strain F5 mus-51::six cre-1::six purified through three rounds of induction of β-recombinase expression by propagation of single colonies on xylose-containing culture medium, interrogating the mus-51::six and cre-1::six loci. (C) Phosphinothricin sensitivity of the F5 mus-51::six cre-1::six isolate confirms marker excision. Shown are the parental strains F5 and F5 mus-51::bar, the deletion isolate F5 mus-51::six cre-1::bar and its descendant F5 mus-51::six cre-1::six, inoculated on Vogel's minimal medium in the absence (−PPT) and presence (+PPT) of phosphinothricin. The cre-1 deletion strains show typical slower growth, as compared to parental F5 strain.

362 363 364 365 366 367 368 369 370 371 372 373 374 375

in other fungal species (Hartmann et al., 2010). Here, for the first time, we show its functionality in N. crassa. The biggest advantage of this system is the strict cis action of β-recombinase. While other recombinases (such as Cre or FLP) are able to act on unlinked recombination sites, β-recombinase is restricted exclusively to intramolecular recombination events (Alonso et al., 1995; Rojo and Alonso, 1994, 1995). This eliminates the danger of undesired and uncontrolled chromosomal rearrangements, as was demonstrated in A. fumigatus for the deletions of genes abr2 and pksP placed only 8.1 kb apart on chromosome II (Hartmann et al., 2010). In our case, mus-51 and cre-1 are located on the same chromosome, albeit 2.65 Mbp apart, and their deletions did not interfere with marker excision or selection. The only difference in functionality between the β-rec/six system in A. fumigatus and in N. crassa is its lower efficiency in the latter fungus. Frequency of marker excision in A. fumigatus reaches virtually 100%. In N. crassa, we also observed eviction of the cassette in all of the transformants we obtained after

N

360 361

U

359

induction on xylose. However, about 80% of the analyzed colonies also carry the β-rec cassette. The observed mix of genotypes can be explained by the multinuclear nature of N. crassa macroconidia, as opposed to the uninucleate conidia of Aspergilli. Another reason for the low frequency of eviction may be the use of the xylP promoter from P. chrysogenum. This promoter is strongly induced and completely repressed in A. nidulans and A. fumigatus, but it has never been used in N. crassa. Nevertheless, the system is still practical for use in N. crassa because transformants lacking the β-rec cassette (20% of the transformants) can be obtained directly, and the transformants can be purified to homokaryons after genetic crossing or microconidia isolation (Ebbole and Sachs, 1990; Pandit and Maheshwari, 1993). For our purposes, the most important feature of the promoter used for recombinase expression is its ability to be repressed when sucrose is used as the carbon source and phosphinothricin as the selection reagent, which allows selection of transformants after transformation with the deletion marker cassette.

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392

E. Szewczyk et al. / Journal of Microbiological Methods xxx (2012) xxx–xxx

References

422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464

Alonso, J.C., Gutierrez, C., Rojo, F., 1995. The role of chromatin-associated protein Hbsu in beta-mediated DNA recombination is to facilitate the joining of distant recombination sites. Mol. Microbiol. 18, 471–478. Austin, B., Hall, R.M., Tyler, B.M., 1990. Optimized vectors and selection for transformation of Neurospora crassa and Aspergillus nidulans to bleomycin and phleomycin resistance. Gene 93, 157–162. Avalos, J., Geever, R.F., Case, M.E., 1989. Bialaphos resistance as a dominant selectable marker in Neurospora crassa. Curr. Genet. 16, 369–372. Borkovich, K.A., Alex, L.A., Yarden, O., Freitag, M., Turner, G.E., Read, N.D., Seiler, S., BellPedersen, D., Paietta, J., Plesofsky, N., Plamann, M., Goodrich-Tanrikulu, M., Schulte, U., Mannhaupt, G., Nargang, F.E., Radford, A., Selitrennikoff, C., Galagan, J.E., Dunlap, J.C., Loros, J.J., Catcheside, D., Inoue, H., Aramayo, R., Polymenis, M., Selker, E.U., Sachs, M.S., Marzluf, G.A., Paulsen, I., Davis, R., Ebbole, D.J., Zelter, A., Kalkman, E.R., O'Rourke, R., Bowring, F., Yeadon, J., Ishii, C., Suzuki, K., Sakai, W., Pratt, R., 2004. Lessons from the genome sequence of Neurospora crassa: tracing the path from genomic blueprint to multicellular organism. Microbiol. Mol. Biol. Rev. 68, 1–108. Brockman, H.E., de Serres, F.J., 1963. "Sorbose toxicity" in Neurospora. Am. J. Bot. 50, 709–714. Buxton, F.P., Radford, A., 1984. The transformation of mycelial spheroplasts of Neurospora crassa and the attempted isolation of an autonomous replicator. Mol. Gen. Genet. 196, 339–344. Canosa, I., Rojo, F., Alonso, J.C., 1996. Site-specific recombination by the β protein from the streptococcal plasmid pSM19035: minimal recombination sequences and crossing over site. Nucleic Acids Res. 24, 2712–2717. Case, M.E., Schweizer, M., Kushner, S.R., Giles, N.H., 1979. Efficient transformation of Neurospora crassa by utilizing hybrid plasmid DNA. Proc. Natl. Acad. Sci. U. S. A. 76, 5259–5263. Colot, H.V., Park, G., Turner, G.E., Ringelberg, C., Crew, C.M., Litvinkova, L., Weiss, R.L., Borkovich, K.A., Dunlap, J.C., 2006. A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proc. Natl. Acad. Sci. U. S. A. 103, 10352–10357. Colot, H.V., Park, G., Collopy, P.D., Krystofova, S., Ringelberg, C., Crew, C., Litvinkova, L., Curilla, S., Altamirano, L., Gorrochotegui-Escalante, N., Wang, W., Borkovich, K.A., Dunlap, J.C., 2007. How to create gene knockouts in Neurospora. Fungal Genetics Stock Center website: http://www.fgsc.net/neurosporaprotocols/How%20to%20create% 20gene%20knockouts%20in%20Neurospora.pdf. Cox, M.M., 1983. The FLP protein of the yeast 2-μμ plasmid: expression of a eukaryotic genetic recombination system in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 80, 4223–4227. Davis, R.H., 2000. Neurospora: contributions of a Model Organism. Oxford University Press, Oxford. Davis, R.H., Perkins, D.D., 2002. Timeline: Neurospora: a model of model microbes. Nat. Rev. Genet. 3, 397–403.

C

418 419

E

416 417

R

414 415

R

408 409

N C O

406 407

U

404 405

F

421

402 403

O

420

We thank Dr. Sven Krappmann (Julius-Maximilians-Universität, Würzburg) for the generous gift of pSK529 and constructive discussions, as well as communications and advice. This project was supported by Agriculture and Food Research Initiative Competitive Grant No. 2011-67009-20060 from the USDA's National Institute of Food and Agriculture. The authors thank Professor Rebecca Parales for the NanoDrop equipment and Drs. Ravi Bhat and Greg Browne for support in performing Southern blots.

400 401

R O

413

399

P

Acknowledgements

397 398

Díaz, V., Rojo, F., Martínez, A.C., Alonso, J.C., Bernad, A., 1999. The prokaryotic βrecombinase catalyzes site-specific recombination in mammalian cells. J. Biol. Chem. 274, 6634–6640. Ebbole, D.J., 1990. Vectors for construction of translational fusions to β−galactosidase. Fungal Genet. Newsl. 37, 15. Ebbole, D.J., Sachs, M.S., 1990. A rapid and simple method for isolation of Neurospora crassa homokaryons using microconidia. Fungal Genet. Newsl. 37, 17–18. Fan, Z., Wu, W., Hildebrand, A., Kasuga, T., Zhang, R., Xiong, X., 2012. A novel biochemical route for fuels and chemicals production from cellulosic biomass. PLoS One 7, e31693. Florea, S., Andreeva, K., Machado, C., Mirabito, P.M., Schardl, C.L., 2009. Elimination of marker genes from transformed filamentous fungi by unselected transient transfection with a Cre-expressing plasmid. Fungal Genet. Biol. 46, 721–730. Forment, J.V., Ramón, D., MacCabe, A.P., 2006. Consecutive gene deletions in Aspergillus nidulans: application of the Cre/loxP system. Curr. Genet. 50, 217–224. Grant, D.M., Lambowitz, A.M., Rambosek, J.A., Kinsey, J.A., 1984. Transformation of Neurospora crassa with recombinant plasmids containing the cloned glutamate dehydrogenase (am) gene: evidence for autonomous replication of the transforming plasmid. Mol. Cell. Biol. 4, 2041–2051. Grønlund, J.T., Stemmer, C., Lichota, J., Merkle, T., Grasser, K.D., 2007. Functionality of the β/six site-specific recombination system in tobacco and Arabidopsis: a novel tool for genetic engineering of plant genomes. Plant Mol. Biol. 63, 545–556. Hartmann, T., Dümig, M., Jaber, B.M., Szewczyk, E., Olbermann, P., Morschhäuser, J., Krappmann, S., 2010. Validation of a self-excising marker in the human pathogen Aspergillus fumigatus by employing the β-rec/six site-specific recombination system. Appl. Environ. Microbiol. 76, 6313–6317. Honda, S., Selker, E.U., 2009. Tools for fungal proteomics: multifunctional Neurospora vectors for gene replacement, protein expression and protein purification. Genetics 182, 11–23. Ishibashi, K., Suzuki, K., Ando, Y., Takakura, C., Inoue, H., 2006. Nonhomologous chromosomal integration of foreign DNA is completely dependent on MUS-53 (human Lig4 homolog) in Neurospora. Proc. Natl. Acad. Sci. U. S. A. 103, 14871–14876. Khrunyk, Y., Münch, K., Schipper, K., Lupas, A.N., Kahmann, R., 2010. The use of FLPmediated recombination for the functional analysis of an effector gene family in the biotrophic smut fungus Ustilago maydis. New Phytol. 187, 957–968. Kinsey, J.A., Rambosek, J.A., 1984. Transformation of Neurospora crassa with the cloned am (glutamate dehydrogenase) gene. Mol. Cell. Biol. 4, 117–122. Kopke, K., Hoff, B., Kück, U., 2010. Application of the Saccharomyces cerevisiae FLP/FRT recombination system in filamentous fungi for marker recycling and construction of knockout strains devoid of heterologous genes. Appl. Environ. Microbiol. 76, 4664–4674. Krappmann, S., Bayram, O., Braus, G.H., 2005. Deletion and allelic exchange of the Aspergillus fumigatus veA locus via a novel recyclable marker module. Eukaryot. Cell 4, 1298–1307. Kück, U., Hoff, B., 2010. New tools for the genetic manipulation of filamentous fungi. Appl. Microbiol. Biotechnol. 86, 51–62. Lee, S.B., Taylor, J.W., 1990. Isolation of DNA from fungal mycelia and single spores. In: Innis, M., Gelfand, D., Sninsky, J., White, T. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, Orlando, Florida. Lee, S.B., Milgroom, M.G., Taylor, J.W., 1988. A rapid, high yield mini-prep method for isolation of total genomic DNA from fungi. Fungal Genet. Newsl. 35, 23–24. Lee, D.W., Haag, J.R., Aramayo, R., 2003. Construction of strains for rapid homokaryon purification after integration of constructs at the histidine-3 (his-3) locus of Neurospora crassa. Curr. Genet. 43, 17–23. Low, W., Jedd, G., 2008. An improved plasmid for transformation of Neurospora crassa using the pan-2 gene as a selectable marker. Fungal Genet. Rep. 55, 44–45. Mach, R.L., Strauss, J., Zeilinger, S., Schindler, M., Kubicek, C.P., 1996. Carbon catabolite repression of xylanase I (xyn1) gene expression in Trichoderma reesei. Mol. Microbiol. 21, 1273–1281. Mach-Aigner, A.R., Pucher, M.E., Steiger, M.G., Bauer, G.E., Preis, S.J., Mach, R.L., 2008. Transcriptional regulation of xyr1, encoding the main regulator of the xylanolytic and cellulolytic enzyme system in Hypocrea jecorina. Appl. Environ. Microbiol. 74, 6554–6562. Margolin, B.S., Freitag, M., Selker, E.U., 1997. Improved plasmids for gene targeting at the his-3 locus of Neurospora crassa by electroporation. Fungal Genet. Newsl. 44, 34–36. Margolin, B.S., Freitag, M., Selker, E.U., 2000. Improved plasmids for gene targeting at the his-3 locus of Neurospora crassa by electroporation: correction. Fungal Genet. Newsl. 47, 112. McCluskey, K., Wiest, A., Plamann, M., 2010. The Fungal Genetics Stock Center: a repository for 50 years of fungal genetics research. J. Biosci. 35, 119–126. McNally, M.T., Free, S.J., 1988. Isolation and characterization of a Neurospora glucoserepressible gene. Curr. Genet. 14, 545–551. Mizutani, O., Masaki, K., Gomi, K., Iefuji, H., 2012. Modified Cre-loxP recombination in Aspergillus oryzae by direct introduction of Cre recombinase for marker gene rescue. Appl. Environ. Microbiol. 78, 4126–4133. Mylyk, O.M., Barry, E.G., Galeazzi, D.R., 1974. New isogenic wild types in N. crassa. Neurospora Newsl. 21, 24. Navarro-Sampedro, L., Olmedo, M., Corrochano, L.M., 2007. How to transform Neurospora crassa by electroporation. http://www.fgsc.net/neurosporaprotocols/How%20to% 20transform%20Nc%20by%20electroporation.pdf. Ninomiya, Y., Suzuki, K., Ishii, C., Inoue, H., 2004. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. U. S. A. 101, 12248–12253. Paietta, J.V., Marzluf, G.A., 1985. Gene disruption by transformation in Neurospora crassa. Mol. Cell. Biol. 5, 1554–1559.

D

412

395 396

T

410 411

The xylP promoter seems to fulfill this task successfully in N. crassa. Even if its induction rate is not as high as in Aspergilli, it is still possible to obtain deletants with the proper excision of the cassette and a single six “scar” replacing the deleted gene (20% of transformants). Future improvements to the construct may include use of a better inducer for the xylP promoter, use of a better inducible promoter of N. crassa, use of a bidirectional marker, or the introduction of the tk gene (Lee et al., 2003), allowing fast-forward, one-step, positive screening process for the excision event and automatic homokaryon purification (currently in progress). The frequency of cassette eviction should not be confused with the frequency of gene replacement by homologous recombination. Deletion of the mus-51 gene in strain F5 occurred with a frequency of 20%, well within the range of 10–30% of homologous recombination events described for wild type strains (Ninomiya et al., 2004; Paietta and Marzluf, 1985). Subsequent deletion of the cre-1 gene in the Δmus-51 strain shows 100% homologous recombination, as expected for the NHEJ deficient strain of N. crassa (Ninomiya et al., 2004).

E

393 394

7

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550

Steiger, M.G., Vitikainen, M., Uskonen, P., Brunner, K., Adam, G., Pakula, T., Penttila, M., Saloheimo, M., Mach, R.L., Mach-Aigner, A.R., 2011. Transformation system for Hypocrea jecorina (Trichoderma reesei) that favors homologous Integration and mmploys reusable didirectionally selectable markers. Appl. Environ. Microbiol. 77, 114–121. Stohl, L.L., Akins, R.A., Lambowitz, A.M., 1984. Characterization of deletion derivatives of an autonomously replicating Neurospora plasmid. Nucleic Acids Res. 12, 6169–6178. Straubinger, B., Straubinger, E., Wirsel, S., Turgeon, B.G., Yoder, O.C., 1992. Versatile transformation vectors carrying the bar gene of Streptomyces hygroscopicus. Fungal Genet. Newsl. 39, 82–83. Suzci, A., Radford, A., 1983. ARS8 sequences in the Neurospora genome. Neurospora Newsl. 30, 13. Szewczyk, E., Nayak, T., Oakley, C.E., Edgerton, H., Xiong, Y., Taheri-Talesh, N., Osmani, S.A., Oakley, B.R., 2006. Fusion PCR and gene targeting in Aspergillus nidulans. Nat. Protoc. 1, 3111–3120. Turner, G.E., Jimenez, T.J., Chae, S.K., Baasiri, R.A., Borkovich, K.A., 1997. Utilization of the Aspergillus nidulans pyrG gene as a selectable marker for transformation and electroporation of Neurospora crassa. Fungal Genet. Newsl. 44, 57–59. Vogel, H.J., 1956. A convenient growth medium for Neurospora. Microbiol. Genet. Bull. 13, 42–46. Zadra, I., Abt, B., Parson, W., Haas, H., 2000. xylP promoter-based expression system and its use for antisense downregulation of the Penicillium chrysogenum nitrogen regulator NRE. Appl. Environ. Microbiol. 66, 4810–4816. Znameroski, E.A., Coradetti, S.T., Roche, C.M., Tsai, J.C., Iavarone, A.T., Cate, J.H., Glass, N.L., 2012. Induction of lignocellulose-degrading enzymes in Neurospora crassa by cellodextrins. Proc. Natl. Acad. Sci. U. S. A. 109, 6012–6017.

F

Pall, M.L., 1993. The use of Ignite (Basta;glufosinate;phosphinothricin) to select transformants of bar-containing plasmids in Neurospora crassa. Fungal Genet. Newsl. 40, 58. Pall, M.L., Brunelli, J.P., 1993. A series of six compact fungal transformation vectors containing polylinkers with multiple unique restriction sites. Fungal Genet. Newsl. 40, 59–62. Pandit, A., Maheshwari, R., 1993. A simple method of obtaining pure microconidia in Neurospora crassa. Fungal Genet. Newsl. 40, 64–65. Perkins, D.D., 1986. Hints and precautions for the care, feeding and breeding of Neurospora. Fungal Genet. Newsl. 33, 35. Perkins, D.D., 2005. How to make a cross. Fungal Genetics Stock Center website: http:// www.fgsc.net/neurosporaprotocols/How%20to%20make%20a%20cross-2.pdf. Perkins, D.D., 2006. How to convert wild-type spreading growth to colonial. http://www. fgsc.net/neurosporaprotocols/How%20to%20convert%20wild-type%20spreading% 20growth%20to%20colonial.pdf. Rojo, F., Alonso, J.C., 1994. A novel site-specific recombinase encoded by the Streptococcus pyogenes plasmid pSM19035. J. Mol. Biol. 238, 159–172. Rojo, F., Alonso, J.C., 1995. The beta recombinase of plasmid pSM19035 binds to two adjacent sites, making different contacts at each of them. Nucleic Acids Res. 23, 3181–3188. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring harbor Laborotory Press, New York. Shaikh, A.C., Sadowski, P.D., 1997. The Cre recombinase cleaves the lox site in trans. J. Biol. Chem. 272, 5695–5702. Southern, E., 2006. Southern blotting. Nat. Protoc. 1, 518–525. Staben, C., Jensen, B.C., Singer, M., Pollock, J., Schechtman, M., Kinsey, J.A., Selker, E.U., 1989. Use of bacterial hygromycin B resistance gene as a dominant selectable marker in Neurospora crassa transformation. Fungal Genet. Newsl. 36, 79–81.

O

551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578

E. Szewczyk et al. / Journal of Microbiological Methods xxx (2012) xxx–xxx

R O

8

U

N

C

O

R

R

E

C

T

E

D

P

606

Please cite this article as: Szewczyk, E., et al., Efficient sequential repetitive gene deletions in Neurospora crassa employing a self-excising β-recombinase/six cassette, J. Microbiol. Methods (2012), http://dx.doi.org/10.1016/j.mimet.2012.12.004

579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605