JOURNAL OF NEUROCHEMISTRY
,1 , ,
| 2010 | 115 | 283–295
doi: 10.1111/j.1471-4159.2010.06928.x
,1,2 ,
*Institut de Neuropatologia, Servei d’Anatomia Patolo`gica, IDIBELL-Hospital Universitari de Bellvitge, L’Hospitalet de Llobregat, Spain Departamento de Quı´mica Inorga´nica, Orga´nica y Bioquı´mica, Facultad de Quı´micas, Centro Regional de Investigaciones Biome´dicas, Universidad de Castilla-La Mancha, Ciudad Real, Spain àUnitat de Neuropatologia Experimental, Departament de Patologia i Terape`utica Experimental, Universitat de Barcelona, L’Hospitalet de Llobregat, Spain §Centro de Investigacio´n Biome´dica en Red sobre Enfermedades Neurodegenerativas, CIBERNED, Barcelona, Spain
Abstract Adenosine A2A receptors (A2ARs) are G-protein coupled receptors that stimulate adenylyl cyclase activity. The most A2ARs-enriched brain region is the striatum, in which A2ARs are largely restricted to GABAergic neurons of the indirect pathway. We recently described how DNA methylation controls basal A2AR expression levels in human cell lines. The present report provides clues about the molecular mechanisms that promote human brain region-specific A2AR gene (ADORA2A) basal expression. The transcription factors ZBP89 and Yin Yang-1 (YY1) have been characterized as regulators of ADORA2A in SH-SY5Y cells by means of specific
expression vectors/siRNAs transient transfection and chromatin immunoprecipitation assay. ZBP-89 plays a role as an activator and YY1 as a repressor. No differences were found in ZBP-89 levels with western blot between the putamen and cerebellum of human postmortem brains. However, increased YY1 levels and DNA methylation percentage in the 5¢ untranslated region of ADORA2A, using SEQUENOM MassArray, were found in the cerebellum with respect to the putamen of human brains, showing an inverse relationship with A2AR levels in the two cerebral regions. Keywords: ADORA2A, DNA methylation, YY1, ZBP-89. J. Neurochem. (2010) 115, 283–295.
Adenosine is an endogenous purine nucleoside that mediates a wide variety of physiological functions by interaction with four G-protein coupled receptors which modulate adenylate cyclase activity: A1, A2A, A2B and A3 (Fredholm et al. 2001). In CNS, A1Rs are associated with neuroprotective processes and they are up-regulated in human neurodegenerative diseases with abnormal protein aggregates (Angulo et al. 2003; Rodrı´guez et al. 2006; Albasanz et al. 2007, 2008; Perez-Buira et al. 2007). By contrast, Adenosine A2A receptors (A2ARs) activity is related to the modulation of glutamate release in the brain and is associated with the outcome of cerebral injury as well as the development of beta-amyloid-induced synaptotoxicity (Cunha 2005; Canas et al. 2009; Stone et al. 2009). The most A2ARs-enriched brain region is the striatum, in which A2ARs are largely restricted to GABAergic neurons of the indirect pathway,
Received June 3, 2010; revised manuscript received July 2, 2010; accepted July 20, 2010. Address correspondence and reprint requests to Marta Barrachina, Institut de Neuropatologia, Servei d’Anatomia Patolo`gica, IDIBELLHospital Universitari de Bellvitge, c/Feixa Llarga sn, 08907 L’Hospitalet de Llobregat, Spain. E-mail:
[email protected] 1 These authors contributed equally to this study. 2 The present address of Guido Dentesano is the Department of Cerebral Ischaemia and Neurodegeneration, IIBB, CSIC, IDIBAPS, Barcelona, Spain. Abbreviations used: A2AR, adenosine A2A receptor; AD, Alzheimer’s disease; ADORA2A, adenosine A2A receptor gene; CGI, CpG island; ChIP, chromatin immunoprecipitation; CpG, dinucleotide CG; GUSB, b-glucuronidase; HA, Tag from influenza hemagglutinin protein; pCMV, cytomegalovirus promoter; PD, Parkinson’s disease; RA, retinoic acid; UTR, untranslated region; YY1, Yin Yang-1; ZBP-89, zinc finger binding protein 89.
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
283
284 | S. P. Buira et al.
projecting from the caudate putamen to the external globus pallidus (Meng et al. 1994; Peterfreund et al. 1996; Rosin et al. 1998; Yu et al. 2004). However, few reports have focused on A2AR gene (ADORA2A) transcription regulation (St. Hilaire et al. 2009), which is localized to chromosome 22 (MacCollin et al. 1994; Le et al. 1996; Peterfreund et al. 1996). We recently showed that DNA methylation plays a role in its basal expression in several human cell lines (Buira et al. 2010). Based on these findings, our study was designed to: (i) determine whether differential DNA methylation pattern of ADORA2A correlated with brain A2AR regionspecific expression levels, and (ii) identify and clarify the role of several transcription factors in basal ADORA2A expression.
Material and methods Human brain samples The human postmortem brain samples were obtained from the brain bank of the Institute of Neuropathology (Hospital of Bellvitge). The donation and obtaining of samples (CNS) were regulated by the ethics committee of this institution. The sample processing followed the rules of the European Consortium of Nervous Tissues: BrainNet Europe II. All the samples were protected in terms of individual donor identification following the BrainNet Europe II laws. One half of each brain was maintained in 4% buffered formalin for morphological and immunohistochemical studies, while the other half was processed in coronal sections to be frozen at )80C and made available for biochemical studies. The neuropathological exams were realized in all cases on 20 sections of brain, both cerebellum and brainstem, stained with haematoxylin and eosin, luxol fast blue-Klu¨ver Barrera, and subjected to immunohistochemistry for glial fibrillary acidic protein, microglial markers, b-amyloid, phosphorylated tau (including antibody AT8), a-synuclein, aB-crystalin, ubiquitin and TAR DNAbinding protein 43 (TDP-43). Control brains were from individuals without neurological history or neuropathological lesions after the standard exam. All cases analyzed are summarized in Table 1. Cell culture Human neuroblastoma SH-SY5Y cell line was maintained in Dulbecco’s modified Eagle’s medium (Invitrogen, El Prat de Llobregat, Spain) (ECACC number: 94030304) supplemented with 10% fetal bovine serum. Depending on experimental conditions, Table 1 Analyzed human postmortem brains Case number
Gender
Age
P-m delay
1 2 3 4 5 6
M F F F M M
64 71 64 55 66 49
3:30 8:30 5 8:30 3:05 9:25
Putamen and cerebellum from control brains were analyzed. M, male; F, female; P-m delay, postmortem delay in hours.
cells were maintained in culture with 10 lM of retinoic acid (RA) (Sigma, Madrid, Spain), which was added every 48 h. Cells were grown at 37C in a humidified atmosphere of 5% CO2. Quantitative DNA methylation analysis DNA purification, bisulfite treatment and quantitative DNA methylation analysis by MassArray platform of SEQUENOM were performed, as recently described (Barrachina and Ferrer 2009). Three loci of 5¢ untranslated region (UTR) of ADORA2A gene were analyzed to learn their percentage of DNA methylation. Primers for each region were designed using MethPrimer (http://www. urogene.org/methprimer/). Every reverse primer presented a T7-promoter tagged to obtain an appropriate product for in vitro transcription and an 8 bp insert to prevent abortive cycling. The forward primers contained a 10mer-tagged to balance the PCR primer length. The sequences of primers used for amplification of bisulfite-treated DNA were (included tags are indicated below in lower case and underlined): A2AR-10069 (PCR 1): forward, 5¢-aggaagagagTTAGTTTGATTAATATGGTGAAATAT-3¢, reverse, 5¢-cagtaatacgactcactatagggagaaggctCCCCCTACAAACAACTTTAAAAC-3¢; A2AR-8973 (PCR 2): forward, 5¢-aggaagagagGAGTTTTTTTAGTAGGGATGGAT-3¢, reverse, 5¢-cagtaatacgactcactatagggagaaggctAACCTAAAACCCAACCCTAAATCT-3¢; A2AR-7883 (PCR 3): forward, 5¢-aggaagagagTTTTTAGTGTTGAGTTGGTTGAGTT-3¢, reverse, 5¢-cagtaatacgactcactatagggagaaggctACAATCCCTATAATATCCCCTAACC-3¢; More detailed information about these primers and PCR reactions is found in Table 2. ZBP-89 and Yin Yang-1 siRNA transfection SH-SY5Y cells were plated on 6-well dishes at a concentration of 50 000 cells/well and cultured overnight before siRNA transfection. Then the cells were transfected with 100 pmol of zinc finger binding protein 89 (ZBP-89) siRNA (5¢-GGUGAUGAGACAAACCAUGtt3¢; Ambion, siRNA ID# 109422, Madrid, Spain), Yin Yang-1 (YY1) siRNA (5¢-GGAGGACAAUUCAUGAACUtt-3¢; Ambion, siRNA ID# 107093) and a negative control or scramble siRNA (Ambion, Cat. Nº4611) in OptiMEM (Invitrogen) using LipofectamineTM 2000 (Invitrogen), following the instructions of the manufacturer. After 5 h of transfection, the OptiMEM medium was replaced with complete fresh medium. For YY1 siRNA transfection, cells were treated again with 10 lM RA for 48 h. Cell transfection with ZBP-89 and YY1 expression vector SH-SY5Y cells were plated in 6-well dishes at a concentration of 105 cells/well and cultured overnight before transfection. 1 lg of ZBP-89 vector (kindly provided by Dr. W. Hammerschmidt) or 1 lg of cytomegalovirus promoter (pCMV)/Tag from in fluenza hemagglutinin protein (HA)-YY1 vector (kindly provided by Dr. Shi) was transfected in OptiMEM (Invitrogen) using LipofectamineTM 2000 (Invitrogen) following the instructions of the manufacturer. After 5 h of transfection, the medium was replaced with completely fresh medium. YY1 over-expression in RA-treated SH-SY5Y cells was carried out in the same way as described for siRNA transfection. The lipofectamine transfection presented 60% efficiency. RNA purification The purification of RNA from cell lines was carried out with RNeasy Midi kit (Qiagen, Hilden, Germany) following the protocol
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
ZBP-89 and Yin Yang-1 control ADORA2A expression | 285
Table 2 PCRs carried out in 5¢ UTR region of ADORA2A to analyze the percentage of DNA methylation
PCR 1 PCR 2 PCR 3
Localization in human genomic contig NT_011520
Position with respect to ATG site (exon 2)a
Sequence length (bp)b
Annealing temperature (C)
4209874–4210419 4210970–4211473 4212060–4212568
)10069/)9524 )8973/)8470 )7883/)7375
546 504 509
60 62 62
a
Human ADORA2A mRNA (GenBank number NM_000675) was aligned with human genomic sequence, establishing that ATG is located at position 4219943 (contig GenBank number NT_011520). b The PCR product length contains an additional 41 bp corresponding to the tag length incorporated in every forward and reverse primer (underlined sequences; see Material and methods section).
provided by the manufacturer. The concentration of each sample was obtained from A260 measurements with Nanodrop 1000. RNA integrity was tested using the Agilent 2100 BioAnalyzer (Agilent, Santa Clara, CA, USA). RT reaction This reaction was carried out using the High capacity cDNA Archive kit (Applied Biosystems, Madrid, Spain) following the protocol provided by the supplier. Parallel reactions for each RNA sample were run in the absence of MultiScribe Reverse Transcriptase to assess the degree of contaminating genomic DNA. TaqMan PCR TaqMan PCR assays for every gene were performed in duplicate on cDNA samples in 384-well optical plates using an ABI Prism 7900 Sequence Detection system (Applied Biosystems). For each 20 lL TaqMan reaction, 9 lL cDNA (diluted 1/20, which corresponds approximately to the cDNA from 22 ng of RNA) was mixed with 1 lL 20· TaqMan Gene Expression Assays and 10 lL of 2· TaqMan Universal PCR Master Mix (Applied Biosystems). Parallel assays for each sample were carried out using primers and probe for b-glucuronidase (GUSB) for normalization. Standard curves were prepared for every gene analyzed using serial dilutions of SH-SY5Y cells. The PCR conditions and TaqMan probe information are the same as previously described (Albasanz et al. 2008). Finally, all TaqMan PCR data were captured using the Sequence Detector Software (SDS version 1.9, Applied Biosystems). The identification numbers for ZBP-89, YY1 and GUSB TaqMan probes were Hs00222661_m1, Hs00231533_m1, and Hs99999908_m1, respectively (Applied Biosystems). Western blot Retinoic acid-treated and non-treated SH-SY5Y cells were lysed with ristocetin-induced platelet agglutination buffer. Lysates were maintained in agitation for 30 min at 4C and then centrifuged at 15 000 g for 12 min at 4C. Striatal and cerebellar plasma membrane extracts from human postmortem samples were purified as described (Perez-Buira et al. 2007). Protein concentration was determined with BCA (Pierce, Woburn, MA, USA) method. 20 lg of the resultant supernatant was used for western blot analysis as described (Perez-Buira et al. 2007). The following antibodies were used: rabbit polyclonal A2AR (ab3461, Abcam, Cambridge, UK) used at a dilution of 1 : 2000, rabbit polyclonal ZBP-89 (H-184, sc-48811, Santa Cruz Biotechnology, Santa Cruz, CA, USA) used at
a dilution of 1 : 1000, monoclonal YY1 antibody (ab58066, Abcam) diluted 1 : 1000, and mouse monoclonal anti-b-actin (clone AC-74, Sigma) diluted 1 : 5000. Quantitative chromatin immunoprecipitation Chromatin shearing was obtained from 10 000 retinoic acid-treated and non-treated SH-SY5Y cells for 48 h, using the BioruptorTM from Diagenode (Liege, Belgium). The resultant DNA (between 200 and 500 bp) was immunoprecipitated with 10 lg of an anti-ZBP-89 (H-184X, Santa Cruz Biotechnology) or 2 lg of an anti-YY1 (C-20X, Santa Cruz Biotechnology). As a negative control, immunoprecipitation was performed with a rabbit serum (2 and 10 lg for anti-ZBP89 and anti-YY1 ChIPs, respectively) (sc-2338, Santa Cruz Biotechnology) using the Magnetic LowCell ChIP kit (Diagenode). In parallel, an aliquot of chromatin sheared from each sample was separated as a loading control of the experiment (Input). The protocol for each chromatin immunoprecipitation (ChIP) was as follows: First, 11 lL of protein A-coated magnetic beads was washed twice with 22 lL of ice-cold buffer A (provided with the kit) and centrifuged for 5 min at 180 g. Then the beads pellet was resuspended in 11 lL of Buffer A. Next, 90 lL of Buffer A was aliquotated in a PCR tube and 10 lL of pre-washed protein A-beads was added. The specific antibody was added and the PCR tube was incubated at 40 rpm on a rotating wheel for at least 2 h at 4C. After this, the tube was placed on an ice-cold magnetic rack for 1 min. The supernatant was discarded and 100 lL of sheared chromatin was added. Then, the PCR tube was placed again at 40 rpm on a rotating wheel for at least 2 h at 4C. Finally, the tube was placed on the magnetic rack for 1 min. The supernatant was discarded and the magnetic beads were washed three times with 100 lL of Buffer A for 4 min on a rotating wheel and placed in the magnetic rack again for 1 min to discard the supernatant. The fourth wash was done with Buffer C (provided by the kit). Then, 100 lL of DNA purifying slurry (also for the Input) was used to wash the magnetic beads, which were then transferred to a 1.5 mL tube. This was boiled for 10 min and then 1 lL of proteinase K was added (provided by the kit) and incubated for 30 min at 55C. A last incubation in boiling water was carried out for 10 min, and then the sample was centrifuged for 1 min at 15 300 g at 4C. 150 lL and 50 lL of supernatant from Input and ChIP samples were transferred to new tubes, respectively. An additional 100 lL of water was added to the pellet of ChIP sample. This was centrifuged and 100 lL was collected and pooled with the previous supernatant. The analysis of ChIP was performed with real time PCR using SYBR green
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
286 | S. P. Buira et al.
technology (Applied Biosystems). Five lL of Input DNA (diluted 1/ 20) and ChIP were amplified in triplicate in 384-well optical plates using an ABI Prism 7900 Sequence Detection system (Applied Biosystems). The PCR reaction was carried out with 0.5 lL of forward and reverse primers (10 lM) and 12.5 lL of master mix in a final volume of 25 lL. The sequence and the PCR product length for each locus are indicated in Tables 4 and 6. The reactions were performed using the following parameters: 50C for 2 min, 95C for 10 min, and 40 cycles of 95C for 15 s and 60C for 1 min. All real time PCR data were captured using the Sequence Detector Software (SDS version 1.9, Applied Biosystems), and PCR products were evaluated by SYBR green melting curve analyses as well as being checked by agarose gels. The value of the ChIP/Input ratio (percentage) was calculated following the instructions provided by the Magnetic LowCell ChIP kit (Diagenode). Statistical analysis All results were analyzed with Statgraphics Plus v5 software (StatPoint Technologies, Inc., Warrenton, VA, USA), using ANOVA with post-hoc Scheffe test. Differences between mean values were considered statistically significant at p < 0.05.
Results Low A2A R levels and increased DNA methylation pattern in ADORA2A are found in the cerebellum of control brains We previously described how DNA methylation controls basal ADORA2A expression in several cell lines (Buira et al. 2010). Based on these findings, we decided to examine whether this epigenetic marker might explain basal A2AR levels in several cerebral areas. First, we observed that A2AR protein levels were higher in the putamen when compared by western blot (Fig. 1a) with cerebellum from six control brains (Table 1), as previously described (Peterfreund et al. 1996). Then we proceeded to determine the percentage of DNA methylation in the 5¢UTR region of ADORA2A in both cerebral areas using the MassARRAY platform of SEQUENOM (Ehrich et al. 2005). This region consists of exon 1 which is a non-coding exon presenting six tissue-specific isoforms: h1A–h1F (Yu et al. 2004). We recently identified three dinucleotide CG (CpG) islands (CGI) surrounding exon 1E and these are schematically represented in Fig. 1(b) (Buira et al. 2010). Three loci of this region were amplified by PCR after genomic DNA bisulfite treatment of all human postmortem brains indicated in Table 1. The three loci were analyzed with PCRs numbers 1–3 (Fig. 1c). PCR 1 covered part of the CGI#1 and CGI#2, PCR 2 matched with part of CGI#2, and PCR 3 with the entire CGI#3. Interestingly, PCR2 and PCR3 revealed an increase in the percentage of DNA methylation in the 5¢UTR region of ADORA2A in the cerebellum with respect to the putamen in all control brains. In contrast to this, a certain loss of DNA methylation in the cerebellum versus the putamen was observed in PCR1. This result is consistent with the existence of low basal A2AR protein levels in the cerebellum.
ZBP-89 is an activator of ADORA2A After the epigenetic study performed in ADORA2A, we wanted to gain knowledge about transcription factors that regulate expression of A2AR. For this purpose, an in silico analysis of the sequence shown in Fig. 1(b) was carried out using the MatInspector software (Cartharius et al. 2005). Nineteen putative DNA binding sites were predicted for the transcription factor ZBP-89, whose positions and sequence are indicated in Table 3. Next, we used two strategies to test whether ZBP-89 regulated ADORA2A expression. First, we transfected an expression vector containing the ZBP-89 cDNA (kindly provided by Dr. Hammerschmidt) in SH-SY5Y cells. Surprisingly, A2AR mRNA levels could not be tested because ZBP-89 over-expression promoted a high percentage of cell death (data not shown). We attributed this finding to the induction of apoptosis previously described for ZBP-89 (Bai and Merchant 2001; Bai et al. 2004). Second, the reduction of endogenous ZBP-89 protein levels with a specific siRNA (Fig. 2a) promoted a decrease in the basal A2AR mRNA levels (Fig. 2b). The results were specific, as the transfection of the scramble (sc) siRNA did not modify the endogenous ZBP-89 and A2AR levels. Moreover, the analysis of siRNA transfection was performed by TaqMan PCR using the GUSB as endogenous control, which was not modified in these experimental conditions as it presented a reduced DCt value. Therefore, these results indicated that ZBP-89 is an activator of basal A2AR mRNA levels in SH-SY5Y cells. Moreover, we carried out cellular transfections with different ZBP-89 siRNA concentrations showing the same percentage of ZBP-89 reduction as well as the same effect on A2AR mRNA levels (Figure S1a). Finally, we checked whether the role of ZBP-89 on ADORA2A expression was directly through an interaction with the 5¢UTR region. Then, a ChIP assay was carried out in SH-SY5Y cells. After cross-linking of proteins and DNA with formaldehyde, sonicated cell lysates from these cells were subjected to immunoprecipitation with the rabbit polyclonal anti-ZBP89 antibody. The precipitated DNA fragments were amplified with four sets of primers, including seven ZBP-89 binding sites of the 19 predicted in ADORA2A (Table 4, Fig. 3a). ChIP PCR products were detected with the ZBP-89 antibody but not with the rabbit serum used as a negative control (IgG), nor with the magnetic beads included in the commercial kit used, except at ZBP-89 binding site #2, whose immunoprecipitation was unspecific, as it was amplified in the same way using the rabbit serum (Fig. 3b). As a positive control, a PCR product covering a locus in the gastrin gene promoter region was obtained with the ZBP-89 antibody (Fig. 3c), as previously described (Merchant et al. 1996). The SyBrGreen PCR reactions performed in the analysis of each ChIP only amplified one specific PCR product, as dissociation curve plots show (Figure S2). In conclusion, these results show that ZBP-89 acts as an activator and that it binds to ADORA2A.
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
ZBP-89 and Yin Yang-1 control ADORA2A expression | 287
YY1 is a repressor of ADORA2A The MatInspector analysis also revealed another transcription factor candidate to regulate ADORA2A expression. Seven putative binding sites for YY1 were predicted (Fig. 4a,
Table 3 Information about the 19 ZBP-89 binding sites predicted in 5¢UTR region of ADORA2A ZBP-89 binding site number (#)
ZBP-89 binding site sequence (5¢ fi 3¢) Consensus: gccCCtCCxCC
Genomic localization respect to ATG
#1 #2 #3 #4 #5 #6 #7 #8 #9 #10 #11 #12 #13 #14 #15 #16 #17 #18 #19
cacgccctctCCCCcacctgctc ctcctcacctCCCCcaacctggc tggcatccctCCCCcacagcccg gctccccacaCCCCcatgtgtcc gggccactcaCCCCctcacacga tgagcagcctCCCCcaggctggc tctctcaccaCCCCccgccaaca ctccacagcaCCCCcaccacaca gtgggcagcaCCCCccccccccc cgcgcacccaCCCCcatccgtcc cggccccgcaCCCCcgacggccc ccgggccccaCCCCcacactccc acccttagctCCCCcacctttag gggaattcccCCCCcatcccccc tggaggagctCCCCctccaggtg tgcctgaccaCCCCctggcctca acagggacctCCCCcagccccac ctgcccgcctCCCCcacccccag ccgcacccctCCCCctgcctcac
)1278/)1301 )4147/)4170 )5401/)5424 )5579/)5602 )5648/)5671 )6175/)6198 )6476/)6499 )6988/)7011 )8054/)8077 )8690/)8713 )9331/)9354 )9834/)9857 )10690/)10713 )10961/)10984 )11730/)11753 )12411/)12433 )12871/)12894 )12914/)12936 )14072/)14094
(a)
(b)
(c)
The 5¢UTR ADORA2A was established by Yu et al. 2004. CpG sites are marked in bold, and homology with ZBP-89 consensus sequence is indicated by underlining.
Fig. 1 The percentage of DNA methylation in the 5¢UTR region of ADORA2A is increased in the cerebellum with respect to the putamen of individual control cases. (a) Striatal A2AR protein levels (45 kDa) from plasma membrane extracts were detected by western blot in the postmortem putamen and cerebellum of individual control cases. bActin (45 kDa) is blotted to control protein loading. The information for each case number is found in Table 1. The image is representative of the other three human cases. P, putamen; CB, cerebellum. (b) Scaled representation of 5¢UTR region of human ADORA2A gene established by Yu et al. (2004) who identified six isoforms of non-coding exon 1 (1A–1F). Three putative CpG islands surrounding exon 1E were predicted by MethPrimer software and are represented in the diagram as CGI#1–3 (Buira et al. 2010). The translational start site (ATG) is indicated with an arrow. The three loci analyzed were covered by PCR 1–3 which are indicated as dotted line. (c) DNA methylation percentage of three loci amplified by PCR 1–3 in the human postmortem putamen and cerebellum of control cases (n = 6). The information for every human case analyzed is found in Table 1. Graphs represent the percentage of DNA methylation (mean ± SD) of each CpG site located in every locus amplified by PCR (see Material and methods section and Table 2). The x-axis of each plot indicates the CpG site number of every PCR product. Unfortunately, some CpG sites could not be quantified by the MassARRAY platform. Moreover, some CpG sites presented the same percentage of DNA methylation because of a technical problem, in that base-specific cleavage of the in vitro transcription product was not discriminated by MALDI-TOF. àp < 0.001 compared with putamen samples (ANOVA with post-hoc Scheffe test).
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
288 | S. P. Buira et al.
(a)
(b)
Fig. 2 ZBP-89 is an activator of basal ADORA2A expression. (a) SHSY5Y cells were transfected for 48 h with a specific ZBP-89 siRNA and a random siRNA (scramble: sc) as described in Material and methods section. ZBP-89 protein levels (89 kDa) from total homogenates were analyzed with western blot, using b-actin (45 kDa) as a control of protein loading. The detection of ZBP-89 showed the typical double band around 115 kDa, previously described for this transcription factor (Merchant et al. 1996). The densitometric analysis is shown below the blots. (b) A2AR and ZBP-89 mRNA levels were measured after ZBP-89 siRNA and scramble transfection in SH-SY5Y cells
with TaqMan PCR. The endogenous control used for real time PCR was b-glucuronidase (GUSB) which was not modified after specific siRNAs transfection. DCt GUSB = Ct(GUSB in non-treated cells) – Ct(GUSB in siRNA transfected cells). Treatments were performed in triplicate (6-well plates). Each bar shows the mean ± SD of three replicates for every experimental condition, and the images are representative of three independent experiments. AU, Arbitrary Units. *p < 0.01 and **p < 0.001 compared with non-treated cells (ANOVA with post-hoc Scheffe test).
Table 4 PCRs carried out in 5¢UTR region of ADORA2A to analyze the ZBP-89 ChIP ZBP-89 binding sites analyzed
Primer forward (5¢ fi 3¢)
Primer reverse (5¢ fi 3¢)
PCR product length (bp)
#1 #2 #8.7.6 #14.13 Gastrina
GTTCCGTACCTGCTTTCTGC GGCCTTGCTAGTGCGACATA ATCAGGTGGAGAGAGGAGCA GGAGGATCAAGGCCACACT CCCTCACCATGAAGGTCAAC
TGCCTCACCTCCCTCCTC CTGCCTTCCTCCTCACCTC AGCAGAGAAAATGCCCGAAG GATGTGTCCCCAATTTCCAA ACCCTGCCATATGAGTCCAG
109 104 105 110 141
a
Shiotani and Merchant (1995).
Table 5). To find out their potential role in ADORA2A expression, several functional analyses were carried out. First of all, as the transfection of a specific YY1 siRNA in SH-SY5Y did not show an effect on A2AR mRNA levels (data not shown), we treated SH-SY5Y cells with 10 lM RA for 48 h to reduce the endogenous A2AR mRNA levels (Fig. 4b). Under these experimental conditions (the procedure is drawn in Fig. 4c), the reduction of endogenous YY1 protein levels with a specific siRNA (Fig. 4d) promoted an increase in the A2AR mRNA levels (Fig. 4e). The results obtained were specific, as the transfection of a scrambled (sc) siRNA did not modify the endogenous YY1 and A2AR levels (Fig. 4d and e). The endogenous control used in the TaqMan PCR analysis was GUSB, and it was unaltered under the experimental conditions used (Fig. 4f). In parallel, we transfected an expression vector containing the HA-YY1 cDNA (kindly provided by Dr. Shi) in RA-treated SH-SY5Y cells (Fig. 4g). The YY1 over-expression promoted a reduction of endoge-
nous A2AR mRNA levels (Fig. 4h) without modifying GUSB levels (Fig. 4i). Moreover, some dose-effect experiments were also carried out with different YY1 siRNA and pCMV/ HA-YY1 vector concentrations (Figure S1b and c). All experimental conditions confirmed that YY1 is a repressor of ADORA2A (Figure S1b and d). Finally, a ChIP assay was also performed with a rabbit YY1 antibody. As Fig. 5(a) shows, the four sets of primers covering the seven YY1 bindings sites in ADORA2A showed amplification in the YY1 immunoprecipitation, indicating that this transcription factor interacts with at least four of these loci predicted in ADORA2A (Table 6). The results obtained were specific, as the immunoprecipitation with a rabbit serum did not present any amplification with the set of primers mentioned. The same ChIP results were obtained in non-RA treated SH-SY5Y cells (data not shown). As a positive control of YY1 immunoprecipitation, a PCR product was obtained in a locus of c-fos gene, as previously reported (Natesan and Gilman 1993)
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
ZBP-89 and Yin Yang-1 control ADORA2A expression | 289
Fig. 3 ZBP-89 binds to 5¢UTR region of ADORA2A in SH-SY5Y cells. (a) Nineteen ZBP-89 binding sites predicted by MatInspector software are indicated as stars in the same diagram described in Fig. 1(b). The sequences and positions of every ZBP-89 binding site are found in Table 3. (b) Chromatin immunoprecipitation assay (ChIP) was carried out in SH-SY5Y cells with a rabbit polyclonal ZBP-89 antibody (black bars), a rabbit serum as a negative control of immunoprecipitation (IgG, white bars), and magnetic beads (gray bars) as negative control of the commercial kit used (see Material and methods section). Immunoprecipitated DNA was analyzed with PCR using a set of primers that amplified four loci covering the analysis of at least seven ZBP-89 binding sites (Table 4). The rest of the ZBP-89 binding sites
were not analyzed because of the impossibility of setting up the PCR reaction conditions. Those ZBP-89 binding sites with a positive ChIP analyses are indicated as black stars in section A. (c) A parallel PCR analysis covering gastrin gene promoter was performed as a positive control of ZBP-89 ChIP. Input refers to DNA chromatin not immunoprecipitated with the specific antibody. ChIP refers to DNA chromatin immunoprecipitated with the specific antibody. % of input represents the percentage of ChIP/Input ratio. The graph bars show the mean ± SD of nine samples from three independent ChIP assays. Dissociation curve analysis for every PCR product is shown in Figure S2. *p < 0.001 compared with IgG immunoprecipitation (ANOVA with post-hoc Scheffe test).
(Fig. 5b). All the PCR products obtained were confirmed in the analysis of their dissociation curve plots (Figure S3). In conclusion, these analyses show that YY1 acts as a repressor and that it binds to ADORA2A.
cerebellum with respect to the putamen of human brains (Fig. 6). Therefore, as occurs with DNA methylation (Fig. 1c), there is an inverse relationship between A2AR and YY1 levels in control cerebellum.
Increased YY1 levels in the cerebellum versus the putamen of human brains Based on the in vitro findings described above, we measured the protein levels of ZBP-89 and YY1 in total homogenates from the putamen and cerebellum of human postmortem brains by western blot (Table 1). No differences were found regarding ZBP-89 protein levels (data not shown), but increased YY1 expression levels were observed in the
Discussion In CNS, the caudate putamen is the most A2ARs-enriched cerebral region (Meng et al. 1994; Peterfreund et al. 1996; Rosin et al. 1998; Yu et al. 2004). We have corroborated these findings by comparing A2ARs levels between the putamen and the cerebellum of six human postmortem brains using western blot. Then we were interested in elucidating
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
290 | S. P. Buira et al.
(a)
(b) (c)
(d)
(g)
(e)
(h)
(f)
(i)
the molecular mechanisms underlying the cerebral regionspecific A2ARs expression levels. DNA methylation is associated with gene repression (Illingworth and Bird 2009) and it is present in human brain (Siegmund et al. 2007). Neuronal alterations of this epigenetic marker have just begun to be described in human neurodegenerative diseases (Urdinguio et al. 2009). We recently demonstrated that DNA methylation regulates the expression of basal A2AR gene (ADORA2A) in human cell lines (Buira et al. 2010). In the present report, we confirm these in vitro findings in human postmortem brain, as an inverse relation-
ship between DNA methylation percentage in ADORA2A and A2ARs levels in the cerebellum versus the putamen of control brains is evidenced with PCR2–3. In this line, it has been reported that tissue-specific DNA methylation in CpG islands (CGIs) is associated with tissue-specific gene repression (Song et al. 2005). As an exception, a certain loss of DNA methylation of ADORA2A is detected with PCR1 in the cerebellum versus putamen. We postulate that this may justify the residual basal A2ARs levels found in the cerebellum. Moreover, the differential DNA methylation analysis of these loci is in agreement with the characterized
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
ZBP-89 and Yin Yang-1 control ADORA2A expression | 291
Fig. 4 YY1 represses basal ADORA2A expression in retinoic acidtreated SH-SY5Y cells. (a) Seven YY1 binding sites predicted by MatInspector software are indicated as squares in the same diagram described in Fig. 1(b). The sequences and positions of every YY1 binding site are found in Table 5. (b) SH-SY5Y cells were treated with 10 lM retinoic acid (RA) for 48 h. Then RNA was extracted and A2AR mRNA levels were measured with TaqMan PCR. RA reduces the endogenous A2AR mRNA levels. DMSO was the vehicle used to dissolve RA. (c) The panel summarizes the procedure employed in this set of experiments. DiV, days in vitro. (d) RAtreated SH-SY5Y cells were transfected with a specific YY1 siRNA and a random siRNA (scramble: sc) as described in Material and methods section. YY1 protein levels were analyzed with western blot, using b-actin (45 kDa) as a control of protein loading. Although YY1 presents a predicted molecular weight of 44 kDa, it migrates on SDS gels as a 65 kDa protein (Shi et al. 1997). The densitometric analysis is shown below the blots. (e) A2AR and YY1 mRNA levels were measured after YY1 siRNA and scramble transfection in
Table 5 Information about the seven YY1 binding sites predicted in 5¢UTR region of ADORA2A
RA-treated SH-SY5Y cells with TaqMan PCR. (f) The endogenous control used for real time PCR was b-glucuronidase (GUSB) which was not modified after specific siRNA transfection. DCt GUSB = Ct(GUSB in non-treated cells) – Ct(GUSB in siRNA transfected cells). (g) RAtreated SH-SY5Y cells were transfected with the pCMV/HA-YY1 vector as described in Material and methods section. YY1 protein levels were analyzed by western blot from total homogenates, using b-actin (45 kDa) as a control of protein loading. The densitometric analysis is shown below the blots. The YY1 over-expressed presented additional 12 kDa which corresponded to HA tag incorporated in the expression vector. (h) A2AR mRNA levels were measured after YY1 over-expression in RA-treated SH-SY5Y cells by TaqMan PCR. (i) The endogenous control used for real time PCR was b-glucuronidase (GUSB) which was not modified after YY1 over-expression. DCt GUSB = Ct(GUSB in non-treated cells) – Ct(GUSB in YY1 over-expressed cells). *p < 0.05, **p < 0.01 and ***p < 0.001 compared with non-treated cells (ANOVA with post-hoc Scheffe test).
YY1 binding site number (#)
YY1 binding site sequence (5¢ fi 3¢) Consensus: (C/g/a)(G/t)(C/t/a)CATN(T/a)(T/g/c)
Genomic localization respect to ATG
#1 #2 #3 #4 #5 #6 #7
ctgaaCCATctgcagaggg aggggCCATcctcaggctg gggagCCATtttaaatctg ccctgCCATatgctcagat gcccgCCATctgagggagg cggggCCATctagaaacac tccatCCATcttctgtctg
)318/–337 )448/–429 )1550/–1531 )4588/–4569 )5921/–5902 )5975/–5956 )7069/–7088
The 5¢UTR ADORA2A was established by Yu et al. (2004). CpG sites are marked in bold, and homology with YY1 consensus sequence is indicated by underlining.
Fig. 5 YY1 binds to 5¢UTR region of ADORA2A in retinoic acidtreated SH-SY5Y cells. (a) Chromatin immunoprecipitation assay (ChIP) was carried out in retinoic acid-treated SH-SY5Y cells with a rabbit polyclonal YY1 antibody (black bars) and a rabbit serum as a negative control (IgG, white bars), as described in Material and methods section. Immunoprecipitated DNA was analyzed with PCR using a set of primers that amplified four loci covering the analysis of seven predicted YY1 binding sites (see Fig. 4a). The sequence and position of oligos used in the ChIP analysis are shown in
Table 6. (b) A parallel PCR analysis covering c-fos gene promoter was performed as positive control of YY1 ChIP. Input refers to DNA chromatin not immunoprecipitated with the specific antibody. ChIP refers to DNA chromatin immunoprecipitated with the specific antibody. % of input represents the percentage of ChIP/Input ratio. The graph bars show the mean ± SD of nine samples from three independent ChIP assays. Dissociation curve analysis for every PCR product is shown in Figure S3. *p < 0.001 compared with IgG immunoprecipitation.
DNA methylation signatures for every cerebral region (LaddAcosta et al. 2007). Interestingly, the above-mentioned study showed a clear differential DNA methylation signature for
the cerebellum with respect to the other areas of the brain. Our study also confirms that DNA methylation pattern for each amplified locus is very homogeneous throughout
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
292 | S. P. Buira et al.
Table 6 PCRs carried out in 5¢UTR region of ADORA2A to analyze the YY1 ChIP YY1 binding sites analyzed
Primer forward (5¢ fi 3¢)
Primer reverse (5¢ fi 3¢)
PCR product length (bp)
#1.2 #3 #4 #5.6.7
TGGCTATGACCACAGCAGAC GTTCCGTACCTGCTTTCTGC GGCCTTGCTAGTGCGACATA ATCAGGTGGAGAGAGGAGCA
TTTCAGATCCCACCCTACCC TGCCTCACCTCCCTCCTC CTGCCTTCCTCCTCACCTC AGCAGAGAAAATGCCCGAAG
100 109 104 105
c-fos oligos were provided by the Magnetic LowCell ChIP kit (Diagenode).
individuals, as described (Barrachina and Ferrer 2009; Byun et al. 2009). Apart from this, it is established that CGIs are usually unmethylated in normal cells (Weber et al. 2007). Therefore, the predicted CGI#3 can be considered as a nonCGI, as it is highly methylated in both cerebral regions analyzed with PCR3. Regarding putamen samples, the low percentage of DNA methylation in CGI#1 and CGI#2
(a)
(b)
Fig. 6 YY1 expression levels are higher in the cerebellum with respect to the putamen in control brains. (a) YY1 protein levels in individual postmortem control brains were detected by western blot. bActin was blotted to control protein loading. The information for each case number is found in Table 1. P: putamen, CB: cerebellum. (b) Densitometric analysis for YY1 normalized with b-actin (Mean ± SEM). AU, Arbitrary Units. *p < 0.05 compared with putamen samples (ANOVA with post-hoc Scheffe test).
(PCR1–2) shows the possibility of drug intervention to reduce high A2AR levels detected in Parkinson’s disease (PD) (Calon et al. 2004; Varani et al. 2010). In fact, A2AR levels were reduced after S-adenosylmethionine treatment in SH-SY5Y and U87-MG cells (Buira et al. 2010). Pharmacological modulation of A2ARs seems to be a promising tool for PD and schizophrenia, because of their property of antagonizing dopamine D2 receptor activity (Schwarzschild et al. 2006; Pinna 2009). Interestingly, the use of epigenetic drugs has been proposed for the treatment of Alzheimer’s disease (AD) and PD (Scarpa et al. 2003, 2006; Obeid et al. 2009). Moreover, therapeutic uses of A2ARs modulation are not restricted to PD, as blockade of these receptors has been shown to be beneficial in animal models of epilepsy, ischemia, Huntington’s disease and AD (Jones et al. 1998; Chen et al. 1999; Popoli et al. 2002; Dall’Igna et al. 2007; Cunha et al. 2008; Canas et al. 2009). After DNA methylation analysis, we proceeded to look for transcription factors related to ADORA2A expression, as only a few have been associated with ADORA2A regulation (St. Hilaire et al. 2009). In the present report, an in silico analysis revealed nineteen and seven binding sites for the transcription factors ZBP-89 and YY1, respectively, in the 5¢UTR region of ADORA2A. ZBP-89 (also known as BFCOL-1, BERF-1 and ZNF-148) is a Kruppel-type zinc-finger transcription factor that was first characterized as a repressor of gastrin gene (Merchant et al. 1996). Its expression is ubiquitous and it binds to a Guanine and cytosine-rich element. It acts as a repressor (Law et al. 1998; Wieczorek et al. 2000; Keates et al. 2001) or as an activator (Ye et al. 1999; Yamada et al. 2001; Bai and Merchant 2003; Malo et al. 2006), depending on the gene promoter. Furthermore, several studies have revealed that ZBP-89 possesses multiple functions. It mediates cell growth arrest through the activation of p21(Waf1) (Hasegawa et al. 1999). Over-expression of ZBP-89 leads to cell cycle arrest and apoptosis, both in cell culture (Bai and Merchant 2001) and in intestinal tissues, upon targeted transgenic expression (Law et al. 2006). These findings may explain the low viability of SH-SY5Y after ZBP-89 over-expression and the consequent technical impossibility of analyzing its role in ADORA2A expression. Interestingly, the use of a specific siRNA revealed its role as a gene activator. However, no changes in ZBP-89 levels were found between the putamen and cerebellum samples.
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
ZBP-89 and Yin Yang-1 control ADORA2A expression | 293
Regarding this, it has been described how ZBP-89 can be phosphorylated by ataxia-telangiectasia mutated (ATM) kinase at Ser202, potentiating p21(Waf1) induction (Bai and Merchant 2007), and how sumoylation provides a reversible post-translational mechanism to control its activity (Chupreta et al. 2007). Thus, it cannot be ruled out that ZBP89 presents a higher degree of phosphorylation or an altered sumoylation pattern in the putamen, but to our knowledge no commercial antibodies for phosphorylated or sumoylated ZBP-89 are available to test these hypotheses. It is also noteworthy that PCR1 and PCR2 performed in the DNA methylation analysis presented ZBP-89 binding sites with CpG units (Tables 2 and 3). In particular, ZBP-89#10 showed a higher percentage of DNA methylation in the cerebellum versus the putamen of human brains, which might affect the binding of ZBP-89. However, there is an absence of CpG units in other ZBP-89 binding sites (Table 3). Therefore, its role as an activator of ADORA2A may contribute to the residual basal A2AR levels in the cerebellum through its interaction with these particular binding sites. Regarding YY1, it is a ubiquitous and multifunctional zinc-finger transcription factor which acts as an initiator, a repressor, or an activator (Shi et al. 1997). Several brain genes have been reported to be regulated by YY1 (He and Casaccia-Bonnefil 2008). Its functionality has been related with basic cellular processes, such as cell-cycle control, differentiation, development and apoptosis (Affar el et al. 2006). In the present report, we show increased YY1 levels in the cerebellum when compared with the putamen of control brains, presenting an inverse relationship with A2ARs levels in these two brain regions. Higher YY1 levels in the cerebellum with respect to other cerebral regions have been also described in the rat brain (Rylski et al. 2008). Our in vitro analysis revealed that YY1 is a repressor of ADORA2A expression. Three types of YY1 mechanisms of action have been described, including direct activation or repression, indirect activation or repression via cofactor recruitment, and activation or repression by disruption of binding sites or conformational DNA changes (Gordon et al. 2006). Further analyses are needed to elucidate the mechanism of action of YY1 in relation to brain-specific region ADORA2A expression. For instance, it needs to be examined whether it forms a repression complex with histone deacetylase (HDAC)1/2 (Thomas and Seto 1999), or whether it interacts with cAMPresponse element binding protein, interfering with its positive role above cerebellar ADORA2A expression (Zhou et al. 1995; Chiang et al. 2005). Interestingly, the formation of YY1/ZBP-89 complex, reducing the ability of ZBP-89 to activate gene expression, has been described (Boopathi et al. 2004). It is also plausible that synergism between the increased DNA methylation profile of ADORA2A and increased YY1 levels results in relatively low A2AR levels in the cerebellum in control brains. Furthermore, most YY1
binding sites do not present CpG units, ruling out DNA methylation interference for YY1 binding to ADORA2A. Recently, a correlation between an absence of DNA methylation and YY1 DNA binding has been described in normal blood cells (Gebhard et al. 2010). In conclusion, this study provides new insights into the control of basal ADORA2A expression, describing two new transcription factors related with its expression, with antagonistic roles. Moreover, we confirm our recent findings regarding the role of DNA methylation (Buira et al. 2010) on A2AR levels in the human brain. Taken together, these represent new data for further investigation to elucidate aberrant A2AR expression in neurological diseases such as AD, PD and schizophrenia.
Acknowledgements There is no conflict of interest including any financial, personal or other relationships with other people or organizations. We are grateful to Dr. Hammerschmidt for ZBP-89 vector, Dr. Shi for pCMV/HA-YY1 vector and Dr. Martı´n-Satue´ for helpful revision of the manuscript. We thank T. Yohannan for editorial help. This study was funded by grants from the Ministerio de Ciencia e Innovacio´n, Instituto de Salud Carlos III (PI05/1631 and CP08/00095) to M.B., and from the European Union through the Marie-Curie Research Training Network PRAIRIES (Contract MRTN-CT-2006-035810), the Consejerı´a de Educacio´n y Ciencia (PCI08-0125), the Consejerı´a de Sanidad-FISCAM (PI-2007/50 and G-2007-C/13) of the Junta de Comunidades de Castilla-La Mancha and the Ministerio de Ciencia e Innovacio´n (BFU2008-00138) to M.M. M.B. and M.M. are recipients of a grant from the Fundacio´ La Marato´ de TV3 (092330). S.P.B received a grant from the University of Barcelona to complete her doctoral thesis.
Supporting information Additional supporting Information may be found in the online version of this article: Figure S1. (a) SH-SY5Y cells were transfected with different concentrations of a specific ZBP-89 siRNA as described in Material and methods section. (b) A2AR and YY1 mRNA levels were measured after transfection of different concentrations of a specific YY1 siRNA in RA-treated SH-SY5Y cells with TaqMan PCR. (c) RA-treated SH-SY5Y cells were transfected with different quantities of the pCMV/HA-YY1 vector as described in Material and methods section, and (d) a reduction of A2AR mRNA levels was detected after YY1 over-expression by TaqMan PCR, without finding a doseeffect response. Figure S2. Dissociation curve analysis for every PCR performed in the analysis of ZBP-89 ChIP and shown in Fig. 3. Figure S3. Dissociation curve analysis for every PCR performed in the analysis of YY1 ChIP and shown in Fig. 5. As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
294 | S. P. Buira et al.
supporting information (other than missing files) should be addressed to the authors.
References Affar el B., Gay F., Shi Y., Liu H., Huarte M., Wu S., Collins T., Li E. and Shi Y. (2006) Essential dosage-dependent functions of the transcription factor yin yang 1 in late embryonic development and cell cycle progression. Mol. Cell. Biol. 26, 3565–3581. Albasanz J. L., Rodrı´guez A., Ferrer I. and Martı´n M. (2007) Up-regulation of adenosine A1 receptors in frontal cortex from Pick’s disease cases. Eur. J. Neurosci. 26, 3501–3508. Albasanz J. L., Perez S., Barrachina M., Ferrer I. and Martı´n M. (2008) Up-regulation of adenosine receptors in the frontal cortex in Alzheimer’s disease. Brain Pathol. 18, 211–219. Angulo E., Casado´ V., Mallol J., Canela E. I., Vin˜als F., Ferrer I., Lluis C. and Franco R. (2003) A1 adenosine receptors accumulate in neurodegenerative structures in Alzheimer disease and mediate both amyloid precursor protein processing and tau phosphorylation and translocation. Brain Pathol. 13, 440–451. Bai L. and Merchant J. L. (2001) ZBP-89 promotes growth arrest through stabilization of p53. Mol. Cell. Biol. 21, 4670–4683. Bai L. and Merchant J. L. (2003) Transcription factor ZBP-89 is required for STAT1 constitutive expression. Nucleic Acids Res. 31, 7264– 7270. Bai L. and Merchant J. L. (2007) ATM phosphorylates ZBP-89 at Ser202 to potentiate p21waf1 induction by butyrate. Biochem. Biophys. Res. Commun. 359, 817–821. Bai L., Yoon S. O., King P. D. and Merchant J. L. (2004) ZBP-89induced apoptosis is p53-independent and requires JNK. Cell Death Differ. 11, 663–673. Barrachina M. and Ferrer I. (2009) DNA methylation of Alzheimer disease and tauopathy-related genes in post-mortem brain. J. Neuropathol. Exp. Neurol. 68, 880–891. Boopathi E., Lenka N., Prabu S. K., Fang J. K., Wilkinson F., Atchison M., Giallongo A. and Avadhani N. G. (2004) Regulation of murine cytochrome c oxidase Vb gene expression during myogenesis: YY1 and heterogeneous nuclear ribonucleoprotein D-like protein (JKTBP1) reciprocally regulate transcription activity by physical interaction with the BERF-1/ZBP-89 factor. J. Biol. Chem. 279, 35242–35254. Buira S. P., Albasanz J. L., Dentesano G., Moreno J., Martı´n M., Ferrer I. and Barrachina M. (2010) DNA methylation regulates adenosine A2A receptor cell surface expression levels. J. Neurochem. 112, 1273–1285. Byun H. M., Siegmund K. D., Pan F., Weisenberger D. J., Kanel G., Laird P. W. and Yang A. S. (2009) Epigenetic profiling of somatic tissues from human autopsy specimens identifies tissue- and individual-specific DNA methylation patterns. Hum. Mol. Genet. 18, 4808–4817. Calon F., Dridi M., Hornykiewicz O., Be´dard P. J., Rajput A. H. and Di Paolo T. (2004) Increased adenosine A2A receptors in the brain of Parkinson’s disease patients with dyskinesias. Brain 127, 1075– 1084. Canas P. M., Porciu´ncula L. O., Cunha G. M., Silva C. G., Machado N. J., Oliveira J. M., Oliveira C. R. and Cunha R. A. (2009) Adenosine A2A receptor blockade prevents synaptotoxicity and memory dysfunction caused by beta-amyloid peptides via p38 mitogenactivated protein kinase pathway. J. Neurosci. 29, 14741–14751. Cartharius K., Frech K., Grote K., Klocke B., Haltmeier M., Klingenhoff A., Frisch M., Bayerlein M. and Werner T. (2005) MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21, 2933–2942.
Chen J. F., Huang Z., Ma J., Zhu J., Moratalla R., Standaert D., Moskowitz M. A., Fink J. S. and Schwarzschild M. A. (1999) A(2A) adenosine receptor deficiency attenuates brain injury induced by transient focal ischemia in mice. J. Neurosci. 19, 9192–9200. Chiang M. C., Lee Y. C., Huang C. L. and Chern Y. (2005) cAMPresponse element-binding protein contributes to suppression of the A2A adenosine receptor promoter by mutant Huntingtin with expanded polyglutamine residues. J. Biol. Chem. 280, 14331– 14340. Chupreta S., Brevig H., Bai L., Merchant J. L. and In˜iguez-Lluhı´ J. A. (2007) Sumoylation-dependent control of homotypic and heterotypic synergy by the Kruppel-type zinc finger protein ZBP-89. J. Biol. Chem. 282, 36155–36166. Cunha R. A. (2005) Neuroprotection by adenosine in the brain: from A(1) receptor activation to A (2A) receptor blockade. Purinergic Signal. 1, 111–134. Cunha G. M., Canas P. M., Melo C. S., Hockemeyer J., Mu¨ller C. E., Oliveira C. R. and Cunha R. A. (2008) Adenosine A2A receptor blockade prevents memory dysfunction caused by beta-amyloid peptides but not by scopolamine or MK-801. Exp. Neurol. 210, 776–781. Dall’Igna O. P., Fett P., Gomes M. W., Souza D. O., Cunha R. A. and Lara D. R. (2007) Caffeine and adenosine A(2a) receptor antagonists prevent beta-amyloid (25-35)-induced cognitive deficits in mice. Exp. Neurol. 203, 241–245. Ehrich M., Nelson M. R., Stanssens P., Zabeau M., Liloglou T., Xinarianos G., Cantor C. R., Field J. K. and van den Boom D. (2005) Quantitative high-throughput analysis of DNA methylation patterns by base-specific cleavage and mass spectrometry. Proc. Natl Acad. Sci. USA 102, 15785–15790. Fredholm B. B., IJzerman A. P., Jacobson K. A., Klotz K. N. and Linden J. (2001) International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol. Rev. 53, 527–552. Gebhard C., Benner C., Ehrich M. et al. (2010) General transcription factor binding at CpG islands in normal cells correlates with resistance to de novo DNA methylation in cancer cells. Cancer Res. 70, 1398–1407. Gordon S., Akopyan G., Garban H. and Bonavida B. (2006) Transcription factor YY1: structure, function, and therapeutic implications in cancer biology. Oncogene 25, 1125–1142. Hasegawa T., Xiao H. and Isobe K. (1999) Cloning of a GADD34-like gene that interacts with the zinc-finger transcription factor which binds to the p21(WAF) promoter. Biochem. Biophys. Res. Commun. 256, 249–254. He Y. and Casaccia-Bonnefil P. (2008) The Yin and Yang of YY1 in the nervous system. J. Neurochem. 106, 1493–1502. Illingworth R. S. and Bird A. P. (2009) CpG islands – ‘‘A rough guide’’. FEBS Let. 583, 1713–1720. Jones P. A., Smith R. A. and Stone T. W. (1998) Protection against hippocampal kainate excitotoxicity by intracerebral administration of an adenosine A2A receptor antagonist. Brain Res. 800, 328–335. Keates A. C., Keates S., Kwon J. H., Arseneau K. O., Law D. J., Bai L., Merchant J. L., Wang T. C. and Kelly C. P. (2001) ZBP-89, Sp1, and nuclear factor-kappa B regulate epithelial neutrophil-activating peptide-78 gene expression in Caco-2 human colonic epithelial cells. J. Biol. Chem. 276, 43713–43722. Ladd-Acosta C., Pevsner J., Sabunciyan S. et al. (2007) DNA methylation signatures within the human brain. Am. J. Hum. Genet. 81, 1304–1315. Law G. L., Itoh H., Law D. J., Mize G. J., Merchant J. L. and Morris D. R. (1998) Transcription factor ZBP-89 regulates the activity of the ornithine decarboxylase promoter. J. Biol. Chem. 273, 19955– 19964.
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
ZBP-89 and Yin Yang-1 control ADORA2A expression | 295
Law D. J., Labut E. M. and Merchant J. L. (2006) Intestinal overexpression of ZNF148 suppresses ApcMin/+ neoplasia. Mamm. Genome 17, 999–1004. Le F., Townsend-Nicholson A., Baker E., Sutherland G. R. and Schofield P. R. (1996) Characterization and chromosomal localization of the human A2a adenosine receptor gene: ADORA2A. Biochem. Biophys. Res. Commun. 223, 461–467. MacCollin M., Peterfreund R., MacDonald M., Fink J. S. and Gusella J. (1994) Mapping of a human A2a adenosine receptor (ADORA2A) to chromosome 22. Genomics 20, 332–333. Malo M. S., Mozumder M., Zhang X. B., Biswas S., Chen A., Bai L. C., Merchant J. L. and Hodin R. A. (2006) Intestinal alkaline phosphatase gene expression is activated by ZBP-89. Am. J. Physiol. Gastrointest. Liver Physiol. 290, 737–746. Meng F., Xie G. X., Chalmers D., Morgan C., Watson Jr S. J. and Akil H. (1994) Cloning and expression of the A2a adenosine receptor from guinea pig brain. Neurochem. Res. 19, 613–621. Merchant J. L., Iyer G. R., Taylor B. R., Kitchen J. R., Mortensen E. R., Wang Z., Flintoft R. J., Michel J. B. and Bassel-Duby R. (1996) ZBP-89, a Kru¨ppel-like zinc finger protein, inhibits epidermal growth factor induction of the gastrin promoter. Mol. Cell. Biol. 16, 6644–6653. Natesan S. and Gilman M. Z. (1993) DNA bending and orientationdependent function of YY1 in the c-fos promoter. Genes Dev. 7, 2497–2509. Obeid R., Schadt A., Dillmann U., Kostopoulos P., Fassbender K. and Herrmann W. (2009) Methylation status and neurodegenerative markers in Parkinson disease. Clin. Chem. 55, 1852–1860. Perez-Buira S., Barrachina M., Rodriguez A., Albasanz J. L., Martı´n M. and Ferrer I. (2007) Expression levels of adenosine receptors in hippocampus and frontal cortex in argyrophilic grain disease. Neurosci. Lett. 423, 194–199. Peterfreund R. A., MacCollin M., Gusella J. and Fink J. S. (1996) Characterization and expression of the human A2a adenosine receptor gene. J. Neurochem. 66, 362–368. Pinna A. (2009) Novel investigational adenosine A2A receptor antagonists for Parkinson’s disease. Expert Opin. Investig. Drugs 18, 1619–1631. Popoli P., Pintor A., Domenici M. R. et al. (2002) Blockade of striatal adenosine A2A receptor reduces, through a presynaptic mechanism, quinolinic acid-induced excitotoxicity: possible relevance to neuroprotective interventions in neurodegenerative diseases of the striatum. J. Neurosci. 22, 1967–1975. Rodrı´guez A., Martı´n M., Albasanz J. L., Barrachina M., Espinosa J. C., Torres J. M. and Ferrer I. (2006) Adenosine A1 receptor protein levels and activity is increased in the cerebral cortex in CreutzfeldtJakob disease and in bovine spongiform encephalopathy-infected bovine-PrP mice. J. Neuropathol. Exp. Neurol. 65, 964–975. Rosin D. L., Robeva A., Woodard R. L., Guyenet P. G. and Linden J. (1998) Immunohistochemical localization of adenosine A2A receptors in the rat central nervous system. J. Comp. Neurol. 401, 163–186. Rylski M., Amborska R., Zybura K., Konopacki F. A., Wilczynski G. M. and Kaczmarek L. (2008) Yin Yang 1 expression in the adult rodent brain. Neurochem. Res. 33, 2556–2564. Scarpa S., Fuso A., D’Anselmi F. and Cavallaro R. A. (2003) Presenilin 1 gene silencing by S-adenosylmethionine: a treatment for Alzheimer disease? FEBS Lett. 541, 145–148.
Scarpa S., Cavallaro R. A., D’Anselmi F. and Fuso A. (2006) Gene silencing through methylation: an epigenetic intervention on Alzheimer disease. J. Alzheimers Dis. 9, 407–414. Schwarzschild M. A., Agnati L., Fuxe K., Chen J. F. and Morelli M. (2006) Targeting adenosine A2A receptors in Parkinson’s disease. Trends Neurosci. 29, 647–654. Shi Y., Lee J. S. and Galvin K. M. (1997) Everything you have ever wanted to know about Yin Yang 1. Biochim. Biophys. Acta 1332, F49–F66. Shiotani A. and Merchant J. L. (1995) cAMP regulates gastrin gene expression. Am. J. Physiol. 269, G458–G464. Siegmund K. D., Connor C. M., Campan M., Long T. I., Weisenberger D. J., Biniszkiewicz D., Jaenisch R., Laird P. W. and Akbarian S. (2007) DNA methylation in the human cerebral cortex is dynamically regulated throughout the life span and involves differentiated neurons. PLoS ONE 2, e895. Song F., Smith J. F., Kimura M. T., Morrow A. D., Matsuyama T., Nagase H. and Held W. A. (2005) Association of tissue-specific differentially methylated regions (TDMs) with differential gene expression. Proc. Natl Acad. Sci. USA 102, 3336–3341. St. Hilaire C., Carroll S. H., Chen H. and Ravid K. (2009) Mechanisms of induction of adenosine receptor genes and its functional significance. J. Cell. Physiol. 218, 35–44. Stone T. W., Ceruti S. and Abbracchio M. P. (2009) Adenosine receptors and neurological disease: neuroprotection and neurodegeneration. Handb. Exp. Pharmacol. 193, 535–587. Thomas M. J. and Seto E. (1999) Unlocking the mechanisms of transcription factor YY1: are chromatin modifying enzymes the key? Gene 236, 197–208. Urdinguio R. G., Sanchez-Mut J. V. and Esteller M. (2009) Epigenetic mechanisms in neurological diseases: genes, syndromes, and therapies. Lancet Neurol. 8, 1056–1072. Varani K., Vincenzi F., Tosi A. et al. (2010) A2A adenosine receptor overexpression and functionality, as well as TNF-{alpha} levels, correlate with motor symptoms in Parkinson’s disease. FASEB J. 24, 587–598. Weber M., Hellmann I., Stadler M. B., Ramos L., Pa¨a¨bo S., Rebhan M. and Schu¨beler D. (2007) Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat. Genet. 39, 457–466. Wieczorek E., Lin Z., Perkins E. B., Law D. J., Merchant J. L. and Zehner Z. E. (2000) The zinc finger repressor, ZBP-89, binds to the silencer element of the human vimentin gene and complexes with the transcriptional activator, Sp1. J. Biol. Chem. 275, 12879– 12888. Yamada A., Takaki S., Hayashi F., Georgopoulos K., Perlmutter R. M. and Takatsu K. (2001) Identification and characterization of a transcriptional regulator for the lck proximal promoter. J. Biol. Chem. 276, 18082–18089. Ye S., Whatling C., Watkins H. and Henney A. (1999) Human stromelysin gene promoter activity is modulated by transcription factor ZBP-89. FEBS Lett. 450, 268–272. Yu L., Frith M. C., Suzuki Y. et al. (2004) Characterization of genomic organization of the adenosine A2A receptor gene by molecular and bioinformatics analyses. Brain Res. 1000, 156–173. Zhou Q., Gedrich R. W. and Engel D. A. (1995) Transcriptional repression of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB. J. Virol. 69, 4323–4330.
2010 The Authors Journal Compilation 2010 International Society for Neurochemistry, J. Neurochem. (2010) 115, 283–295
