Conservation and developmental control of alternative splicing in maebl among malaria parasites

ARTICLE IN PRESS doi:10.1016/j.jmb.2004.08.047

J. Mol. Biol. (2004) xx, 1–11

Conservation and Developmental Control of Alternative Splicing in maebl Among Malaria Parasites Naresh Singh1, Peter Preiser2†, Laurent Re´nia3†, Bharath Balu1 John Barnwell4, Peter Blair1, William Jarra2, Tatiana Voza5, Ire`ne Landau5 and John H. Adams1* 1

Department of Biological Sciences, University of Notre Dame, 220 Galvin, PO Box 369 Notre Dame, IN 46556, USA 2 Division of Parasitology National Institute for Medical Research, The Ridgeway, Mill Hill NW7 1AA, UK 3

De´partement d’Immunologie Institut Cochin, INSERM U567 CNRS 8104, Universite´ Rene´ Descartes, Hoˆpital Cochin Baˆtiment Gustave Roussy 75014 Paris, France 4

Division of Parasitic Diseases National Center for Infectious Diseases, Centers for Disease Control & Prevention, Mailstop F-13, Bldg. 22B, 4770 Buford Highway, NE, Chamblee, GA 30341, USA

Genes of malaria parasites and other unicellular organisms have larger exons with fewer and smaller introns than metaozoans. Such differences in gene structure are perceived to extend to simpler mechanisms for transcriptional control and mRNA processing. Instead, we discovered a surprisingly complex level of post-transcriptional mRNA processing in analysis of maebl transcripts in several Plasmodium species. Mechanisms for internal alternative cis-splicing and exon skipping were active in multiple life cycle stages to change exon structure in the deduced coding sequence (CDS). The major alternatively spliced transcript utilized a less favorable acceptor splice site, which shifted codon triplet usage to a different CDS with a hydrophilic C terminus, changing the canonical type I membrane MAEBL product to a predicted soluble isoform. We found that developmental control of the alternative splicing pattern was distinct from the canonical splicing pattern. Western blot analysis indicated that MAEBL expression was better correlated with the appearance of the canonical ORF1 transcript. Together these data reveal that RNA metabolism in unicellular eukaryotes like Plasmodium is more sophisticated than believed and may have a significant role regulating gene expression in Plasmodium. q 2004 Elsevier Ltd. All rights reserved.

5 Museum National d’Histoire Naturelle, F-75231 Paris France

*Corresponding author

Keywords: malaria; Plasmodium; alternative splicing; MAEBL; ligand

Introduction † P.P. and L.R. contributed equally to this work. Present addresses: P. Preiser, Nanyang Technological University, School of Biological Sciences, 60 Nanyang Drive, Singapore 637551; P. Blair, Department of Biology, Earlham College, 801 National Road West, Richmond, IN 47374, USA. Abbreviations used: AMA-1, apical membrane antigen1; DBP, Duffy antigen binding protein; DBL, duffy binding-like; EBA-175, erythrocyte binding antigen-175; ebl, erythrocyte binding-like; EBP, erythrocyte binding protein; IFA, indirect immunofluorescence assay; ORF, open reading frame. E-mail address of the corresponding author: [email protected]

Malaria is one of the most serious human diseases causing several million deaths and clinical illness in hundreds of millions of people every year. The biological complexity of these pathogenic protozoans is extraordinary in the intricate life cycles, as the malaria parasite must develop in two very different host organisms, infecting different cell types, and its motile stages must often traverse different tissues before infecting a new cell.1 Nevertheless, the Plasmodium genome is estimated to have less than 6000 genes and the number of unique genes is still less since a considerable part of the Plasmodium genome is occupied by multi-gene families (e.g. var, rif, stevor).2,3 Compared to the

0022-2836/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.

ARTICLE IN PRESS 2 simple unicellular yeast, which is predicted to have O6000 genes, the estimated size of the Plasmodium genome does not seem to adequately reflect the remarkable biological complexity in a malaria parasite’s life cycle. Developmental processes of malaria parasites are tightly coordinated with gene expression in a “just in time” strategy so that transcript abundance patterns closely mirror the time in the life cycle where products are needed.4–6 Gene expression in eukaryotes occurs at several levels, including initiation of transcription, elongation, mRNA processing, RNA stability, translation, and posttranslation processing. Profiling of global gene expression patterns of Plasmodium falciparum revealed that the temporal control is fairly rigid.5–7. Recent evidence indicates that chromatin assembly or remodeling operates as an important mechanism to control transcription in malaria parasites.8 Cis-acting regulatory motifs are present in the flanking non-coding regions adjacent to gene coding sequences, although these structures are poorly defined in Plasmodium.9–11 However, the ability to identify such characteristic cis elements as the TATA box is hindered by the strong AT bias in the P. falciparum genome. Still core trans elements of the transcription machinery, such as TATA-binding protein, are clearly present in Plasmodium genome. In the post-transcriptional phase of gene expression, splicing of precursor mRNA is controlled in the splicesome by a series of small nuclear ribonucleoproteins (snRNP) to remove introns and bring together exon sequences in a very precise manner. Similar to most other eukaryotes, exon boundaries of Plasmodium are demarcated by consensus donor and acceptor splicing junctions, GU and AG, respectively.12 The acceptor is often preceded by a poly-pyrimidine tract, although this can be veiled somewhat because introns generally have elevated AT nucleotide composition relative to the coding sequence. To date, alternative splicing has been discovered for only a few Plasmodium genes and the complexity of alternative splicing is relatively limited.13–17 Alternative splicing is important in metazoans as a mechanism to create different isoform products from the same gene, which is often developmentally coordinated and occurs in a tissue-specific manner. 18–21 More recently appreciated is the role of alternative splicing as a gene regulatory mechanism targeting mRNA for degradation.22,23 Splicing occurs in the nucleus and the processed mRNA is stabilized then exported to the cytoplasm in order to be translated. Modulation of mRNA stability can control gene expression levels and Plasmodium has such a mechanism in place as indicated by the extremely delayed translation of Pbs21, which occurs only in the zygote and ookinete stages even though the message is made much earlier in the gametocyte stage.24 A mechanism to rapidly decay nonsense mRNA appears to be more poorly developed, since transcripts of pseudogenes are present at easily detectable levels and their abundance is controlled

RNA Processing in Malaria Parasites

in developmental patterns similar to homologous or adjacent genes.7,25,26 Plasmodium motile stages are highly specialized for infecting the next host cell and to do so utilize an apical complex of organelles.27 Proteins destined for inclusion in the apical organelles are expressed only during the final stages of intracellular development and represent a cohort of genes whose expression is tightly regulated.5,6,28,29 Despite great differences in cell types invaded by the different Plasmodium motile stages, the basic mechanisms of invasion appear similar in the different stages and species.30 The ebl family of erythrocyte-binding proteins includes some of the best characterized malarial ligands, such as the Plasmodium vivax Duffy binding protein (DBP) and P. falciparum Erythrocyte Binding Antigen-175 (EBA-175).31 Exon structure, including the conserved position of splicing junctions within codons at the exon boundaries, is an important characteristic of ebl genes.32 maebl is a paralogue of the ebl family, similar except that its two extracellular ligand domains have identity to AMA1 and not the consensus DBL ligand domains of other ebl products.33 maebl evolved independently prior to speciation along with the ebl and ama1 in the ancestral Plasmodium genome.34 Similar to the consensus ebl products, MAEBL was identified in Plasmodium yoelii and P. falciparum blood-stage parasites as a minor type I transmembrane protein with erythrocyte binding activity.33,35,36 Conventional views considered that this type of molecule evolved to have a stage-specific function in the biology of malaria parasites. Indeed, proteomic analysis confirmed that very few proteins are expressed in all stages and determined that a large percentage of malarial proteins are stagespecific.28,29 Surprisingly, a number of apical organelle and membrane-associated proteins were expressed both in sporozoites and merozoites.28 This supports previous observations that ebl and maebl products are expressed and can have essential roles in other stages of development.37–39 Therefore, it is apparent that many parasite ligands with defined functions are more functionally diverse than originally thought. In our analysis of maebl expression in different stages of malaria parasite development we discovered multiple transcripts. Alternative splicing of Plasmodium maebl created different ORF in the 3 0 CDS in all species of malaria parasites examined. We found that mRNA processing and alternative splicing of maebl was developmentally regulated. These data reveal an efficient conserved mechanism for alternative splicing among malaria parasites to create multiple unique gene products from a single locus.

Results Alternative splicing of the maebl 3 0 exons The canonical structure of maebl has splicing

ARTICLE IN PRESS RNA Processing in Malaria Parasites

Figure 1. Schematic gene structure of the Plasmodium maebl. The consensus gene structure of maebl (top) consists of five exons, which encode a (1) signal peptide, (2) extracellular domain, (3) transmembrane domain, and (4/5) cytoplasmic domain. Arrows beneath the gene structure display the approximate locations of the primers used for RT-PCR analysis of the splicing of 3 0 exons. Anti-MAEBL serum used here was prepared against the N-terminal ligand domain M1.

junctions within codons at the exon/intron boundaries in the 3 0 exons identical with other members of the ebl family.32,40 All ebl family and maebl products are deduced as type I membrane proteins and the 3 0 exons encode the putative transmembrane and cytoplasmic domains (Figure 1). In studying maebl

3 gene expression of P. yoelii sporozoites (S) during mosquito stage development we expected to detect a single transcript, but instead we discovered multiple RT-PCR products when amplifying portions of the 3 0 CDS of maebl (Figure 2). We extended this transcript analysis to other stages of development, exoerythrocytic forms (EEF) and blood-stages (BS), with similar results. Clones were isolated out of the total RT-PCR reaction corresponding to each of the three RT-PCR products detected from sporozoite RNA. One product had the expected canonical splicing pattern, but two other products represented novel transcripts created by alternative splicing of the maebl 3 0 exons (Figure 3(A)). Both alternatively spliced transcripts, referred to here as ORF2 and ORF3, encode putative soluble MAEBL isoforms (Figure 3(B)). Internal alternative cis-splicing of exon 3 generated the ORF2 transcript by using a right splicing junction (AAG) within intron 2. This alternative acceptor splice site is 16 nt before the canonical junction (YAG) of ORF1 and generates a frame shift to create a new C terminus without a transmembrane domain. The remaining splicing junctions for ORF2 transcripts remain the same as in

Figure 2. (A) Diagram of the life cycle of malaria parasites identifying the three stages of reproductive development: erythrocytic or blood-stage (BS); sexual including gametocytes, gametes, and oocyst (O); and exoerythrocytic forms (EEF). Sporozoites (S) are the products of sexual reproduction on the mosquito midgut then invade the salivary gland to become infective to a new vertebrate host. (B) Initial RT-PCR analysis for alternative splicing of maebl transcripts in sporozoites (S), exoerythrocytic forms at 0 hour and 44 hours during development, and bloodstage parasites (BS). Reactions were done with (C) and without (K) reverse transcriptase. Two products (O300 nt) are evident in all samples except 0 hour EEF, plus a third smaller product visible only in the S sample. Sequence analysis of these products identified them as ORF2, ORF1, and ORF3 from largest to smallest. Purified gametocytes or gametes were not available for analysis.

ARTICLE IN PRESS 4

RNA Processing in Malaria Parasites

Figure 3. (A) Schematic structures show the canonical (ORF1) and alternative splicing of maebl (ORF2, ORF3). Introns V arranged on top at exon boundaries of the main open reading frame ( ) are removed using splicing junctions that are W homologous to splicing junctions of the paralogous ebl, whereas introns arranged below ( ) are removed using alternative splicing junctions. CDSs that match the consensus MAEBL sequence are shaded in black (&), exons with possible alternative ORFs are shaded as grey ( ) and untranslated ORFs resulting from alternative splicing are shown as straight lines (—). (B) Deduced sequences are shown for the consensus and alternative ORF at the C-termini of P. yoelii MAEBL (AF031886). The nucleotide sequence begins near the end of exon 2 and extends through the final 3 0 coding exons as shown in Figure 1. The dominant alternatively spliced transcript is created by use of an acceptor splicing junction 16 nucleotides before the ORF1 acceptor junction. Inclusion of this extra sequence creates a shift in the ORF used in exons 3 and 4, switching deduced amino acid residues from hydrophobic to hydrophilic. ORF3 is created by skipping exons 3 and 4 entirely, connecting exons 2 and 5 together with the consensus donor and acceptor junctions of the canonical splicing pattern. Internal exon boundaries are identified by a mark (O), donor splicing junctions are shaded, and stop codons are boxed.

ARTICLE IN PRESS 5

Constitutive expression in multiple development stages typically is a characteristic of a house-keeping gene and so MAEBL expressed in multiple parasite developmental stages suggests a universal function without stage-specificity. This seems unlikely and instead MAEBL has some distinct functional characteristics in each the different invasive stages because as a surface ligand it is interacting with very different host cells that present quite distinct arrays of surface receptors. MAEBL avidly binds erythrocytes,1 is essential for sporozoite attachment and invasion of salivary glands,2 and is important for infection of hepatic stages.3 S, salivary gland sporozoite stage; EEF, liver-stage exoerythrocytic forms; BS, blood-stagestage. C, splicing pattern detected; K, never detected; *, detected at least in one sample preparation; na, samples not available for RT-PCR analysis.

C C C na na na na na na C C K C C K 1 2 3

C C C

C C K

C C C

C C C

C C K

C C *

C C *

C C *

C C K

na na na

EEF S BS EEF EEF S BS EEF EEF ORF

S

BS

S

265BY YM

P. yoelii

Table 1. Species and stage-specific detection of alternatively spliced 3 0 exons maebl

17XNL

BS

S

3D7

P. falciparum

P. vivax

BS

RNA Processing in Malaria Parasites

ORF1, but a stop at the second codon in exon 4 results in early termination of the CDS O50 nt before the next intron. Exon skipping (3 and 4) is the other type of alternative splicing in the maebl 3 0 exons, which creates the ORF3 transcript with exon 2 directly spliced to 5. This third splice variant appears to be only a very minor RT-PCR product as viewed by agarose gel electrophoresis. The codon triplet pattern of the ORF is unchanged but absence of exon 3 results in omission of the transmembrane domain CDS to create a MAEBL isoform of the extracellular domain with only a short additional polypeptide sequence added at the C terminus. Alternative splicing of 3 0 exons occurs in multiple stages and across Plasmodium species Each life cycle stage of the malaria parasite represents a unique developmental stage with different types of evolutionary adaptations to the distinct molecular environments of each host and each cell infected. Since alternative splicing in metazoans is often associated with expression of distinct functional isoforms in different tissues, we were interested to determine if there is an analogous stage-specific alternative splicing of maebl in other life cycle stages of the protozoan parasite. We obtained RNA from the sporogonic, exoerythrocytic forms, and blood stages of, P. yoelii (Table 1). We included in our analysis genetically and phenotypically distinct lines of this rodent malaria parasite: YM, 265BY, and 17XNL. RT-PCR detected identical patterns of alternative splicing of the 3 0 maebl exons, except ORF3 that was less consistently detected. These results indicate that there is no real difference in the pattern or level of alternative splicing in different developmental stages. Because the primary deduced amino acid structure of maebl is highly conserved across evolutionarily divergent Plasmodium species,34 we thought that the alternative splicing might also be conserved. Analysis of maebl in P. falciparum, Plasmodium berghei, Plasmodium knowlesi, and P. vivax revealed that the intron 2 nucleotide sequence involved in alternative splicing is highly conserved in each of these species (Figure 4). Although the canonical acceptor site for ORF1 varies in the first nucleotide position (TAG/CAG), the acceptor site involved in the ORF2 alternative splicing (AAG) is identical in all genes. Using RNA isolated from sporogonic and erythrocytic stages, the same splicing patterns of ORF1 and ORF2 were identified from P. falciparum (NF54) as for P. yoelii. The alternative splicing pattern for ORF3 was not detected in any of the P. falciparum stages examined; however, P. vivax had all three splicing patterns present in erythrocytic stages (other stages not available). Alternative splicing is developmentally regulated during oocyst development Occurrence of maebl alternative splicing in all of

ARTICLE IN PRESS 6

RNA Processing in Malaria Parasites

Figure 4. Alternatively spliced maebl intron 2 and flanking exon boundaries from evolutionarily divergent Plasmodium species. Nucleotides for exons are capitalized and introns are in lower case with the alternatively spliced region shaded. An asterisk beneath the aligned sequences identifies bases conserved in all species. Portions of the internal intron sequences were deleted and the number is indicated (Xn) (pf, P. falciparum AY042084; pb, P. berghei AF31887; py, P. yoelii AF031886; pk, P. knowlesi; pv, P. vivax AY042083).

the different developmental stages examined indicated that it was not tissue-specific, therefore, we were interested to determine if alternative splicing was regulated within a developmental cycle. Sporogonic development of the malaria parasite in the mosquito is slow relative to the other developmental stages in the vertebrate host and is more amenable to this type of analysis. After ingesting a malaria-infected blood meal, oocysts attached to the outside of the mosquito midgut require two weeks to develop to the motile sporozoite (Figure 2) compared to the !1-day and !2-day development cycles of the blood stages and exoerythrocytic forms, respectively. In addition, midgut sporozoites must then invade the mosquito salivary glands in order to complete their development and for the malaria parasite to be capable of infecting a new vertebrate host. We examined developing oocysts and sporozoites of P. yoelii, using semi-quantitative RT-PCR methods to specifically detect each splicing pattern, and identified developmentally coordinated differences in maebl splicing patterns (Figure 5(A)). Low levels of the ORF2 alternatively spliced transcripts appeared quite early in oocyst development and then was upregulated in the 6.5 days after ingesting an infected blood meal (Figure 5). In contrast, the ORF1 canonical splicing pattern was not detected until 6.5 days in oocyst development and then was upregulated 24 hours later. Expression of other apical organelle proteins, identified as important for sporozoite invasion processes (CSP, TRAP/SSP2, AMA1) were more similar to the ORF1 expression pattern (Figure 5(B)). Surprisingly, we found that the only ebl homologue identified in the P. yoelii genome was not actively transcribed in oocysts or sporozoites. PY-235 demonstrated a much briefer period of expression only during the final sporozoite differentiation phase at the end of oocyst development. Examination of ARF1 as a marker of the secretory pathway, which all of these products would pass through, indicated that this pathway was established early in oocyst development and further expanded during sporozoite differentiation. Western blot analysis, using an antiserum to the N-terminal cysteine-rich ligand domain, first detected expression of a single full-length MAEBL product early on day 7, approximately 12 hours after appearance of the ORF1 transcript (Figure 6). This anti-M1 serum should react to both ORF1 and

ORF2 MAEBL products, but only a single protein band was evident. Previously, we identified the O200 kDa protein as the transmembrane ORF1 MAEBL product.41 Given the small difference in size predicted between ORF1 and ORF2 products (z2 kDa) it is unlikely that the two bands would be distinguishable on a Western blot. To determine if ORF2 is also expressed, antisera was prepared against two different synthetic peptides from the short unique C terminus of the ORF2 product, but both of these sera were not reactive to parasite proteins by Western blots (data not shown). Consequently, there are no conclusive data regarding presence or absence of proteins potentially encoded by the alternatively spliced mRNAs. When the midgut sporozoites matured all full-length MAEBL product had undergone post-translational processing (Figure 6, 14G). After invasion of the salivary glands MAEBL was again expressed (Figure 6, 14S). Appearance of the more abundant CSP product corresponded more closely with appearance of its transcripts early on day 6 of oocyst development. The anti-CSP monoclonal identified both the precursor and post-translationally processed forms of CSP in the midgut and salivary gland sporozoites.42,43

Discussion Alternative splicing in mammals and other metazoans is important for creating functional diversity, particularly in cell adhesion molecules, through developmentally controlled tissue-specific expression of distinct isoforms.44 The occurrence of alternatively spliced transcripts for the ligand MAEBL during the different life cycle stages identified a mechanism by which a malaria parasite might similarly expand the functional diversity of its genome. Generation of possible soluble isoforms of MAEBL along with the canonical transmembrane form of MAEBL appeared to match the paradigm in metazoan organisms of alternative splicing creating distinct protein isoforms. Even if limited in scope, alternative splicing of transcripts may be an important mechanism to expand the functional diversity of the apparent limited genetic information of the Plasmodium genome. Alternative splicing has been observed for a few other Plasmodium genes, still only adenylyl cyclase variant isoforms are suggested to have possible functional differences.15

ARTICLE IN PRESS RNA Processing in Malaria Parasites

7

Figure 5. (A) Analysis of developmentally regulated maebl expression during oocyst development. Splicing patterns of maebl were analyzed using oligonucleotide primers specific for each splicing pattern. Each product was probed as indicated on the right with the maebl 3 0 product (Figure 2) or an oligonucleotide probe specific for that splice junction (Table 2). RT-PCR used total RNA prepared from infected mosquito midguts and numbers on the top of the Figure correspond to day of oocyst development after mosquito engorgement with P. yoelii-infected blood meal. Two samples were collected on days 6 and 7 in the morning (A) and 12 hours later (P). Day 14 samples included midgut sporozoites (14G) and salivary gland sporozoites (14S). Controls included uninfected midgut (UMG), P. yoelii-infected blood (BS), uninfected blood, no reverse transcriptase (-RT). (B) Gene expression patterns of other microneme proteins (CSP, TRAP/SSP2, AMA1) analyzed by RT-PCR were similar to MAEBL during oocyst development, although no transcript was detected for the EBA175 orthologue (PyEBL). Transcription of the rhoptry protein PY-235 was abundant briefly only at the onset of sporozoite differentiation (day 9). RT-PCR analysis of ARF1 was included as a reference since all of these proteins traffic through the secretory pathway.

We examined maebl transcript patterns from three distinct life cycle stages of several Plasmodium species within their insect and vertebrate hosts, but found no significant differences. Instead, the schemes of alternative splicing were well conserved amongst these evolutionarily divergent species and the ORF1 and ORF2 splicing patterns occurred in all stages. The lengthy development time of the stages in the mosquito vector provided the opportunity for closer analysis within a single life cycle stage and

we did resolve developmentally coordinated differences in the alternative and canonical splicing within the oocyst. MAEBL product was not detected early in oocyst development when just the ORF2 transcript was present, so expression of a full-length MAEBL product appeared to better correlate with expression of the canonical ORF1 transmembrane product. The N-terminal M1 ligand domain, which is the target of the anti-MAEBL serum used in this analysis, is part of both products.

ARTICLE IN PRESS 8

Figure 6. (A) Western blot analysis of MAEBL expression in total protein extracts of midgut oocysts and sporozoites and purified salivary gland sporozoites. Antiserum to the N-terminal M1 ligand domain detected a O200 kDa protein, corresponding to the full-length precursor protein, was first in the morning sample of day 7. The full-length protein was not evident in the mature midgut sporozoites (14G), but was re-expressed in sporozoites after they invaded the mosquito salivary glands (14S). Uninfected mosquito midgut (UMG) served as a negative control. (B) Western blot analysis of CSP expression, using monoclonal antibody NYS1, was included as a positive control for these parasite samples.

In a previous study, we confirmed that this fulllength MAEBL product, also expressed in salivary gland sporozoites, is the transmembrane MAEBL. Together these data suggest that alternatively spliced transcripts may not appear to have importance in the expression of different isoforms. It is suggested that mRNA processing and translational control mechanisms play a major role in regulating protein expression in malaria parasites, since not many transcriptional regulatory elements are identified in the P. falciparum genome.45,46 Little is known in Plasmodium about transcriptional control of gene expression through RNA processing,9 although this plays a critical role in regulating the proteome of higher eukaryotic organisms.47–49 Suppression of canonical splicing junctions and exon skipping, like that observed for Plasmodium maebl, are common RNA regulatory mechanisms among multicellular eukaryotic organisms.50,51 Several key players in regulated RNA processing are readily identifiable in the P. falciparum genome, including homologues of the SR protein ASF/SF-2 and the SR-related protein U2AF65, in accordance with a mechanism of

RNA Processing in Malaria Parasites

splicesome assembly on exonic splicing enhancer elements. Separate from creating different isoforms, alternative splicing may also be a mechanism controlling Plasmodium gene expression through introduction of early termination codons that lead to nonsense mediated decay (NMD) of such mRNA. In mammals, premature stop codons, those occurring O50 nt upstream of the final exon, target transcripts for decay. The dominant alternative splicing of maebl does introduce an early stop codon in the penultimate exon in a pattern consistent with NMD. However, surveillance mechanisms regulating NMD in Plasmodium may be more similar to other unicellular eukaryotes like yeast, which utilize other mechanisms.52 Our analysis of maebl transcripts reveals a complexity of mRNA processing much greater than expected for a unicellular eukaryote. Malaria parasites display a high degree of developmental control of gene expression and yet there is a dearth of factors to tightly control transcription. Undoubtedly, this elevates the importance of posttranscriptional control mechanisms to prevent translation of nonsense proteins or proteins at the wrong stage of development. Identifying how RNA is processed provides important insight into our general understanding of the gene regulatory networks of these important unicellular pathogens.

Methods Parasites Genomic DNA of P. falciparum (3D7), P. y. yoelii (256 BY, 17X NL 1.1, YM lines), and P. vivax (Sal-1) were obtained by standard extraction protocols.53 P. yoelii 17X was routinely maintained in Syrian golden hamsters transmitted to three to five day old Anopheles stephensi.54 Mosquitoes were maintained at 25 8C and 70–80% relative humidity. The infectivity of mosquitoes was determined on day 5 post-infective blood meal by counting oocysts in dissected midguts stained with mercurochrome and sporozoites on day 14 from salivary glands preparation. The salivary glands and midgut were dissected out from infected A. stephensi and gently ground in PBS to release P. yoelii sporozoites. After the removal of tissue fragments by centrifugation at 18g for three minutes, sporozoites were collected from the supernatant by centrifugation at 5000g for three minutes. Extraction of RNA and DNA Infected blood was collected at 10–20% parasitemia, washed in PBS. Leukocytes were removed by filtering blood through Plasmodipur filter (Euro-Diagnostica), and then the blood pellet resuspended in TRI-reagent (Invitrogen) for total RNA extraction. Genomic DNA from blood-stage parasite was extracted by the phenol/chloroform method. All oocyst RNA samples were collected from infected midguts on day 1, 2, 3, 4, 5, 6/am, 6/pm, 7/am, 7/pm, 8, 9, 10 and 14 post-infective blood meal and solubilized in TRI-reagent. Mature sporozoites were collected on day 14 from infected mosquito salivary glands and total RNA was extracted with TRI-reagent, according to the manufacturer’s instructions. Total RNA

ARTICLE IN PRESS 9

RNA Processing in Malaria Parasites

Table 2. Primer description used in RT-PCR. Each primer pair is listed as sense (S) and antisense (A) Genes maebl 3 0 -set 1

Accession number

Primer

AF031886

S A S A S A S A S A S A S A S A S A S A S A S A

0

maebl 3 -set 2

AF031886

Pfmaebl 3 0 -set 1

AYO42084

Pfmaebl 3 0 set 2

AYO42084

maebl ORF1

AF031886

maebl ORF2

AF031886

CSP

PY03168

SSP2

PY03052

AMA1

PY01581

EBL

PY04764

Py235

Y11181

ARF1

PY04572

Primer sequence (5 0 -3 0 ) ATGCTAAATATAAAACATCAC GAAACAATTATGCTGCAATATCAGATTATT CAAAGAAGGAATTTTCAGATCC GCTGTATAAATTTCCGTATG CATTATTAAGTTAATAAACATTGCAAAATTAAGC ATGTTGTTCCATTTCTGATTTTTGTCT CATTTGATTATGTTTTCTTCCG GAATTTGCTGATCCTTTATATAG AGTAACGAGGAATATTCAAAAGC TTGCATAATATTTTATAATTCTTTTAGAATATG AGTAACGAGGAATATTCAATTAC TTGCATAATATTTTATAATTCTTTTAGAATATG AATGAAGATTCTTATGTCCCAAGC TACAAATCCTAATGAATTGCTTAC TGGAAAATGGGAAGAATGGAGTG TGTGGGCAATCACGAACCTTAC AAATTTGGAATCTGGGTTGATGGT AGTACTAGATAAAGCAGT TATTATGATTGTATGAATGAAGAG TACAGGTATATATTCTTGTACACG GACGATTTAAAAAATAAAAAACAGGAG CTATAACTTCATCTTCTCTTTCAAAAAGCG AAAGTCAAATTAGGAGAAGTTG TGTAGCGCAGGTTGATTGGATG

was also extracted from uninfected blood as well as uninfected midguts for control RT-PCR with the same method.

probing was 10 8C less than oligo Tm. Hybridized blots were exposed to X-ray film for variable time periods at K70 8C to obtain clear bands.

RT-PCR amplification and cloning of maebl

Immunoblotting

RNA from different stages was extensively treated with DNase I (Amp grade) before use in the reverse-transcriptase step, using Superscript (Invitrogen) one-step RT-PCR kit.55 Oligonucleotide primers amplified maebl of P. falciparum or P. yoelii, at the 3 0 -end flanking introns 2–4. Samples from RT-PCR reactions were analyzed by agarose gel electrophoresis. RT-PCR products were purified, cloned and sequenced as described.7,55 RT-PCR analysis of the maebl 3 0 -end of P. yoelii was carried out with sense (S) and antisense (A) oligonucleotide primers in set 1 as indicated in Table 2, using standard methods as described.56 Negative samples were subjected to a nested reaction using set 2. Analysis of the P. falciparum maebl was identical using Pfmaebl primer set 1 and 2. Samples from RT-PCR reactions were analyzed by agarose gel electrophoresis. RT-PCR products were purified using the QIAquick PCR purification kit (QIAGEN), cloned and sequenced as described.55

Infected midguts with oocysts collected on day 5, 6/am, 6/pm, 7/am, 7/pm, 8 and 14 as well as mature salivary gland sporozoites were directly mixed with SDSPAGE sample buffer for protein analysis by Western blot. Equivalent numbers of uninfected midguts were used as controls. Western blot analysis was performed with antisera (“C10”) raised against GST fused P. yoelii MAEBL M1 domain protein in rabbits.4 Anti-CSP (NYS-1)43 murine monoclonal antibody was used as a control. Midgut and sporozoite samples were solubilized in SDSPAGE sample buffer containing b-mercaptoethanol and heated to 70 8C for five minutes. Equivalent amounts of uninfected midgut control were also included. After electrophoresis, proteins were electrotransfered onto nitrocellulose membranes (Millipore). Blots were blocked with 5% non-fat dry milk in PBS-T and washed five times with PBS-T. Anti-MAEBL C10 (1:500) and anti-CSP (1:1000) in PBS-T followed by secondary antibody HRPconjugates were used with an enhanced chemiluminiscence system (Amersham Biosciences) to detect parasite antigens.

Sequence analysis and Southern blot hybridization Sequences of cloned DNA were determined by the dideoxy chain termination method. Nucleotide and deduced amino acid sequences were aligned using the CLUSTAL (MacVector 6.5.3) and adjusted manually. RTPCR products resolved by agarose gel electrophoresis, denatured and transferred onto positive nylon membranes. Blots were hybridized with radiolabeled probes (RT-PCR products or gene-specific oligonucleotide), as indicated in Figure legends, using standard protocols. The oligonucleotide probes for ORF1 was GGAATATTC AAAAGCGGTTTA and ORF2 was GGAATATTCAATT ACGTTTTTTT. The hybridization temperature for oligo

Acknowledgements This work was supported by the National Institutes of Health (R01 AI33656) and a Burroughs Wellcome Fund travel grant (J.H.A.). Travel (P.R.P. and L.R.) was funded by The Royal Society’s “Joint Project under European Science Exchange Programme” and The British Council’s and French

ARTICLE IN PRESS 10 Ministry of Foreign Affairs “Alliance: FrancoBritish Partnership Programme”. T.V. held a fellowship from MRT. This work was supported in part by Grants-in-Aid for Scientific Research 13576007 (M.T.) from the Ministry of Education, Science, Sports and Culture, Japan. NYS-I was kindly provided by Dr Y. Charoenvit.

RNA Processing in Malaria Parasites

15.

16.

References 1. Markell, E. K., John, D. T. & Krotoski, W. A. (1998). Medical Parasitology, 8th edit., W. B. Saunders Company, Philadelphia, PA. 2. Gardner, M. J., Tettelin, H., Carucci, D. J., Cummings, L. M., Aravind, L., Koonin, E. V. et al. (1998). Chromosome 2 sequence of the human malaria parasite Plasmodium falciparum. Science, 282, 1126– 1132. 3. Bowman, S., Lawson, D., Basham, D., Brown, D., Chillingworth, T., Churcher, C. M. et al. (1999). The complete nucleotide sequence of chromosome 3 of Plasmodium falciparum. Nature, 400, 532–538. 4. Noe, A. R., Fishkind, D. J. & Adams, J. H. (2000). Spatial and temporal dynamics of the secretory pathway during differentiation of the Plasmodium yoelii schizont. Mol. Biochem. Parasitol. 108, 169–185. 5. Bozdech, Z., Llinas, M., Pulliam, B. L., Wong, E. D., Zhu, J. & Derisi, J. L. (2003). The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS. Biol. 1, 5. 6. Le Roch, K. G., Zhou, Y., Blair, P. L., Grainger, M., Moch, J. K., Haynes, J. D. et al. (2003). Discovery of gene function by expression profiling of the malaria parasite life cycle. Science, 301, 1503–1508. 7. Blair, P. L., Witney, A., Haynes, J. D., Moch, J. K., Carucci, D. J. & Adams, J. H. (2002). Transcripts of developmentally regulated Plasmodium falciparum genes quantified by real-time RT-PCR. Nucl. Acids Res. 30, 2224–2231. 8. Calderwood, M. S., Gannoun-Zaki, L., Wellems, T. E. & Deitsch, K. W. (2003). Plasmodium falciparum var genes are regulated by two regions with separate promoters, one upstream of the coding region and a second within the intron. J. Biol. Chem. 278, 34125– 34132. 9. Horrocks, P., Dechering, K. & Lanzer, M. (1998). Control of gene expression in Plasmodium falciparum. Mol. Biochem. Parasitol. 95, 171–181. 10. van Lin, L. H., Janse, C. J. & Waters, A. P. (2000). The conserved genome organisation of non-falciparum malaria species: the need to know more. Int. J. Parasitol. 30, 357–370. 11. Crabb, B. S. & Cowman, A. F. (1996). Characterization of promoters and stable transfection by homologous and nonhomologous recombination in Plasmodium falciparum. Proc. Natl Acad. Sci. USA, 93, 7289–7294. 12. Vinkenoog, R., Veldhuisen, B., Speranca, M. A., Del Portillo, H. A., Janse, C. & Waters, A. P. (1995). Comparison of introns in a cdc2-homologous gene within a number of Plasmodium species. Mol. Biochem. Parasitol. 71, 233–241. 13. Knapp, B., Nau, U., Hundt, E. & Kupper, H. A. (1991). Demonstration of alternative splicing of a pre-mRNA expressed in the blood stage form of Plasmodium falciparum. J. Biol. Chem. 266, 7148–7154. 14. Pace, T., Birago, C., Janse, C. J., Picci, L. & Ponzi, M. (1998). Developmental regulation of a Plasmodium

17.

18.

19.

20.

21. 22. 23.

24.

25.

26.

27.

28.

29.

30.

gene involves the generation of stage-specific 5 0 untranslated sequences. Mol. Biochem. Parasitol. 97, 45–53. Muhia, D. K., Swales, C. A., Eckstein-Ludwig, U., Saran, S., Polley, S. D., Kelly, J. M. et al. (2003). Multiple splice variants encode a novel adenylyl cyclase of possible plastid origin expressed in the sexual stage of the malaria parasite Plasmodium falciparum. J. Biol. Chem. 278, 22014–22022. van Lin, L. H., Pace, T., Janse, C. J., Birago, C., Ramesar, J., Picci, L. et al. (2001). Interspecies conservation of gene order and intron-exon structure in a genomic locus of high gene density and complexity in Plasmodium. Nucl. Acids Res. 29, 2059–2068. Volkman, S. K., Barry, A. E., Lyons, E. J., Nielsen, K. M., Thomas, S. M., Choi, M. et al. (2001). Recent origin of Plasmodium falciparum from a single progenitor. Science, 293, 482–484. Celotto, A. M. & Graveley, B. R. (2001). Alternative splicing of the Drosophila Dscam pre-mRNA is both temporally and spatially regulated. Genetics, 159, 599– 608. Wollerton, M. C., Gooding, C., Robinson, F., Brown, E. C., Jackson, R. J. & Smith, C. W. (2001). Differential alternative splicing activity of isoforms of polypyrimidine tract binding protein (PTB). RNA, 7, 819–832. Delotto, Y., Smith, C. & Delotto, R. (2001). Multiple isoforms of the Drosophila Spatzle protein are encoded by alternatively spliced maternal mRNAs in the precellular blastoderm embryo. Mol. Gen. Genet. 264, 643–652. Smith, C. W. & Valcarcel, J. (2000). Alternative premRNA splicing: the logic of combinatorial control. Trends Biochem. Sci. 25, 381–388. Hillman, R. T., Green, R. E. & Brenner, S. E. (2004). An unappreciated role for RNA surveillance. Genome Biol. 5, R8. Lewis, B. P., Green, R. E. & Brenner, S. E. (2003). Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. Proc. Natl Acad. Sci. USA, 100, 189–192. Shaw, M. K., Thompson, J. & Sinden, R. E. (1996). Localization of ribosomal RNA and Pbs21-mRNA in the sexual stages of Plasmodium berghei using electron microscope in situ hybridization. Eur. J. Cell Biol. 71, 270–276. Triglia, T., Thompson, J. K. & Cowman, A. F. (2001). An EBA175 homologue which is transcribed but not translated in erythrocytic stages of Plasmodium falciparum. Mol. Biochem. Parasitol. 116, 55–63. Taylor, H. M., Triglia, T., Thompson, J., Sajid, M., Fowler, R., Wickham, M. E. et al. (2001). Plasmodium falciparum homologue of the genes for Plasmodium vivax and Plasmodium yoelii adhesive proteins, which is transcribed but not translated. Infect. Immun. 69, 3635–3645. Preiser, P., Kaviratne, M., Khan, S., Bannister, L. & Jarra, W. (2000). The apical organelles of malaria merozoites: host cell selection, invasion, host immunity and immune evasion. Microbes Infect. 2, 1461–1477. Florens, L., Washburn, M. P., Raine, J. D., Anthony, R. M., Grainger, M., Haynes, J. D. et al. (2002). A proteomic view of the Plasmodium falciparum life cycle. Nature, 419, 520–526. Lasonder, E., Ishihama, Y., Andersen, J. S., Vermunt, A. M., Pain, A., Sauerwein, R. W. et al. (2002). Analysis of the Plasmodium falciparum proteome by highaccuracy mass spectrometry. Nature, 419, 537–542. Dubremetz, J. F., Garcia-Reguet, N., Conseil, V. &

ARTICLE IN PRESS 11

RNA Processing in Malaria Parasites

31. 32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

Fourmaux, M. N. (1998). Apical organelles and hostcell invasion by apicomplexa. Int. J. Parasitol. 28, 1007– 1013. Adams, J. H., Kaneko, O., Blair, P. L. & Peterson, D. S. (2001). An expanding ebl family of Plasmodium falciparum. Trends Parasitol. 17, 297–299. Adams, J. H., Sim, B. K. L., Dolan, S. A., Fang, X., Kaslow, D. C. & Miller, L. H. (1992). A family of erythrocyte binding proteins of malaria parasites. Proc. Natl Acad. Sci. USA, 89, 7085–7089. Kappe, S. H., Noe, A. R., Fraser, T. S., Blair, P. L. & Adams, J. H. (1998). A family of chimeric erythrocyte binding proteins of malaria parasites. Proc. Natl Acad. Sci. USA, 95, 1230–1235. Michon, P., Stevens, J. R., Kaneko, O. & Adams, J. H. (2002). Evolutionary relationships of conserved cysteine-rich motifs in adhesive molecules of malaria parasites. Mol. Biol. Evol. 19, 1128–1142. Blair, P. L., Kappe, S. H., Maciel, J. E., Balu, B. & Adams, J. H. (2002). Plasmodium falciparum MAEBL is a unique member of the ebl family. Mol. Biochem. Parasitol. 122, 35–44. Ghai, M., Dutta, S., Hall, T., Freilich, D. & Ockenhouse, C. (2002). Identification, expression, and functional characterization of MAEBL, a sporozoite and asexual blood stage chimeric erythrocytebinding protein of Plasmodium falciparum. Mol. Biochem. Parasitol. 123, 35. Gruner, A. C., Brahimi, K., Letourneur, F., Renia, L., Eling, W., Snounou, G. & Druilhe, P. (2001). Expression of the erythrocyte-binding antigen 175 in sporozoites and in liver stages of Plasmodium falciparum. J. Infect. Dis. 184, 892–897. Kappe, S. H., Gardner, M. J., Brown, S. M., Ross, J., Matuschewski, K., Ribeiro, J. M. et al. (2001). Exploring the transcriptome of the malaria sporozoite stage. Proc. Natl Acad. Sci. USA, 98, 9895–9900. Kariu, T., Yuda, M., Yano, K. & Chinzei, Y. (2002). MAEBL is essential for malarial sporozoite infection of the mosquito salivary gland. J. Expt. Med. 195, 1317–1323. Kappe, S. H. I., Noe, A. R., Fraser, T. S., Blair, P. L. & Adams, J. H. (1998). A family of chimeric erythrocyte binding proteins of malaria parasites. Proc. Natl Acad. Sci. USA, 95, 1230–1235. Preiser, P. R., Renia, L., Singh, N., Balu, B., Jarra, W., Voza, T. et al. (2004). Antibodies against MAEBL ligand domains M1 and M2 inhibit sporozoite development in vitro. Infect. Immun. 72, 3604–3608. Yoshida, N., Potocnjak, P., Nussenzweig, V. &

43.

44.

45.

46. 47. 48.

49. 50. 51. 52.

53. 54.

55.

56.

Nussenzweig, R. S. (1981). Biosynthesis of Pb44, the protective antigen of sporozoites of Plasmodium berghei. J. Expt. Med. 154, 1225–1236. Charoenvit, Y., Leef, M. F., Yuan, L. F., Sedegah, M. & Beaudoin, R. L. (1987). Characterization of Plasmodium yoelii monoclonal antibodies directed against stage-specific sporozoite antigens. Infect. Immun. 55, 604–608. Rowen, L., Young, J., Birditt, B., Kaur, A., Madan, A., Philipps, D. L. et al. (2002). Analysis of the human neurexin genes: alternative splicing and the generation of protein diversity. Genomics, 79, 587–597. Gardner, M. J., Hall, N., Fung, E., White, O., Berriman, M., Hyman, R. W. et al. (2002). Genome sequence of the human malaria parasite Plasmodium falciparum. Nature, 419, 498–511. Wirth, D. F. (2002). Biological revelations. Nature, 419, 495–496. Modrek, B. & Lee, C. (2002). A genomic view of alternative splicing. Nature Genet. 30, 13–19. Harrison, P. M., Kumar, A., Lang, N., Snyder, M. & Gerstein, M. (2002). A question of size: the eukaryotic proteome and the problems in defining it. Nucl. Acids Res. 30, 1083–1090. Graveley, B. R. (2001). Alternative splicing: increasing diversity in the proteomic world. Trends Genet. 17, 100–107. Caceres, J. F. & Kornblihtt, A. R. (2002). Alternative splicing: multiple control mechanisms and involvement in human disease. Trends Genet. 18, 186–193. Brett, D., Pospisil, H., Valcarcel, J., Reich, J. & Bork, P. (2002). Alternative splicing and genome complexity. Nature Genet. 30, 29–30. Kebaara, B., Nazarenus, T., Taylor, R., Forch, A. & Atkin, A. L. (2003). The Upf-dependent decay of wildtype PPR1 mRNA depends on its 5 0 -UTR and first 92 ORF nucleotides. Nucl. Acids Res. 31, 3157–3165. Schlichtherle, M., Wahlgren, M., Perlmann, H. & Scherf, A. (2000). Methods in Malaria Research, 3rd edit., MR4/ATCC. Singh, N. & Puri, S. K. (1998). Causal prophylactic activity of antihistaminic agents against Plasmodium yoelii nigeriensis infection in Swiss mice. Acta Trop. 69, 255–260. Preiser, P. R. & Jarra, W. (1998). Plasmodium yoelii: differences in the transcription of the 235-kDa rhoptry protein multigene family in lethal and nonlethal lines. Expt. Parasitol. 89, 50–57. Preiser, P. R., Jarra, W., Capiod, T. & Snounou, G. (1999). A rhoptry-protein-associated mechanism of clonal phenotypic variation in rodent malaria. Nature, 398, 618–622.

Edited by J. Karn (Received 13 July 2004; received in revised form 11 August 2004; accepted 13 August 2004)