Systematic and Applied Microbiology 35 (2012) 326–333
Contents lists available at SciVerse ScienceDirect
Systematic and Applied Microbiology journal homepage: www.elsevier.de/syapm
Antibiotic resistance and virulence traits in clinical and environmental Enterococcus faecalis and Enterococcus faecium isolates I.U. Rathnayake, M. Hargreaves, F. Huygens ∗ School of Biomedical Sciences, Faculty of Health, Queensland University of Technology, Australia
a r t i c l e
i n f o
Article history: Received 5 March 2012 Received in revised form 21 May 2012 Accepted 29 May 2012 Keywords: E. faecalis E. faecium Antibiotic resistance Virulence determinants
a b s t r a c t This study compared virulence and antibiotic resistance traits in clinical and environmental Enterococcus faecalis and Enterococcus faecium isolates. E. faecalis isolates harboured a broader spectrum of virulence determinants compared to E. faecium isolates. The virulence traits Cyl-A, Cyl-B, Cyl-M, gel-E, esp and acm were tested and environmental isolates predominantly harboured gel-E (80% of E. faecalis and 31.9% of E. faecium) whereas esp was more prevalent in clinical isolates (67.8% of E. faecalis and 70.4% of E. faecium). E. faecalis and E. faecium isolated from water had different antibiotic resistance patterns compared to those isolated from clinical samples. Linezolid resistance was not observed in any isolates tested and vancomycin resistance was observed only in clinical isolates. Resistance to other antibiotics (tetracycline, gentamicin, ciprofloxacin and ampicillin) was detected in both clinical and water isolates. Clinical isolates were more resistant to all the antibiotics tested compared to water isolates. Multi-drug resistance was more prevalent in clinical isolates (71.2% of E. faecalis and 70.3% of E. faecium) compared to water isolates (only 5.7% E. faecium). tet L and tet M genes were predominantly identified in tetracycline-resistant isolates. All water and clinical isolates resistant to ciprofloxacin and ampicillin contained mutations in the gyrA, parC and pbp5 genes. A significant correlation was found between the presence of virulence determinants and antibiotic resistance in all the isolates tested in this study (p < 0.05). The presence of antibiotic resistant enterococci, together with associated virulence traits, in surface recreational water could be a public health risk. © 2012 Elsevier GmbH. All rights reserved.
Introduction Enterococci occur ubiquitously and are natural members of the digestive microbiota in warm-blooded animals and humans, but may be present in soil, surface water, on plants, vegetables, in some food items such as fermented products and as human probiotics [8,29]. However enterococci are not regarded as “Generally Recognized As Safe” (GRAS) [36,39] and their presence is regarded as an indicator of faecal contamination [31]. Enterococci are typical opportunistic pathogens which are harmless in healthy individuals and mainly cause infections in patients who are in intensive care units, who have severe underlying disease, or who are immunocompromised [35]. Enterococci are ranked among the most prevalent organisms encountered in nosocomial infections and cause bacteraemia, endocarditis, urinary tract and other infections [26]. Moreover, previous epidemiological studies demonstrated a correlation between the concentration of
∗ Corresponding author at: School of Biomedical Sciences, Faculty of Health, Queensland University of Technology, 2 George St, Brisbane, Queensland, 4001, Australia. Tel.: +61 7 3138 0453; fax: +61 7 3138 6030. E-mail address:
[email protected] (F. Huygens). 0723-2020/$ – see front matter © 2012 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.syapm.2012.05.004
enterococci in surface waters and an increase in swimmerassociated gastroenteritis [15–17,24]. Enterococcal infections are predominantly caused by Enterococcus faecalis and Enterococcus faecium [37]. In addition to the increasing rate of infections, enteroccci are increasingly becoming more resistant to antimicrobial agents globally. Enterococci are either intrinsically resistant when the resistance genes are located on the chromosome, or they possess acquired resistance determinants which are located on plasmids or transposons [45]. This suggests that the treatment of enterococcal infections could be difficult as they possess intrinsic resistance determinants to many antibiotics. Furthermore, the presence of virulence factors associated with Enterococci enhances their pathogenicity [29]. These virulence factors trigger the pathogenicity of the infecting strains by allowing the colonisation of host tissue, invasion of host tissue, translocation through epithelial cells and evading the host’s immune response. In addition, virulent strains produce pathological changes either directly by toxin production or indirectly by inflammation [45]. The virulence factor, Enterococcal surface protein (Esp) plays an important role in the pathogenicity of enterococci, produced by E. faecalis and E. faecium. The incidence of Esp was shown to be higher among clinical strains of E. faecalis and E. faecium than isolates from
I.U. Rathnayake et al. / Systematic and Applied Microbiology 35 (2012) 326–333
healthy individuals, indicating its role in pathogenicity [7]. The gene encoding this trait in both enterococcal species appears to be chromosomally encoded. The presence of the esp gene contributes to colonisation and persistence of E. faecalis and E. faecium in host tissue. In addition to a role of adhesion, Esp may also have a function in evasion of the host’s immune response. GelE has been shown to cleave fibrin, which has an important implication in the virulence of Enterococci. Expression of GelE leads to the degradation of the fibrin layer surrounding bacteria and allows further dissemination of the organism. Furthermore, GelE is responsible for the degradation of antimicrobial peptides which are part of the innate immune system [46]. Cytolysin, encoded by the Cyl-A, Cyl-B, Cyl-M genes, enables the organism to evade the host immune response by destroying cells such as macrophages and neutrophils [14]. Production of cytolysin appears to be a major risk factor associated with pathogenic enterococci. In order to cause infection and bacteraemia, enterococci must penetrate the intestinal or genitourinary epithelium and enter the lymphatic and/or vascular system [43]. This translocation is facilitated by the aggregation protein. In E. faecium, collagen binding adhesion (Acm) also plays an important role in pathogenicity [36]. The spread of infectious enterococci from the hospital environment or other sources to environmental water bodies through sewage discharge or other means could increase the prevalence of these strains in the human population and become a potential risk to human health [34]. Several researchers have reported the distribution of antimicrobial-resistance and virulence factors in clinical isolates [3,31]. Comparative analysis of resistance patterns in clinical isolates and isolates originating from other environments such as food, sea water and waste water have been investigated previously [7,29]. However very little is reported about the distribution of antimicrobial resistance and virulence markers among E. faecalis and E. faecium sourced from water. The current study was performed to determine the incidence of antibiotic resistance and virulence determinants in E. faecalis and E. faecium sourced from surface water compared to clinical samples. In addition, we investigated whether there was any correlation between the presence of specific virulence genes and antibiotic resistance genes in both clinical and water sourced E. faecalis and E. faecium isolates.
Materials and methods Sample processing and bacterial identification A total number of 188 strains originating from clinical and water samples were tested in this study. E. faecalis (n = 59) and E. faecium (n = 27) clinical isolates were obtained from Pathology Queensland and the QUT culture collection. Speciation of these isolates was confirmed by performing real-time PCR to detect the genes ddlE. faecalis and ddlE. feacium (ddl-d-alanine:d-alanine ligase) which are specific for E. faecium and E. faecalis respectively, using specific primers [40]. Primers were synthesised by Sigma–Aldrich, Castle Hill, NSW, Australia. Surface water samples were collected from six designated sites of the Coomera River, South East Queensland, which were identified by the Gold Coast City Council as problematic sites with a history of high number of faecal coliforms [40]. Water samples were processed according to the USEPA (United States Environmental Protection Agency) specifications using membraneEnterococus Indoxyl--d-glucoside agar (mEI) agar (Difco, North Ryde, Australia) and the membrane filtration method [50]. Typical colonies that appeared on the membranes were identified to the genus and species level using previously described methods [12] and E. faecalis (n = 55) and E. faecium (n = 47) isolates were also
327
confirmed using the ddlE. faecalis and ddlE. feacium real-time PCR test [40]. Antibiotic susceptibility testing Antibiotic resistance phenotypes were determined by the disk diffusion method according to the standard recommendations of the Clinical and Laboratory Standards Institute [6]. The antibiotic discs vancomycin (VAN, 30 g), ampicillin (AMP, 10 g), gentamicin (GEN, 10 g), tetracycline (TET, 30 g), ciprofloxacin (CIP, 5 g) and linezolid (LIN, 30 g) (Oxoid, Thebarton, Australia), were placed on the surface of each inoculated plate. The diameters of antibiotic inhibition zones were measured and recorded as susceptible (S), intermediate (I) or resistant (R) according to CLSI M02-A10. E. faecalis strain ATCC 29212 and Staphylococcus aureus strain ATCC 25923 was used for quality control. Real-time PCR for the detection of antibiotic resistance genes and virulence determinants DNA preparation The Corbett X-tractor Gene automated DNA extraction system (Corbett Robotics, Brisbane, Australia) was used to extract genomic DNA from all E. faecalis and E. faecium isolates, sub-cultured in Brain Heart Infusion Broth (BHIB) (Oxoid). The core protocol No.141404 version 02 which allows for the simultaneous extraction of DNA from 96 isolates was used as the extraction method. Primer design Real-time PCR primers for genes encoding resistance to vancomycin [vanA, vanB, vanC1, vanC2], tetracycline [tet M, tet L, tet S], ciprofloxacin [gyrA], ampicillin [pbp5], gentamicin [aac(6 )-aph(2 )] and genes encoding virulence determinants such as cytolysins (cylA, cylB, cylM), gelatinase (gel E) and extracellular surface protein (esp) were designed using the Primer Express 2.0 primer design software program (Applied BioSystems, Carlsbad, CA, USA). Previously described primers were used to detect the presence of the acm gene in E. faecium [36]. Primer sequences together with the expected amplicon sizes are listed in Table 1. Real-time PCR All enterococcal isolates were screened for the presence of antibiotic resistance and virulence genes by real-time PCR. Amplification was performed in 20 l of reaction mix. Each reaction contained 2 l DNA which was added to 18 l of reaction master mix containing 10 l of 2× SYBRGreen® PCR Mastermix (Invitrogen, Mulgrave, Australia) and 0.25 l of reverse and forward primers (20 M stock, final concentration 0.5 M). The reactions were performed in a Rotor-Gene 6000 real-time PCR cycler (Qiagen, Doncaster, Australia). Cycling conditions consisted of 50 ◦ C for 2 min, 95 ◦ C for 10 min, followed by 40 cycles of 95 ◦ C for 15 s, 60 ◦ C for 60 s, and 72 ◦ C for 60 s. A melting curve analysis was performed for each real-time PCR experiment to separate the specific product from non-specific products and primer-dimers. In the melting profile analysis, the temperature was increased from 60 ◦ C to 90 ◦ C at 0.5 ◦ C min−1 . Each isolate was tested in duplicate, positive and negative controls were included in all analyses and no template controls (NTCs) were used for each primer set as well. Amplicons representing each gene target were confirmed by sequencing. Sequencing was performed using a protocol of 96 ◦ C for 1 min, 96 ◦ C for 10 s, 50 ◦ C for 5 s and 60 ◦ C for 4 min on the AB3730XL instrument (Applied BioSystems). Sequencing data were analysed and mutations were detected using Vector NTI (version 11, Invitrogen) software.
328
I.U. Rathnayake et al. / Systematic and Applied Microbiology 35 (2012) 326–333
Table 1 Oligonucleotide primers for Real-Time PCR detection of genes encoding for resistance to vancomycin (vanA, vanB, vanC1,vanC2), tetracycline (tet L, tet M, tet S), ciprofloxacin (gyrA), ampicillin (pbp5) and gentamicin (aac(6 )-aph(2 )) and genes encoding virulence factors cytolysins (cylA, cylB, cylM), gelatinase (gel E) extracellular surface protein (esp) and collagen binding protein (acm). Target gene
Primer name
Primer sequence (5 –3 )
cylA
cylAFa cylARb cylBF cylBR cylMF cylMR espF espR gelEF gelER acmF acmR vanAF vanAR vanBF vanBR tetLF tetLR tetMF tetMR tetSF tetSR gyrAF gyrAR pbp5F pbp5R acc-aphF acc-aphR
CAAGTTGCTGGAGTAATAGACACGAT TCCCATCCATCACCTTGTAAGAA CATGGTACACAAGTTGCTGGAGTAA CCCATCCATCACCTTGTAAGAATT GTATTTAGAATCACTAGGATTCTTTGTAGGAA GGAATTTCAGAATCTAGGTTTCTCAATAA CTTTCGACGTGGATGTAGAGTTTG GGTACGTATGTTGCATCATTTTCC TCAGTGGTGTCAGCAGCCTTT TGGTTTACCTGAATGTCTTCTTTAGC GGCCAGAAACGTAACCGATA AACCAGAAGCTGGCTTTGTC TGTGCGGTATTGGGAAACAG GATTCCGTACTGCAGCCTGATT TCTGCTTGTCATGAAAGAAAGAGAA GCATTTGCCATGCAAAACC GGGTAAAGCATTTGGTCTTATTGG ATCGCTGGACCGACTCCTT GCAGAATATACCATTCACATCGAAGT AAACCAATGGAAGCCCAGAA CCATTGATATCGAAGTACCTCCAA AGGAAGTGGTGTTACAGATAAACCAA CGGATGAACGAATTGGGTGTGA AATTTTACTCATACGTGCTT GTTCTGATCGAACATGAAGTTCAAA TGTGCCTTCGGATCGATTG TCCTTACTTAATGACCGATGTACTCT TCTTCGCTTTCGCCACTTTGA
cylB cylM esp gelE acm van A van B tet L tet M tet S gyr A pbp 5
aac(6 )-aph(2 ) a b
Amplicon size (bp)
Positive control
70
ATCC 29212
78
ATCC 29212
81
ATCC 29212
70
C68
85
ATCC 29212
135
RBH200522
72
ATCC 51559
121
ATCC 700802
63
RBH200523
59
RBH200535
68
RBH200535
239
ATCC 51559
65
ATCC 51559
147
ATCC 700802
F forward primer. reverse primer.
gyrA and parC gene mutations detected in ciprofloxacin-resistant isolates Enterococcal isolates which were identified as ciprofloxacinresistant and intermediate-resistant were screened for gene mutations. The gyrA and parC genes were amplified and sequenced. The primers used were: 5 CGGGATGAACGAATTGGGTGTGA3 and 5 AATTTTACTCATACGTGCTTCGG3 (gyrA forward and reverse respectively); and 5 AATGAATAAAGATGGCAATA3 and 5 CGCCATCCATACTTCCGTTG3 (parC forward and reverse respectively) [9]. Each reaction contained 5 l of PCR buffer (Roche, Castle Hill, Australia), 1 l of dNTP (Roche), 1.25 l each primer (20 M in stock, final concentration 0.5 M), 0.2 l of Taq Polymerase (Roche), 2 l of genomic DNA and molecular grade water to a final volume of 50 l to obtain reliable amplification. The PCR cycling parameters were as follows: 90 ◦ C for 5 min, 40 cycles of 30 s denaturation at 95 ◦ C, 30 s annealing at 55 ◦ C for gyrA and 48.7 ◦ C for parC, 30 s extension at 72 ◦ C followed by a final extension step of 72 ◦ C for 10 min. PCR products were prepared for sequencing using the high pure PCR product purification kit (Roche) according to manufacturer’s instructions. DNA templates (3–10 ng for gyrA sequencing and 5–20 ng for parC sequencing) were mixed with the relevant sequencing primer at a final concentration of 3.2 pmol in a 20 l reaction containing Big Dye terminator mix (Applied BioSystems). pbp5 gene mutations detected in ampicillin-resistant isolates Ampicillin-resistant isolates were screened for mutations in pbp5 gene using 5 CGGGATCTCACAAGAAGAT3 forward primer and 5 TTATTGATAATTTTGGTT3 reverse primer [44]. PCR reaction and cycling parameters were used as described for the gyrA and parC genes using 52 ◦ C as the primer annealing temperature. Gene sequencing and analysis was performed as described earlier.
Statistical analysis The Chi Square (2 ) test was performed to determine whether there was a correlation between the presence of virulence genes and antibiotic resistance genes for all E. faecalis and E. faecium isolates using PASW Statistics 18. A p-value
