Plant Cell Rep (2006) 25: 112–116 DOI 10.1007/s00299-005-0033-1
GENETIC TRANSFORMATION AND HYBRIDIZATION
Mrudul V. Shirgurkar · Vaishali B. Naik · Sara von Arnold · Rajani S. Nadgauda · David Clapham
An efficient protocol for genetic transformation and shoot regeneration of turmeric (Curcuma longa L.) via particle bombardment Received: 14 March 2005 / Revised: 14 June 2005 / Accepted: 28 June 2005 / Published online: 6 January 2006 C Springer-Verlag 2005
Abstract Turmeric (Curcuma longa L.) is an important spice crop plant that is sterile and cannot be improved by conventional breeding. An efficient method for stable transformation for turmeric, C. longa L., was developed using particle bombardment. Callus cultures initiated from shoots were bombarded with gold particles coated with plasmid pAHC25 containing the bar and gusA genes each driven by the maize ubiquitin promoter. Transformants were selected on medium containing glufosinate. Transgenic lines were established on selection medium from 50% of the bombarded calluses. Transgenic shoots regenerated from these were multiplied and stably transformed plantlets were produced. Polymerase chain reaction (PCR) and histochemical GUS assay confirmed the stable transformation. Transformed plantlets were resistant to glufosinate. Key words Curcuma longa L. . Glufosinate . Particle bombardment . Stable transformation . Transgenic plantlets . Turmeric Introduction Curcuma longa L., commonly known as turmeric, is a tropical perennial herb belonging to the family Zingiberaceae (Purseglove 1972). It is mainly cultivated in India, Pakistan, Sri Lanka, Bangladesh, and China. India is the largest producer and a major exporter of this spice. Turmeric powder is obtained from its boiled, dried and polished underground rhizomes. It is used to add flavor and color to the food. Its
bright yellow color is due to the presence of curcumin pigment which is a strong antioxidant. Turmeric is a certified natural food color and also used as a dye to color cotton and silk. It has several uses in traditional medicine as it is a stomachic, blood purifier, tonic and antiseptic (John et al. 1997). Chattopadhyay et al. (2004) reviewed the biological actions and medicinal applications of turmeric and curcumin. Turmeric is a rarely flowering, sterile triploid plant, 2n = 3x = 63, (John et al. 1997). There is essentially no seed set. The plant is propagated vegetatively through its underground rhizomes. Improvement of this crop through conventional breeding is therefore difficult (Shirgurkar et al. 2001). Selection of desirable genotypes with higher yield, curcumin content, disease and insect/pest resistance, adaptability etc. can be employed for development of new cultivars; but these selection methods are limited to mutants arising during vegetative propagation (Salvi et al. 2001). Nadgauda and Mascarenhas (1986) reported a method for screening for high curcumin content in turmeric cultivars in vitro. Somaclonal variation, mutation breeding and induction of polyploidy have proved to be useful tools in plant breeding. Today, genetic engineering can be used for the production of plants with desirable traits in several crops and is particularly attractive to apply to species with little genetic variation such as turmeric. At present no such gene transfer system is reported for turmeric. In the present paper we report an efficient method for regeneration of stably transformed plants via particle bombardment of callus and selection towards resistance to the herbicide, glufosinate.
Communicated by L. C. Fowke M. V. Shirgurkar · V. B. Naik · R. S. Nadgauda () Tissue Culture Pilot Plant, National Chemical Laboratory, Dr. Homi Bhabha Road, Pashan Pune, 411008, India e-mail:
[email protected]
Materials and methods
S. von Arnold · D. Clapham Department of Forest Genetics, Swedish University of Agricultural Sciences, Box 7027, S-750 07 Uppsala, Sweden
Sprouting buds from mature rhizomes of C. longa L. were surface sterilized and used to initiate shoot cultures (Nadguada et al. 1978; Shirgurkar et al. 2001). All media were based on MS basal medium (Murashige and Skoog
Plant material
113
1962) with pH adjusted to 5.8 before autoclaving. Multiple shoots were obtained in liquid multiplication medium composed of MS basal medium containing 2.2 µM 6benzylaminopurine, 0.93 µM kinetin, 5% (v/v) coconut water and 2% sucrose (Nadgauda et al. 1978). The shoots were incubated at 25 ± 2 ◦ C in 16 h light/8 h dark cycles. The light intensity was 11.7 µmol m−2 s−1 . The shoots were used for establishing callus cultures. The tips of the shoots were cut longitudinally and incubated on callus medium composed of MS basal medium containing 27 µM naphthaleneacetic acid, 3% sucrose, and 0.2% gelrite. The cultures were incubated in the dark at 25 ± 2 ◦ C and subcultured every 3–4 weeks.
acetone for 30 min. Acetone was removed and tissue was rinsed with phosphate buffer pH 7.2 (0.05 M KH2 PO4 , 0.05 M K2 HPO4 , 0.05 M EDTA, 0.5 mM K3 FeCN6 and 0.5 mM K4 FeCN6 ) and then immersed in 5-bromo-4chloro-3-indolyl-β-d-glucuronide (10 mg ml−1 ) solution, with vacuum infiltration for 4 min. The tissue was incubated overnight at 37 ◦ C. After incubation, the tissue was washed with 70% alcohol and observed for the presence of blue coloration in the tissue. Callus was GUS-stained one day after bombardment. Later, leaf tips of the shoots regenerated from the same callus after 4 months of incubation on selection medium were GUS-stained. The plants developed in multiplication medium were also tested for the presence of GUS activity.
Gene transfer Gold particles (1.5–3.0 µm diameter) were coated with plasmid pAHC25 (Christensen and Quail 1996) containing the bar gene and the gus A reporter gene each fused between the maize ubiquitin promoter and the nos terminator, as described in Clapham et al. (2000). Three-week-old callus pieces (approximate weight 150–200 mg) were transferred to a petri dish and bombarded with a particle inflow gun (Clapham et al. 2000). In some cases the callus was soaked in liquid MS basal medium containing 0.25 M inositol for 2 h before bombardment. Selection of transformants The bombarded callus was placed on fresh callus medium and incubated in the dark at 25 ± 2 ◦ C for 3 days. The cultures were then transferred to selection medium, i.e., callus medium containing 1 mg l−1 Basta (filter sterilized and added aseptically) as selection agent for transformed cells. Basta is a commercial preparation (Hoechst Ltd.) of ammonium glufosinate, 200 g l−1 . The cultures were subcultured on fresh selection medium at regular intervals of 4 weeks and incubated in the dark. Multiple shoot formation from transformed tissue
DNA extraction and polymerase chain reaction (PCR) Total high molecular weight genomic DNA was isolated from young leaf tissue using the CTAB method as described by Doyle and Doyle (1990) except that β-mercaptoethanol was omitted. Primer pairs to PCR amplify a 603 bp fragment of the gusA gene were, gus1, 5 TTGGCAAGTGGTGAATCCGCA 3 and gus2, 5 AGTTTAGGCGTTGCTTCCGCC 3 . The reaction mixture was 2 µl of 10× PCR buffer, 1 U Taq DNA polymerase (MBI, Fermentas), 2 pmol of each primer, 2 mM dNTPs and autoclaved MilliQ water to make final volume 20 µl. The thermal profile of the reaction was: initial denaturation at 94 ◦ C for 2 min, 35 cycles of 92 ◦ C for 30 s, 58 ◦ C for 30 s, 72 ◦ C for 30 s, and finally 72◦ C for 4 min. To amplify a 195 bp fragment of the nos terminator, the procedure was as before except that the primers were nos1: 5 GAATCCTGTTGCCGGTCTTG 3 and nos2: 5 TTATCCTAGTTTGCGCGCGCTA 3 , and the annealing temperature was 62 ◦ C. After PCR, the amplified products were separated by electrophoresis in 1.5% agarose gels (for products amplified with gusA primers) and in 2% agarose (for products amplified with nos primers). Basta tolerance test
After the 5th subculture on selection medium, the callus cultures with regenerating shoots were transferred to Erlenmeyer flasks containing liquid shoot multiplication medium and incubated at 25 ± 2 ◦ C in 16 h light/8 h dark cycles. The light intensity was 11.7 µmol m−2 s−1 . These cultures were maintained on multiplication medium by regular subculture every month for seven subcultures. Rooted shoots were planted in a glass jar (20 cm × 12 cm diameter) containing moist sand soil 1:1 mixture. The jars were covered with polypropelene screw cap lid and incubated in diffused light.
Basta solution (0, 1, 10, 50, 100, 200, 500 mg l−1 ) was sprayed on untransformed turmeric plants to test their natural tolerance level. Basta solution of 100, 200 and 500 mg l−1 concentrations was aseptically sprayed on transgenic plantlets under in vitro conditions.
Histochemical GUS assay for transient and stable transformation
The shoot tips along with the leaf bases showed callus formation within 15 days of incubation on callus medium (Fig. 1a). Regular subculture on callus medium stimulated callus growth and shoot differentiation. Shoots were removed and only callus was subcultured.
For histochemical detection of β-glucuronidase (GUS) activity (Jefferson 1987) the tissue was immersed in ice-cold
Results and discussion Establishment of callus cultures
114
Fig. 1 Regeneration of transgenic plantlets Curcuma longa L. a Callus derived from a shoot tip after 3 weeks on callus medium; bar 1.6 mm. b Transient GUS expression in callus 1 day after bombardment; bar 0.05 mm. c Regenerating shoots after 8 weeks on selection medium; bar 8.3 mm. d Transgenic plantlet growing on multiplica-
tion medium for 2 weeks showing GUS expression; bar 1.6 mm. e Transgenic plantlets 4 weeks old growing on multiplication medium; bar 18 mm. f Transgenic plantlets growing for 4 weeks in sand/soil mixture; bar 18.4 mm
Transient GUS expression
lus pieces turned yellowish to brown within 30 days of incubation. From 20 of the callus pieces, new calluses were formed on selection medium. These were kept on selection medium for 5 months. During this period on average 4–6 shoots regenerated from each callus (Fig. 1c). We assume that all shoots from the same callus originated from the same transformation event, constituting a transgenic line. However, detailed genetic analysis is required for final proof. The clusters of shoots were then transferred to multiplication medium and maintained by regular subculture on multiplication medium (Fig. 1e). From each shoot four to eight new shoots developed within a month. The shoot aggregates were therefore divided at each subculture. On average 95% of the shoots had differentiated roots. Rooted plantlets were transferred to glass jars containing sand:soil mixture (Fig. 1f). Thousands of plants could be regenerated from each transgenic line over 7 months. The multiplication rate for the transgenic lines was similar to that for the control lines (Nadgauda et al. 1978). Compared with the transformation efficiency obtained for Colocasia esculenta (Fukino et al. 2000) and for Cynodon dactylon (Li and Qu 2004), the transformation and regeneration efficiency
Proliferating callus cultures were bombarded and transient expression of the gusA reporter gene was estimated by histochemical staining after one day (Fig. 1b). Up to four blue GUS foci were seen per 150–200 mg callus piece, on average 1.0. Osmotic treatments often greatly enhance transient expression (e.g. Clapham et al. 2000), so experiments were performed where the calluses were pretreated in higher osmoticum. Surprisingly, no increase in transient expression was observed, hence osmotic treatment was omitted. Selection and multiplication of transformants Non-transformed calluses were initially cultured on media containing 0–5 mg l−1 of Basta. Growth was significantly reduced at 0.25 and 0.5 mg l−1 and inhibited at higher concentrations (data not shown). Based on these results, we have used 1 mg l−1 for selection. A total of 40 callus pieces were bombarded for stable transformation. After transfer to selection medium the cal-
115
reduced the normal growth of the plants. The transformed plants could tolerate up to 100 mg l−1 concentration of Basta.
Conclusion Biotechnological approaches such as gene transfer for disease resistance and pest resistance offer opportunities for rapid improvement of plants. However, the availability of an in vitro regeneration system is a prerequisite for effective genetic transformation. In this work, we have shown that 50% of the bombarded calluses of turmeric give rise to transgenic calluses on selection medium. On average five shoots per callus differentiate on selection medium. When transferred to multiplication medium the shoots multiply with a factor of 4–8 each month. These results show that callus culture is an efficient system for biolistic transformation in turmeric. Therefore, the protocol reported here is highly important for gene transfer in turmeric for which conventional breeding is impossible owing to its sterile nature. In the future, the protocol can be exploited to introduce desired genes into the turmeric genome. Fig. 2 PCR analysis of leaves from regenerated shoots. a PCR using primers specific for gusA and b with nos terminator. The PCR products were separated by agarose gel electrophoresis. Lane M, F X 174/Hae III DNA molecular weight marker; lanes 1–7, DNA from transformed regenerated turmeric plantlets; lane 8, DNA from untransformed control turmeric plantlet
of turmeric is very high. Our results strengthen the importance of a robust regeneration system before introducing genetic engineering. Characterization of the putative stable transformants The presence of the gusA gene and the nos terminator was confirmed by PCR analysis of seven shoots representing seven different transgenic lines. The expected 603 bp band for gusA and 195 bp band for the nos terminator were amplified from the putatively transformed shoots, but not from the unbombarded control shoots (Fig. 2a and b). All calluses growing on selection medium showed GUS activity after histochemical staining, the unbombarded control callus being negative (data not shown). It appears that escapes are highly infrequent with the current procedure. Leaf tips of 20 regenerated shoots from different transgenic lines growing on selection medium were tested for histochemical GUS staining and found positive (data not shown). Histochemical GUS assays performed on the putatively transformed plants after 5 (Fig. 1d) and 7 months on multiplication medium continued to be GUS-positive. Shoots and roots from the unbombarded control plants showed no GUS activity as judged by histochemical staining. Basta-sprayed control plants could tolerate Basta concentrations up to 10 mg l−1 . Higher concentrations of Basta
Acknowledgments The work was supported by SIDA (Swedish International Development Agency), Sweden, and by DBT (Department of Biotechnology), India. The help rendered by Dr. Sujata Bhargava, Department of Botany, University of Pune, during the course of work is acknowledged.
References Chattopadhyay I, Biswas K, Bandyopadhyay U, Banerjee RK (2004) Turmeric and curcumin: Biological actions and medicinal applications. Curr Sci 87(1):44–53 Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgen Res 5:213– 218 Clapham D, Demel P, Elfstrand M, Koop HU, Sabala I, von Arnold S (2000) Gene transfer by particle bombardment to embryonic cultures of Picea abies and the production of transgenic plantlets. Scand J For Res 15:151–160 Fukino N, Hanada K, Ajisaka H, Sakai J, Hirochika H, Hirai M, Hagio T, Enomoto S (2000) Transformation of Taro (Colocasia esculenta Schott) using particle bombardment. JARQ-Jpn Agric Res Quart 34:159–165 Doyle J, Doyle J (1990) Isolation of plant DNA from fresh tissue. Focus 12:13–15 Jefferson RA (1987) Assaying chimeric plant genes: The GUS fusion system. Plant Mol Biol Rep 5:387–405 John CK, Nadgauda RS, Mascarenhas AF (1997) Turmeric. In: Tissue culture of economic plants. Center for Science and Technology of the Non-Aligned and Other Developing Countries, New Delhi, pp 191–209 Li L, Qu R (2004) Development of highly regenerable callus lines and biolistic transformation of turf-type common bermudagrass [Cynodon dactylon (L) Pers.]. Plant Cell Rep 22:403– 407 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:437–497
116 Nadgauda RS, Mascarenhas AF, Hendre RR, Jagannathan V (1978) Rapid multiplication of turmeric (Curcuma longa Linn.) plants by tissue culture. Indian J Exp Biol 16:120–122 Nadgauda RS, Mascarenhas AF (1986) A method for screening high curcumin-containing turmeric (Curcuma longa L.) cultivars in vitro. J Plant Physiol 124:359–364 Purseglove JW (1972) Curcuma domestica Val. In: Tropical crops: Monocotyledons 2. Longman, London, pp 522–528
Salvi ND, George L, Eapen S (2001) Plant regeneration from leaf base callus of turmeric and random amplified polymorphic DNA analysis of regenerated plants. Plant Cell Tissue Org Cult 66:113–119 Shirgurkar MV, John CK, Nadgauda RS (2001) Factors affecting in vitro microrhizome production in turmeric. Plant Cell Tissue Org Cult 64:5–11
