Biomaterials 30 (2009) 1098–1112
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
A three-dimensional model of vasculogenesis Mani T. Valarmathi a, *, Jeffrey M. Davis a, Michael J. Yost b, Richard L. Goodwin a, Jay D. Potts a a b
Department of Cell and Developmental Biology and Anatomy, School of Medicine, University of South Carolina, Columbia, South Carolina 29209, USA Department of Surgery, School of Medicine, University of South Carolina, Columbia, South Carolina 29209, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 August 2008 Accepted 26 October 2008 Available online 22 November 2008
Postnatal bone marrow contains various subpopulations of resident and circulating stem cells (HSCs, BMSCs/MSCs) and progenitor cells (MAPCs, EPCs) that are capable of differentiating into one or more of the cellular components of the vascular bed in vitro as well as contribute to postnatal neo-vascularization in vivo. When rat BMSCs were seeded onto a three-dimensional (3-D) tubular scaffold engineered from topographically aligned type I collagen fibers and cultured either in vasculogenic or non-vasculogenic media for 7, 14, 21 or 28 days, the maturation and co-differentiation into endothelial and/or smooth muscle cell lineages were observed. Phenotypic induction of these substrate-grown cells was assayed at transcript level by real-time PCR and at protein level by confocal microscopy. In the present study, the observed upregulation of transcripts coding for vascular phenotypic markers is reminiscent of an in vivo expression pattern. Immunolocalization of vasculogenic lineage-associated markers revealed typical expression patterns of vascular endothelial and smooth muscle cells. These endothelial cells exhibited high metabolism of acetylated low-density lipoprotein. In addition to the induced monolayers of endothelial cells, the presence of numerous microvascular capillary-like structures was observed throughout the construct. At the level of scanning electron microscopy, smooth-walled cylindrical tubelike structures with smooth muscle cells and/or pericytes attached to its surface were elucidated. Our 3-D culture system not only induces the maturation and differentiation of BMSCs into vascular cell lineages but also supports microvessel morphogenesis. Thus, this unique in vitro model provides an excellent platform to study the temporal and spatial regulation of postnatal de novo vasculogenesis, as well as attack the lingering limit in developing engineered tissues, that is perfusion. Ó 2008 Elsevier Ltd. All rights reserved.
Keywords: Bone marrow stromal cells Mesenchymal stem cells Vasculogenesis Angiogenesis Vascular tissue engineering
1. Introduction Vasculogenesis is the process of blood vessel formation occurring by a de novo production of endothelial cells in an embryo (primitive vascular network) or a formerly avascular area when endothelial precursor cells (angioblasts, hemangioblasts, or stem cells) migrate and differentiate in response to local cues (such as growth factors and extra cellular matrix) to form new intact blood vessels [1], whereas angiogenesis refers to the sprouting of new blood vessels from the differentiated endothelium of pre-existing vessels. These vascular trees or plexuses are then pruned, remodeled and extended through angiogenesis to become larger caliber vessels [2]. The identification of bone-marrow-derived (hematopoietic and non-hematopoietic stem cells) and non-bone-marrow-derived
* Corresponding author. Building 1 Room B-60, 6439 Garners Ferry Road, Department of Cell and Developmental Biology and Anatomy, School of Medicine, University of South Carolina, Columbia, South Carolina 29209, USA. Tel.: þ1 803 733 3294; fax: þ1 803 733 3212. E-mail address:
[email protected] (M.T. Valarmathi). 0142-9612/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2008.10.044
(tissue-resident stem/progenitor cells – adipose, neural, heart, skeletal muscle; peripheral and cord blood-derived stem cells) endothelial progenitors cells (EPCs) has led to the realization of potential postnatal vasculogenesis [3]. Previous reports indicate that adult bone-marrow-derived mesenchymal stem cells (BMSCs/ MSCs) and multipotent adult progenitor cells (MAPCs) can be differentiated into endothelial-like cells in vitro and contribute to neoangiogenesis in vivo [4–6], and are readily available. In addition, BMSCs can augment collateral remodeling and perfusion in ischemic models through paracrine mechanisms rather than by cellular incorporation upon local delivery [7]. For these reasons, embryonic, fetal and postnatal stem cells, as well as various types of endothelial progenitor cells, can be a potential cellular source for vascular tissue engineering [8]. However, the source for these early-stage developmental cells is problematic. Unlike embryonic stem cells (ES), obtaining autologous bone-marrow-derived stromal cells is feasible and can potentially be exploited to develop tissue-engineered blood vessel constructs for therapeutic purposes. Similarly, repeated isolation and rapid in vitro expansion of sufficient yield of autologous and/or allogenic non-bone-marrow-derived resident stem cells/progenitors, especially from vital organs for routine therapeutic purposes
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
are highly constrained. On the contrary, to a certain extent autologous and/or allogenic bone-marrow-derived BMSCs are amenable for repeated isolation and rapid in vitro expansion from the patients. Extracellular molecules initiate biological signals and play a critical role in the control of cellular proliferation, differentiation, and morphogenesis. Many parameters, such as the presence and amount of soluble factors such as hormones, growth factors, and cytokines or the insoluble factors such as the physical configuration of the matrix, which mediate the cell-cell and cell-matrix interactions, exert strong influence on the success of angiogenic processes in vitro and presumably in vivo [9,10]. The likelihood and ultimate success of in vitro cellular differentiation depends on how closely the cell-matrix relationship mimics that found during normal development or regeneration. In vascular tissue engineering, the application of these principles in vivo will be important to ensure that the matrix/scaffold to be implanted can support endothelial cell proliferation and migration resulting in endothelial tube formation [11]. The vital issue for realistic clinical application is whether these scaffolds with preformed endothelial tubes can survive implantation into tissue defects and subsequently be able to anastomose to the host vasculature [10]. We therefore hypothesized that under appropriate in vitro physicochemical microenvironmental cues (combination of growth factors and ECM) multipotent adult BMSCs could be differentiated into vascular endothelial and smooth muscle cell lineages. To test this hypothesis, we characterized the intrinsic vasculogenic differentiation potential of adult BMSCs when seeded onto a threedimensional (3-D) tubular scaffold engineered from aligned type I collagen strands and cultured in both vasculogenic and non-vasculogenic growth media. In these culture conditions, BMSCs differentiated and matured into both endothelial and smooth muscle/pericyte cell lineages and showed microvascular morphogenesis. We also explored the potential of the 3-D model system to undergo postnatal de novo vasculogenesis. Our results indicate that the 3-D tubular scaffold with its unique characteristics provides a favorable microenvironment that permits the development of in situ microvascular structures. Moreover, this is the first report that explicitly demonstrates that adult BMSCs under appropriate in vitro environmental cues can be induced to undergo vasculogenic differentiation culminating in microvessel morphogenesis. Our model recapitulates many aspects of in vivo de novo vasculogenesis. Thus, this unique culture system provides an in vitro model to investigate the maturation and differentiation of BMSC-derived vascular endothelial and smooth muscle cells in the context of postnatal vasculogenesis. In addition, it allows us to elucidate various molecular mechanisms underlying the origin of both endothelial and smooth muscle cells and especially to gain a deeper insight and validate the emerging concept of ‘one cell and two fates’ hypothesis of vascular development [12]. 2. Materials and methods 2.1. Fabrication of tubular scaffold The 3-D collagen type I tube served as a scaffold on which rat BMSC differentiation cultures were carried out. The details of the production and properties of the collagen tubes have previously been described [13]. Briefly, a 25 mg/ml solution of bovine collagen type I was extruded with a device that contained two counterrotating cones. The liquid collagen was fed between the two cones and forced through a circular annulus in the presence of an NH3-air (50–50 vol/vol) chamber. This process results in a hollow cylindrical tube of aligned collagen fibrils with an inner central lumen. The dimensions of tubes produced for this set of experiments had a length of 30 mm with a luminal diameter of 4 mm and an external diameter of 5 mm, leaving a wall thickness of 1 mm. The collagen tubes had a defined fiber angle of 18 relative to the central axis of the tube and had pores ranging from 1 to 10 mm. The rationale for the particular orientation of collagen fiber was based on our previous work on cardiovascular tissue engineering [13], when proepicardial (PE) cells were seeded onto this scaffold; they underwent maturation and differentiation
1099
and produced elongated vessel-like structures reminiscent of an in vivo-like phenotype [14]. The tubes were sterilized using gamma radiation 1200 Gy followed by Stratalinker UV crosslinker 1800 (Stratagene) and then placed in Moscona’s solution (in mM: 136.8 NaCl, 28.6 KCl, 11.9 NaHCO3, 9.4 glucose, 0.08 NaH2PO4, pH 7.4) (Sigma–Aldrich) containing 1 ml/ml gentamicin (Sigma–Aldrich) and incubated in 5% CO2 at 37 C until cellular seeding. 2.2. BMSCs isolation, expansion and maintenance (nonclonal BMSCs culture) The procedures were performed in accordance with the guidelines for animal experimentation by the Institutional Animal Care and Use Committee, School of Medicine, University of South Carolina. Rat BMSCs were isolated from the bone marrow of adult 300 g Sprague DawleyÒÔ SDÒÔ rats (Harlan Sprague Dawley, Inc.). Briefly, after deep anesthesia, the femoral and tibial bones were removed aseptically and cleaned extensively to remove associated soft connective tissues. The marrow cavities of these bones were flushed with Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen) and combined. The obtained marrow plugs were triturated, and passed through needles of decreasing gauge (from 18 gauge to 22 gauge) to break up clumps and cellular aggregates. The resulting single-cell suspensions were centrifuged at 200 g for 5 min. Nucleated cells were counted using a Neubauer chamber. Cells were plated at a density of 5 106 2 107 cells per T75 cm2 flasks in basal media composed of DMEM supplemented with 10% fetal bovine serum (FBS, lotselected; Hyclone), gentamicin (50 mg/ml) and amphotericin B (250 ng/ml) and incubated in a humidified atmosphere of 5% CO2 at 37 C for 7 days. The medium was replaced, and changed three times per week until the cultures become w70% confluent (between 12 and 14 days). Cells were trypsinized using 0.05% trypsin-0.1% EDTA and re-plated at a density of 1 106 cells per T75 cm2 flasks. After three passages, attached marrow stromal cells were devoid of any non-adhering population of cells. 2.3. Clonal BMSCs culture Single-cell suspensions of BMSCs prepared as described above were plated in 150 mm 20 mm Petri dishes at a low density of 1–4 103 nucleated cells/cm2. After 24 h of incubation, the cultures were thoroughly washed with complete DMEM to remove nonadherent cells. The cultures were continued as described above for 12–14 days. Colonies that were well defined and separated from neighboring colonies were washed with Moscona’s solution, pH 7.4 and individual colonies were isolated using cloning cylinders (Sigma–Aldrich). Cells were trypsinized and re-plated onto individual wells of a six-well culture plates. At approximately 80% confluency, the subcultured cells were transferred to T25 cm2 followed by T75 cm2 (passage 3) flasks and expanded to confluency. 2.4. Phenotypic characterization of BMSCs by flow cytometry and confocal microscopy Qualitative evaluation for various cell surface markers was performed on cells grown in the Lab-tekÔ chamber slide systemÔ (Nunc) using a Zeiss LSM 510 Meta confocal scanning laser microscope (Carl Zeiss, Inc.) and quantitative analysis of the same set of markers was performed by single-color flow cytometry using a CoulterÒ EPICSÒ XLÔ Flow Cytometer (Beckman Coulter, Inc.). Briefly, the passage 3 maintained BMSCs were trypsinized, pelleted at 200 g for 5 min and washed twice with Moscona’s solution, pH 7.4. Cells were re-suspended in staining buffer (1.5% bovine serum albumin in PBS, pH 7.4) (BSA, Sigma–Aldrich) and incubated for 30 min at 4 C with appropriate dilutions of FITC-conjugated mouse anti-rat CD11b, CD31, CD44, CD45, CD90 and OX43 monoclonal antibodies for direct immunostaining (Table 1). Similarly, the cells were incubated with FITC-unconjugated mouse anti-rat CD34, CD73, CD106, Flk1, VE-cadherin, a-SMA, calponin and rabbit anti-rat Flt1 monoclonal antibodies followed by incubation with appropriate FITC-conjugated anti-mouse or, anti-rabbit secondary antibodies for indirect immunostaining (Table 1). Cells were briefly permeabilized in PBS, pH 7.4 containing 0.1% Triton X-100 (Sigma–Aldrich) and 0.5 mM glycine (Sigma–Aldrich) at 4 C for the intracellular staining of a-SMA and calponin. FITC-labeled mouse anti-rat-IgGs and FITC-labeled rabbit anti-rat-IgG antibodies served as the isotype controls. The stained cells were washed twice with Moscona’s solution and either acquired immediately or fixed in ice-cold 0.5% paraformaldehyde (Sigma–Aldrich) and stored in the dark at 4 C until acquired in flow cytometry. The obtained data were analyzed using Expo32 ADC software (Beckman Coulter, Inc.). 2.5. Purification and enrichment of BMSCs by magnetic cell sorting Passage 3 adherent populations of BMSCs were further purified by indirect magnetic cell labeling method using an autoMACSÔ Pro Separator (Miltenyi Biotech). The cells were subjected to CD90 positive selection by incubating the cells with FITC-labeled anti-CD90 antibodies (BD Pharmingen), followed by incubation with anti-FITC magnetic microbeads (Miltenyi Biotech), and passed through the magnetic columns as per the manufacturer’s instructions. The resultant enriched CD90þ/CD34/CD45 fractions were expanded by subcultivation and subjected to flow cytometric analysis.
1100
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
Table 1 Primary antibodies used in this study. Primary Antibodies
Dilutions
BMSCs characterization markers CD11b 1:50 CD31 1:10 CD44 1:10 CD45 1:50 CD73 1:50 CD90 1:50 CD106 1:50 OX43 1:10
Source
Cell Target
BD Pharmingen Abcam Gene Tex, Inc BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen Gene Tex, Inc
Leukocytes Endothelial Leukocytes Hematopoietic BMSCs BMSCs Endothelial Endothelial
Endothelial cell differentiation markers CD34 1:100 Santa Cruz Biotechnology Flt-1 1:100 Santa Cruz Biotechnology Flk-1 1:100 Santa Cruz Biotechnology VE-cadherin 1:100 Santa Cruz Biotechnology Pecam1 1:100 Santa Cruz Biotechnology Vwf 1:100 Santa Cruz Biotechnology Tomato lectin 1:50 Vector Laboratories Fibronectin 1:200 Abcam
Endothelial Endothelial Endothelial Endothelial Endothelial Endothelial Endothelial Endothelial
Smooth muscle cell differentiation markers a-SMA 1:100 Sigma–Aldrich Calponin 1:5000 Sigma–Aldrich
Smooth Muscle Smooth Muscle
30 s at 56 C, and 30 s at 72 C. Data collection was enabled at 72 C in each cycle. CT (threshold cycle) values were calculated using the MyiQ optical system software, version 2.0. The calibrator control included passage 4 BMSCs day 0 sample and the target gene expression was normalized by a non-regulated reference gene expression, Gapdh. The mathematical model previously described in detail [16], was used to determine the expression ratio of genes. 2.8. Immunofluorescence staining and confocal microscopy Collagen tube cultures were collected at day 7, 14, 21 or 28 and processed according to previously described protocols [17]. After incubation, the tubes were rinsed twice in Moscono’s solution, pH 7.4 and fixed in 2% paraformaldehyde at 4 C for 12–16 h. Each of the samples was then permeabilized in PBS, pH 7.4 containing 0.1% Triton X-100 and 100 mM glycine for 30–40 min at room temperature and blocked in 1.5% BSA, 0.5 mM glycine in PBS for 1 h at room temperature. The primary antibodies used are shown in Table 1. Primary antibodies were used at 1:100 to 1:5000 dilutions in blocking buffer for 12–16 h at 4 C. Secondary antibodies (Alexa fluorÒ 488, 546, 633 obtained from Molecular Probes, Invitrogen) were used at 1:100 dilutions in blocking buffer for 2 h at room temperature in the dark. Lycopersicon esculentum (tomato) lectin (1:50 in 10 mM N-2-hydroxyethylpiperazine-N0 -2-ethanesulfonic acid, pH 7.5; 0.15 M NaCl) was used to identify endothelial cells. Alexa fluorÒ 488, 546, 633 or rhodamine phalloidin (1:200 in PBS) were used to stain filamentous actin. Nuclei were stained with DAPI (4,6-diamidino-2-phenylindole, 100 ng/ml; Sigma–Aldrich). Images of the collagen tubular constructs were visualized using a confocal microscope (Zeiss LSM 510 Meta CSLM). Negative control for staining included only secondary antibodies. 2.9. Dil-Ac-LDL uptake
2.6. BMSCs vasculogenic differentiation Passage 4 expanded and maintained CD90þ BMSCs were seeded inside the lumen of the hollow cylindrical collagen-gel tubes at a density of 0.5 106 cells/ 30 mm tube and cultured either in mesenchymal stem cell growth medium supplemented with 10% FBS, penicillin and streptomycin (PoieticsÒ MSCGMÔ BulletKitÒ; Lonza Ltd.) or microvascular endothelial cell growth medium (CloneticsÒ EGMÒ-MV Bullet KitÒ; Lonza Ltd.) supplemented with 5% FBS, bovine brain extract, human epidermal growth factor (hEGF), hydrocortisone, amphotericin B and gentamicin for 7, 14, 21 and 28 days. In addition, BMSCs were seeded in 65 mm Petri dishes at a density of 3 103 cells/cm2 and cultured in non-vasculogenic (MSCGM) or vasculogenic (EGMMV) media for 7, 14, 21 and 28 days. The cultures were terminated at these regular intervals and the samples were subjected to RT-qPCR, immunofluorescence, ultrastructural, and biochemical analyses.
To identity the endothelial cells based on their increased uptake and metabolism of Ac-LDL, the low-density lipoprotein (LDL) uptake assay was performed using DilAc-LDL (1,10 -dioctadecyl-3,3,30 ,30 -tertamethylindocarbocyanine-labeled acetylated low-density lipoprotein) staining kit (Biomedical Technologies, Inc.) according to manufacturer’s recommendations. Briefly, the tube cultures at various time points (7, 14, 21 or 28 days) maintained under vasculogenic and non-vasculogenic differentiation conditions were incubated with complete medium containing 10 mg/ml Dil-Ac-LDL for 4–6 h in 5% CO2 at 37 C [18]. Subsequently, the tubes were rinsed several times with PBS, pH 7.4 and fixed in 2% paraformaldehyde for 20 min at room temperature. Alexa 488 phalloidin (1:200 in PBS) was used to stain filamentous actin. Nuclei were stained with DAPI (100 ng/ml). The images of Dil-labeled endothelial cells were obtained using a Zeiss LSM 510 Meta CSLM. 2.10. Scanning electron microscopic (SEM) analysis of tubular constructs
2.7. Real-time polymerase chain reaction Total cellular RNA extraction from three independent collagen tube cultures maintained both in non-vasculogenic (MSCGM) and vasculogenic (EGMMV) media were performed using TRIzolÒ Plus RNA purification kit (Invitrogen) according to manufacturer’s instructions. The quality and quantity of the obtained RNA was analyzed on the Agilent 2100 Bioanalyzer using the Agilent RNA 6000 nano kit (Agilent Technologies, Inc.) according to manufacturer’s instructions. The reverse transcriptase (RT) reaction was performed using 500 ng of total RNA in a final reaction volume of 20 ml using an iScriptÔ cDNA synthesis kit (Bio-rad Laboratories) according to manufacturer’s recommendations. Gene-specific primers for platelet/ endothelial cell adhesion molecule 1 (Pecam1), kinase insert domain protein receptor (Kdr/Flk1/Vegfr2), tyrosine kinase with immunoglobulin-like and EGF-like domains 1 (Tie1), endothelial-specific receptor tyrosine kinase (Tek/Tie2) and von Willebrand homology (vWF) and; the calibrator reference gene, glyceraldehyde-3phosphate dehydrogenase (Gapdh) were designed using web based software Primer3 [15], synthesized commercially (Integrated DNA Technologies, Inc.), and evaluated for an annealing temperature of 56 C as shown in Table 2. Real-time PCR conditions were optimized as described previously [14]. All RTqPCRs were performed with SYBR Green I chemistry in a MyiQÔ single-color realtime PCR detection system (Bio-rad Laboratories). For qPCRs, iQ5 SYBR Green I supermix, 3 pmol/ml of each forward and reverse primers, and 5 ml cDNA template were used in a final reaction volume of 50 ml. PCR cycling parameters included an initial denaturation of 8 min and 45 s at 95 C followed by 45 cycles of 30 s at 95 C,
To visualize the formation and organization of the vessel-like structures in the tubular construct, day 28 samples were processed for scanning electron microscopy (SEM) by the O-GTA-O-GTA-O method [19]. In brief, the tubular scaffolds that were maintained in vasculogenic and non-vasculogenic culture conditions were dissected longitudinally and rinsed twice in PBS, pH 7.4. The tubes were then fixed in 2.5% glutaraldehyde (Sigma–Aldrich) in 0.1 M sodium cacodylate buffer, pH 7.4 (Sigma– Aldrich) overnight at 4 C, rinsed in buffer, and immersed in 2% aqueous OsO4 for 2 h. After rinsing, samples were treated with two rounds of GTA-O steps: three 4 h treatments with 8% glutaraldehyde-2% tannic acid at 4 C, followed by rinsing and 2 h treatment with 2% OsO4. Tubes were then dehydrated in graded ethanols, critical point dried and mounted on aluminum stubs. The surface layers of tube constructs were examined using JSM 6300 scanning electron microscope (Tokyo, Japan) operated at 10 kV. Images were captured using JEOL Vision 98 Control Console, Version 1.25 software (Tokyo, Japan). 2.11. Statistical analysis RT-qPCR data were represented as mean standard error of the mean (mean SEM). Differences in expression (vasculogenic markers) between control (day 0) and treated samples (day 7, 14, 21 and 28) were assessed in group means for statistical significance by applying ‘Pair Wise Fixed Reallocation Randomization Test’ using Relative Expression Software Tool (RESTÓ) [20]. Values of p < 0.05 were considered statistically significant.
Table 2 RT-qPCR primer sequences used in this study. Genes
Forward Primer
Reverse Primer
Product Length (bp)
Annealing Temperature ( C)
GenBank Accession No
Pecam1 Kdr Tie1 Tek Vwf Gapdh
50 –CGAAATCTAGGCCTCAGCAC–30 50 –TAGCGGGATGAAATCTTTGG–30 50 –AAGGTCACACACACGGTGAA–30 50 –CCGTGCTGCTGAACAACTTA–30 50 –GCTCCAGCAAGTTGAAGACC–30 50 –TTCAATGGCACAGTCAAGGC–30
50 –CTTTTTGTCCACGGTCACCT–30 50 –TTGGTGAGGATGACCGTGTA–30 50 –TGGTGGCTGTACATTTTGGA–30 50 –AATAGCCGTCCACGATTGTC–30 50 –GCAAGTCACTGTGTGGCACT–30 50 –TCACCCCATTTGATGTTAGCG–30
227 207 174 201 163 101
56 56 56 56 56 56
NM_03159.1 NM_013062.1 XM_233462.4 NM_001105737.1 XM_342759.3 XR_007416.1
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
1101
1102
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
Fig. 2. Immunophenotyping of passage 3 undifferentiated rat BMSCs by confocal microscopy. Phenotypic characterization and evaluation revealed that the permeabilized cells were negative for CD11b, CD31, CD34, CD44, CD45 and OX43 (Figure, 2 A–J, O–P), indicating that these cultures were devoid of any potential hematopoietic and/or endothelial cells of bone marrow origin. However, the cells consistently expressed both CD73 and CD90 (Figure 2, K–N) surface antigens, a property of mesenchymal/stromal stem cells. Isotype controls were included in each experiment to identify the level of background staining. Cells were also stained for nuclei (blue, DAPI) and fibrillar actin (red, rhodamine phalloidin). Merged images (B, D, F, H, J–N, P). (A–P, scale bar 100 mm).
3. Results 3.1. Phenotypic characterization of input BMSCs Analysis of cell surface markers by flow cytometry of passage 3 BMSCs revealed that the fluorescent intensity and distribution of the cells stained for CD11b, CD31, CD34, CD44, CD45 and CD106 were not significantly different from the intensity and distribution of cells stained with isotype controls (Fig. 1A–E, H). In addition, these cells were negative for the rat endothelial cell surface marker OX43 (Fig. 1I), an antigen expressed on all vascular endothelial cells of rat, indicating that these cultures were devoid of any possible hematopoietic stem and/or progenitor cells as well as differentiated bonemarrow-derived endothelial cells. In contrast, BMSCs exhibited high expression of CD73 and CD90 surface antigens (Fig. 1F–G), which is consistent with their undifferentiated state. Furthermore, flow cytometric analysis of the same passage 3 BMSCs for various other
vascular endothelial cell surface antigens and smooth muscle cell intracellular antigens revealed that these cells were negative for Flt1, Flk1 and VE-cadherin (Fig. 1J–L) and, were predominantly positive for calponin (Fig. 1M). The expression profiles of these surface molecules were consistent with previous reports [4,14,17,21]. Phenotypic characterization using the same set of markers on passage 3 BMSCs by confocal microscopy also revealed that the cells were negative for CD11b, CD31, CD34, CD44, CD45 and OX43 (Fig. 2A–J, O–P), and strongly positive for CD73 and CD90 (Fig. 2K– N). The permeabilized cells when stained for Vcam1 (CD106), Flt1 (Vegfr1), Flk1 (Vegfr2) and VE-cadherin (Fig. 3A–H) revealed faintly detectable cytoplasmic and/or nuclear signal of these endothelial antigens. While these cells showed abundant cytoplasmic expression of smooth muscle antigen, calponin (Fig. 3I–J). Phenotypic characterization and evaluation of these markers on clonally expanded BMSCs showed similar expression patterns consistent with their parent culture.
Fig. 1. Immunophenotyping of passage 3 undifferentiated rat BMSCs by flow cytometry. Single parameter histograms showing the relative fluorescence intensity of staining (abscissa) and the number of cells analyzed, events (ordinate). Isotype controls were included in each experiment to identify the level of background fluorescence. The intensity and distribution of cells stained for hematopoietic and endothelial markers; CD11b, CD31, CD34, CD44, CD45, CD106, OX43, Flt1, Flk1 and VE-cadherin (green, shaded peaks) were not significantly different from those of isotype control (red, open peaks) (Panels A–E, H–L). The fluorescent intensity was greater (shifted to right) when BMSCs were stained with CD73, CD90 and calponin (green) compared to isotype control (red) (Panels F, G, M). The predominant population of BMSCs uniformly expressed CD90 surface molecule, consistent with their undifferentiated state.
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
1103
Fig. 3. Confocal microscopic analysis of various vascular related antigens on passage 3 undifferentiated rat BMSCs. Evaluation of the permeabilized cells for Vcam1 (CD106), Flt1 (Vegfr1), Flk1 (Vegfr2) and VE-cadherin revealed faintly detectable cytoplasmic and/or nuclear signals of these endothelial antigens (Figure 3, A–H), whereas these cells showed abundant cytoplasmic expression of smooth muscle antigen, calponin (Figure 3, I–J). Suggesting that BMSCs constitutively express very low levels of endothelial associated antigens as well as very high-levels of smooth muscle specific antigens. Isotype and/or negative controls were included in each experiment to identify the level of background staining. Cells were also stained for nuclei (blue, DAPI) and fibrillar actin (red, rhodamine phalloidin). Merged images (B, D–F, H–J). (A–J, scale bar 100 mm).
1104
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
Fig. 4. Real-time reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) analysis of various key vasculogenic markers, platelet/endothelial cell adhesion molecule 1 (Pecam1), kinase insert domain protein receptor (Kdr/Flk1/Vegfr2), tyrosine kinase with immunoglobulin-like and EGF-like domains 1 (Tie1), endothelial-specific receptor tyrosine kinase (Tek/Tie2) and von Willebrand factor homology (vWF) as a function of time (abscissa). BMSCs cultured in Petri dishes (2-D culture) in mesenchymal stem cell growth medium (A) and, in microvascular endothelial cell growth medium (B). BMSCs cultured in collagen-gel tubular scaffolds (3-D culture) in mesenchymal stem cell growth medium (C) and, in microvascular endothelial cell growth medium (D). The calibrator control included passage 4 BMSCs day 0 sample and; the target gene expression was normalized by a nonregulated reference gene expression, Gapdh. The expression ratio (ordinate) was calculated using the REST-XL version 2 software. The values are means standard errors for three cultures (n ¼ 3), *P < 0.05; **P < 0.001.
3.2. mRNA analysis of vasculogenic markers To determine the differential gene expression profiles between BMSCs cultured in tubular scaffolds (3-D culture) and Petri dishes (2-D culture), real-time quantitative RT-PCR (RT-qPCR) analyses of vasculogenic differentiation markers were carried out at the defined time points (7, 14, 21 and 28 days) on BMSCs cultured in tubular scaffolds either in vasculogenic (EGMMV) or non-vasculogenic (MSCGM) media. Additionally, RT-qPCR on BMSCs cultured in the Petri dishes in the same media conditions was performed at the same time points. BMSCs cultured in Petri dishes in non-vasculogenic medium constitutively expressed transcripts coding for key vasculogenic lineage-specific markers (Fig. 4A and B). Pecam1 showed an initial down regulation around day 7 followed by sustained progressive upregulation up to 28 days, whereas Kdr remained upregulated up to 28 days with a marked expression seen at day 21. Tie1 showed a slight initial upregulation and thereafter displayed variable levels of down regulation over 21 days. Tek1 showed a transient down
regulation at day 21. vWF expression revealed consistent down regulation up to 28 days (Fig. 4A). When BMSCs were cultured in Petri dishes in vasculogenic medium, the transcript levels of Pecam1 and vWF showed marked upregulation during day 21. Kdr showed progressive upregulation with a peak expression noticeable around day 21. Tie1 demonstrated a progressive down regulation over 21 days. Tek1 showed upregulation only on day 28 (Fig. 4B). In contrast, the expression pattern of key vasculogenic marker transcripts in tube cultures showed a remarkable difference in response to non-vasculogenic and vasculogenic media (Fig. 4C and D). In non-vasculogenic medium Pecam1 showed down regulation until day 14 and thereafter-showed gradual upregulation over the remaining observed period of time. Kdr and Tie1 were upregulated at day7, day 14 and day 28 and, both transcripts showed a transient down regulation during day 21. Tek remained upregulated until day 21 and subsequently returned to basal level. vWF demonstrated consistent upregulation over 28 days (Fig. 4C). When BMSCs were cultured on the tubular scaffold in vasculogenic medium, the transcript level of Pecam1 showed an initial down regulation
Fig. 5. Expression pattern of various vasculogenic markers in tubular scaffold by confocal microscopy. Localization of key endothelial and smooth muscle cell phenotypic markers of day 21 non-vasculogenic tube cultures demonstrated the expression of CD34 (A–C), Pecam1 (D–F), vWF (G–I), VE-cadherin (J–L) and a-SMA (B–C, E–F, H–I, K–L). Dual immunostainings of non-vasculogenic tube cultures (mesenchymal stem cell growth media, MSCGM) revealed areas of elongated and flattened cells composed of varying degrees of mature endothelial and smooth muscle cells (A–L). These cells were organized into a loose delicate network of nascent capillary-like structures composed of mature endothelial and smooth muscle cells and showed evidence of central lumen formation (white arrows, D–I). In addition, tube-like structures were emanating from the mixed population of vasculogenic cells represented by their distinct morphology and phenotypic expression (white arrows, A–C; white arrows, J–L). Cells were also stained for nuclei (blue, DAPI). Images (A–C) show a projection representing 15 sections collected at 5.05 mm intervals (70.70 mm). Images (D–F) show a projection representing 19 sections collected at 5.05 mm intervals (90.90 mm). Images (J–L) show a projection representing 19 sections collected at 4.04 mm intervals (72.90 mm). Merged images (A–L). (A–L, scale bar 50 mm).
Fig. 6. Expression pattern of various vasculogenic markers in tubular scaffold by confocal microscopy. Localization of key endothelial and smooth muscle cell phenotypic markers of day 21 vasculogenic tube cultures demonstrated the expression of Flk1 (A, C), VE-cadherin (D, F), vWF (G, I; J, L), tomato lectin (E–F; H–I) and a-SMA (B–C, K–L). Dual immunostainings of vasculogenic tube cultures (microvascular endothelial cell growth medium, EGMMV) revealed areas of elongated cells composed of both mature endothelial and smooth muscle cells (A–L). These cells formed developing microvessl-like structures (A–F, J–L). The linear nascent capillary-like structures showed translucent central lumen (white arrows, D–F). In addition, the cells were organized into a loose network of vascular cells and were in a ribbon-like configuration (G–I). These aligned vascular cells transformed into thin tube-like structures reminiscent of in vivo microvessel morphogenesis (J–L). Cells were also stained for nuclei (blue, DAPI). Images (D–F) show a projection representing 13 sections collected at 3.05 mm intervals (36.60 mm). Images (G–I) show a projection representing 18 sections collected at 7.05 mm intervals (119.8 mm). Images (J–L) show a projection representing 27 sections collected at 6.05 mm intervals (157.3 mm). Merged images (A–L). (A–C, J–L, scale bar 100 mm; D–F, G–I, scale bar 50 mm).
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
1107
1108
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
around day 7 followed by sustained augmented upregulation up to 28 days. Kdr and vWF remained upregulated remarkably throughout 28 days. Tie1 was downregulated at day 7 and day 28 and, virtually undetectable on day 14 and 21. Tek showed a gradual upregulation and reached a maximum on day 21 and, virtually undetectable on day 28 (Fig. 4D). 3.3. Expression of vasculogenic markers in tubular scaffold To validate the findings of mRNA expression pattern of important vasculogenic markers in these tube cultures and, to determine whether these messages were translated into proteins, immunocytochemistry was undertaken. When BMSCs were seeded and cultured in the tubular scaffold under non-vasculogenic and vasculogenic culture conditions for 21 days microvessel-like structures were generated (Fig. 5A–L and Fig. 6A–L). Immunostaining and confocal laser scanning microscopic analysis established that these structures were composed of cells that were positive for a variety of markers that are associated with vascular endothelial and smooth muscle cells, CD31/Pecam1, CD34, Flt1 (Vegfr1), Flk1 (Kdr/Vegfr2), VE-cadherin (CD144), tomato lectin, fibronectin, von Willebrand factor (vWF), a-SMA and calponin (Fig. 5A–L and Fig. 6A–L). This implied that the tubular scaffold contained mixture of both endothelial cells and smooth muscle cells. By cellular adhesion and condensation these differentiated cells formed sheets of monolayered cells and clusters of multilayered cells (white asterisks, Fig. 5J–L). Solid cord-like structures composed of many cells were emanating from these cellular aggregations (white arrows Fig. 5J– L). Self-assembly into elongated and thinned out cells created multiple ribbon-like structures (Fig. 6G–I). These nascent capillarylike structures and convoluted mature tube-like structures were seen throughout the construct (Fig. 5A–C and Fig. 6A–F, J–L). These linear and branching tube-like structures consisted of aligned endothelial cells that were surrounded by a-SMA positive cells. Extensive plexuses of arborizing capillary-like structures reminiscent of neo-vascularization and/or neoangiogenesis were also observed. These capillary-like structures contained central lumens of varying caliber (white arrows, Fig. 5D–I; white arrows, Fig. 6D–F) and exhibited strong expression of late stage endothelial cell marker, vWF and smooth muscle cell marker, a-SMA, thus indicating that these microvessels were able to attain a mature vascular phenotype. Day 14 and day 28 tube cultures under vasculogenic and non-vasculogenic conditions demonstrated similar staining patterns for these markers. However, there exist obvious differences in the vascular phenotypic maturity at a given time point in both media culture conditions. When compared to day 28 nonvasculogenic tube cultures, day 28 vasculogenic tube cultures revealed relatively larger caliber vessel-like structures with patent lumens (data not shown). 3.4. Characterization of endothelial cells by LDL incorporation In order to characterize the phenotypic nature of BMSC-derived endothelial cells, a functional method that involves measuring the
uptake of Ac-LDL using the fluorescent probe Dil (Dil-Ac-LDL) was performed. The collagen-gel tube cultures were incubated with Dil-Ac-LDL, a compound that does not inhibit the growth rate and viability of cells that internalize it. The endothelial cells generated in vasculogenic and non-vasculogenic culture conditions were brightly stained, demonstrating the high metabolism of acetylated low-density lipoprotein (Ac-LDL) (Fig. 7A–J). Confocal microscopic analysis of Dil-Ac-LDL stained day 21 vasculogenic and non-vasculogenic culture tube sections showed robust uptake of LDL from the media. Fluorescence was predominantly punctate with a perinuclear distribution (Fig. 7A, B, G, H). Smooth muscle cells/pericytes were distinguished from endothelial cells by their lack of detectable fluorescence. The Ac-LDL uptake and metabolism were evident as early as day 14 with a greater uptake seen at day 21 and day 28. Fig. 7(C–F, I, J) show areas of tubular constructs that contain typical bright red stained clusters of endothelial cells transforming into plexus of nascent endothelium-lined tube-like structures with attempted lumen formation (white arrows, Fig. 7H–J). 3.5. SEM analysis of tubular construct SEM analysis of the day 28 tubular constructs under both vasculogenic and non-vasculogenic culture conditions revealed the typical cobblestone appearance of differentiated endothelial cells that were arranged in monolayer (Fig. 8A, F). Stratified cells showed honeycomb appearance with areas of cellular retraction, transformation and networking (Fig. 8B, G). Areas of smooth-walled tube-like structures with attached smooth muscle cells/pericytes were also seen amidst these stratified cells (black arrows, Fig. 8D, E, I, J). It is apparent that multiple smooth muscle-like cells were wrapping around these tube-like structures (black asterisks, Fig. 8C–E, H–J). These cylindrical structures showed the presence of evolving lumen (white asterisks, Fig. 8C–E, H, J), which may be apparently accomplished by the retraction and reorganization of endothelial cells from the substratum followed by wrapping of smooth muscle cells around it in a perpendicular fashion (black asterisks, Fig. 8D, E, I, J). Some of those luminal surfaces showed the regular cobblestone arrangement of endothelial cells (white asterisks, Fig. 8C, D). 3.6. Clonal analyses In this study, clonally isolated and expanded cells were consistently positive for CD73 and CD90, indicating that the BMSC-derived colonies were predominantly undifferentiated. Differentiation of these cells on collagen scaffolds using vasculogenic and non-vasculogenic culture conditions for 28 days produced vessel-like structures. Vascular lineage-specific marker analysis of two individual clones revealed endothelial and smooth muscle cells, suggesting the intrinsic vasculogenic differentiation potential of BMSCs. In these culture conditions, BMSCs produced both capillary-like networks and/or endothelium-lined tube-like structures.
Fig. 7. Characterization of BMSCs derived endothelial cells by Dil-Ac-LDL uptake. BMSCs cultured in collagen-gel tubular scaffolds in non-vasculogenic (mesenchymal stem cell growth medium, MSCGM) and vasculogenic (microvascular endothelial cell growth medium, EGMMV) culture conditions were incubated with 10 mg/ml of Dil-Ac-LDL for 4–6 h. Confocal laser scanning microscopic analysis of sections of day 21 tubular scaffolds in MSC growth medium revealed abundant punctate perinuclear bright red fluorescence of the differentiated and matured endothelial cells (A–F). These labeled vascular cells were organized into a discrete cluster (A, B), assembled into tangled capillary-like structures on top of a cluster (white asterisks, C, D) and, transformed into nascent linear and branching capillary-like structures (white asterisks, E, F). Similarly, confocal laser scanning microscopic analysis of sections of day 21 tubular scaffolds in microvascular endothelial cell growth medium revealed typical abundant punctate perinuclear bright red fluorescence of the differentiated and matured endothelial cells (G–J). These labeled vascular cells were organized into small discrete clusters (G), self-organized into numerous small capillaries with a central lumen (white arrow, H), assembled into solid cord of cells (white arrow, I) and, transformed into tube-like structure with attempted lumen formation (white arrows, J). Cells were also stained for nuclei (blue, DAPI) and fibrillar actin (green, AlexaÒ 488 phalloidin). Images (A–B) show a projection representing 13 sections collected at 3.05 mm intervals (36.60 mm). Images (C–D) show a projection representing 20 sections collected at 4.05 mm intervals (76.95 mm). Images (E–F) show a projection representing 4 sections collected at 2.05 mm intervals (6.15 mm). Image (H) shows a projection representing 20 sections collected at 5 mm intervals (95.00 mm). Image (I) shows a projection representing 13 sections collected at 4 mm intervals (48.00 mm). Image (J) shows a projection representing 22 sections collected at 5 mm intervals (105.00 mm). Merged images (A–J). (A–J, scale bar 50 mm).
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
1109
Fig. 8. Scanning electron microscopic (SEM) analysis of tubular constructs. SEM analysis of day 28 tubular constructs under both vasculogenic and non-vasculogenic culture conditions showed the typical cobblestone appearance of differentiated endothelial cells (A, F), stratification and networking (B, G), and the presence of smooth-walled tube-like structures with its attached smooth muscle cells and/or pericytes (black arrows, D, E, I, J). Multiple smooth muscle-like cells were wrapping around these tube-like structures (black asterisks, Figure C–E, H–J). These cylindrical structures revealed the presence of evolving patent lumens (white asterisks, C–E, H, J). Some of these luminal surfaces showed the regular cobblestone arrangement of endothelial cells (white asterisks, C, D). (B, D–J, scale bar 10 mm; A, C, scale bar 100 mm).
4. Discussion The 3-D collagen-gel tubular scaffold has previously been used to create models of vascularized bone development [14,17]. Here we report the utility of a 3-D tubular construct for its ability to
support the vasculogenic differentiation of BMSCs culminating into microvascular structures that is reminiscent of postnatal de novo vasculogenesis and angiogenesis. In the developing vertebrate embryo, the initial event of blood vessel formation is the differentiation of vascular endothelial cells, which subsequently cover
1110
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
the entire interior surface of all blood vessels. Angioblasts are a subpopulation of primitive mesodermal cells that are committed to differentiate into endothelial cells and later on form the primitive vascular labyrinth [1]. In addition, endothelial cells can also arise from hemangioblasts, a common precursor for both hematopoietic and endothelial cells [22]. In adults, endothelial precursor cells have been identified in bone marrow, peripheral blood and blood vessels [23]. The postnatal bone marrow contains two subsets of multipotential stem cells, hematopoietic stem cells (HSCs) and bone marrow stromal cells (BMSCs) or mesenchymal stem cells (MSCs). BMSCs are heterogeneous populations of cells that can be differentiated into osteoblasts, chondrocytes, adipocytes, smooth muscle cells and hematopoietic supportive stroma either in vitro or in vivo [24]. Previous studies have demonstrated that bone-marrow-derived stem and/or progenitor cells can be differentiated into either endothelial or smooth muscle cells in vitro and in pathological situations are capable of contributing to neoangiogenesis in vivo by cellular integration [25]. Although there are a plethora of studies focused on developing viable scaffolds for osteogenic, chondrogenic, adipogenic and musculogenic differentiation of BMSCs [26], the optimal scaffolds that are capable of inducing and supporting the growth and differentiation of BMSCs into vascular cell lineages are yet to be identified and characterized. Despite the much known vasculogenic potential and transgermal plasticity of BMSCs; none of these studies explicitly demonstrated the postnatal de novo vasculogenic potential of BMSCs in vitro [4,5]. When compared to 2-D planar cultures, the potential 3-D models of vasculogenesis allow us to understand the role of specific factors under more physiological conditions with respect to dimensionality, architecture and cell polarity. Nevertheless, the molecular composition and the natural complexity and diversity of in vivo extra cellular matrix (ECM) organization cannot be easily reproduced in vitro [27]. In addition, even though quite a few in vitro 3-D models of vasculogenesis based on fibrin and collagen gels are in vogue [28]; none have explored the behavior of BMSCs and their intrinsic vasculogenic differentiation potential on a topographically structured 3-D tubular scaffold made of uniformly aligned type I collagen fibers. Previous studies demonstrated that the formation of endothelial tubes in vitro was largely influenced by the nature of the substrate [29]. The formation of endothelium-lined tubular structures was enhanced when the substrate was rich in laminin [30], whereas a matrix rich in type I collagen would not promote rapid tubulogenesis [31,32]. Similarly, Ingber and Folkman [32] documented that under a given cocktail of growth factors, the local physical nature of the interaction between endothelial cells and the underlying matrix/substrate ultimately determined the tubular morphogenesis. Substrates containing abundant fibronectin promoted adhesion, spreading and growth of endothelial cells. In contrast, less adhesive substrate or matrix materials that were arranged three-dimensionally permitted the endothelial cells to retract and form tubes [32]. We hypothesized that under appropriate in vitro local environmental cues (combination of growth factors and ECM) multipotent postnatal BMSCs could be induced to undergo microvascular development. Hence, we developed a 3-D culture system in which a pure population of CD90þ rat BMSCs was seeded and cultured on a highly aligned, porous, biocompatible collagen-fiber tubular scaffold for differentiation purposes. Here, we compared the effects of two types of growth media, MSCGM and EGMMV. Both of these culture media consistently promoted the vasculogenic differentiation of BMSCs and also supported the formation of endothelium-lined tube-like structures within the constructs.
A number of early and late stage markers associated with rodent vascular development in vivo were used in this study to characterize the rat BMSCs-derived microvascular structures at mRNA and protein levels, which included: CD31/Pecam1, Flt1 (Vegfr1), Flk1 (Vegfr2/Kdr), VE-cadherin (CD144), CD34, Tie1, Tek (Tie2), and von Willibrand factor (vWF). Platelet/endothelial cell adhesion molecule, also known as CD31, is a transmembrane protein expressed abundantly early in vascular development that may mediate leukocyte adhesion and migration, angiogenesis, and thrombosis [33]. The other early-stage differentiation markers are the vascular endothelial cell growth factor-A (Vegf) receptors Flk1 and Flt1, which play a vital role in embryonic vascular and hematopoietic development [34]. Similarly, VE-cadherin, a member of the cadherin family of adhesion receptors, is a specific and constitutive marker of endothelial cell plays an important role in early vascular assembly. Vascular markers that are expressed at a later stage include CD34 and Tie2 [35]. CD34 is a transmembrane surface glycoprotein that is expressed in endothelial cells and hematopoietic stem cells whereas Tie1 and Tek are receptor kinases that are essential for vascular development and remodeling in the embryo may mediate maintenance and repair of adult vascular system. In late phases of vasculogenesis the mature endothelial cells will synthesize and secrete vWF homolog, a plasma protein that mediates platelet adhesion to damaged blood vessels and stabilizes blood coagulation factor VIII. To study the expression pattern of key vasculogenic gene transcripts in the 3-D tube constructs, we examined the expression of Pecam1, Kdr, Tie1, Tek and vWF at mRNA level in the tube constructs by real-time PCR. Constitutive expressions of these markers were detected at low to very low levels in undifferentiated input BMSCs. RT-qPCR results showed that vasculogenic differentiation of BMSCs in vasculogenic culture conditions for 28 days resulted in increased expression of transcripts coding for various endothelial cell associated proteins such as Pecam1, Kdr, Tek and vWF. The peak expression of vWF, the endothelial-specific protein occurred around day 21 (over 400 fold) indicating that the differentiating cells acquired a distinctive phenotype and biosynthetic activity of differentiated and matured endothelial cells. The upregulation of Tek during this period may represent the continual development and remodeling of the developing microvessels. Whereas differentiation of BMSCs under non-vasculogenic conditions for 14 days showed signs of early and rapid induction of transcripts coding for both early and late stage endothelial cell markers such as Kdr, Tie1, Tek and vWF. The peak expression of vWF occurred during day 14 (over 20 fold). As revealed by immunostaining for various vasculogenic markers, day 21 vasculogenic and non-vasculogenic tube cultures showed that BMSCs were able to adhere, proliferate, migrate and, undergo complete maturation and differentiation into microvascular structures. BMSCs derived microvessel formation is a combination of de novo vasculogenesis i.e., in situ endothelial cell differentiation and endothelium-lined tube formation, and angiogenesis, endothelial sprouting from existing endothelial tubes. In addition, these microvessels are stabilized by association with BMSCs derived smooth muscle cells and/or pericytes. It is well known that endothelial cells share the large majority of their antigens with other hematopoietic or mesenchymal cells [36]. Hence, antigens such as CD31, CD34, CD144 (VE-cadherin), CD146, vWF or CD105 are not only expressed by endothelial cells but also expressed by hematopoietic cells (specifically HSCs), platelets and certain subpopulations of fibroblasts. Hence, to identify the differentiated and matured endothelial cells in the tubular scaffold a battery of various early and late stage vasculogenic markers such as Pecam1, CD34, Flt1, Flk1, VE-cadherin, fibronectin and vWF were employed. In addition, tomato lectin, another marker specific for rat vascular endothelial cells, was found closely associated with
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
Flk1 and vWF staining. These endothelial associated markers localized to endothelial cell clusters and capillary-like structures that were present throughout the tubular construct. This suggests that BMSC-derived endothelial cells assembled into endothelium-lined tube-like structures and initiated the process of vasculogenesis, consistent with our previous report [17]. In addition, the BMSCs derived cells and the microvessel-like structures expressed the smooth muscle antigens, a-SMA and calponin. These a-SMA positive cells were recruited in juxtaposition to the tandemly arranged endothelial cells and, were attached and wrapped around in such a way that is reminiscent of in vivo microvessel morphogenesis. Similarly, SEM analysis of the tubular constructs depicted the pattern of microvessel morphogenesis and maturity. These formed nascent capillary-like structures and elongated tube-like structures revealed patent lumen-like structures, elucidating the vessel-maturation. Furthermore, the ability to identify endothelial cells based on their increased metabolism of Ac-LDL was examined using Ac-LDL tagged with the fluorescent probe (Dil-Ac-LDL). BMSCs derived endothelial cells and the nascent capillary-like structures were brilliantly fluorescent whereas the fluorescent intensity of smooth muscle cells/pericytes was barely detectable. This suggests that the formed endothelial cells were not only fully differentiated but also functionally competent and matured. Previously, it has been shown that mature vascular endothelium can give rise to smooth muscle cell (SMC) via endothelial-mesenchymal transdifferentiation, coexpressing both endothelial and SMC-specific phenotypic markers [37]. Recently, it has been show that Flk1-expressing blast cells derived from embryonic stem cells can act as precursors that can differentiate into both endothelial and mural cell populations of the vasculature [12]. In this study, clonal analyses revealed the bi-lineage potential of BMSCs, suggesting that both endothelial and smooth muscle/pericytes could be derived from single colonies. However, in general, BMSCsderived colonies are clonal or nearly clonal. The colonies of BMSCs resultant from a number of cells may represent co-existence of several subclones, each capable of differentiating into specific lineages. Hence, single-cell-derived colonies that are stably transfected with lineage-restricted expression markers are needed to gain more meaningful insights and address the origin of both lineages. This behavior of BMSCs and their exhibition of vasculogenic differentiation potential can be attributed to the nature of microenvironmental factors in this culture conditions. The preconditioned factors in the growth microenvironment rendered by the aligned type I collagen fibers of the tubular scaffold and the soluble differentiating factors provided by the vasculogenic and non-vasculogenic media may be behind the BMSC fate determination. Further work is ongoing to determine whether our prevascularised tubular scaffolds can survive implantation into a tissue defect and is able to anastomose promptly with vascular sprouts emanating from the host. Finally, our morphological, molecular, immunological and biochemical data reveal the intrinsic vasculogenic differentiation potential of BMSCs under appropriate 3-D microenvironmental conditions. 5. Conclusions Here we report a unique 3-D culture system that recapitulates many aspects of postnatal de novo vasculogenesis and angiogenesis. This is the first comprehensive report that evidently demonstrates that BMSCs under appropriate in vitro environmental conditions can be induced to undergo vasculogenic differentiation culminating in microvessels. Since BMSCs differentiated into both endothelial and smooth muscle cell lineages, this in vitro model system provides a tool for investigating the cellular and molecular
1111
origin of both vascular endothelial cells and smooth muscle cells. In addition, this system can potentially be harnessed to develop in vitro engineering of microvascular trees, especially using autologous bone-marrow-derived BMSCs for therapeutic purposes in regenerative medicine. Disclosures All authors have no conflicts of interest. Acknowledgements The authors thank Dr. Robert L. Price for his critical reading of the manuscript and Dr. Udai P. Singh for his flow cytometry technical assistance and; Ms. Cheryl Cook and Ms. Valerie A. Kennedy for their excellent technical assistance, cell culture and MACS cell sorting respectively. References [1] Risau W, Flamme I. Vasculogenesis. Annu Rev Cell Dev Biol 1995;11:73–91. [2] Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat Med 2000;6:389–95. [3] Urbich C, Dimmeler S. Endothelial progenitor cells functional characterization. Trends Cardiovasc Med 2004;14:318–22. [4] Reyes M, Dudek A, Jahagirdar B, Koodie L, Marker PH, Verfaillie CM. Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 2002;109:337–46. [5] Oswald J, Boxberger S, Jorgensen B, Feldmann S, Ehninger G, Bornhauser M, et al. Mesenchymal stem cells can be differentiated into endothelial cells in vitro. Stem Cells 2004;22:377–84. [6] Al-Khaldi A, Eliopoulos N, Martineau D, Lejeune L, Lachapelle K, Galipeau J. Postnatal bone marrow stromal cells elicit a potent VEGF-dependent neoangiogenic response in vivo. Gene Ther 2003;10:621–9. [7] Kinnaird T, Stabile E, Burnett MS, Shou M, Lee CW, Barr S, et al. Local delivery of marrow-derived stromal cells augments collateral perfusion through paracrine mechanisms. Circulation 2004;109:1543–9. [8] Levenberg S. Engineering blood vessels from stem cells: recent advances and applications. Curr Opin Biotechnol 2005;16:516–23. [9] Even-Ram S, Yamada KM. Cell migration in 3D matrix. Curr Opin Cell Biol 2005;17:524–32. [10] Carlson BM. Tissue engineering and regeneration. In: Principles of regenerative biology. Amsterdam: Elsevier; 2007. p. 259–78. [11] Ingber DE, Folkman J. How does extracellular matrix control capillary morphogenesis? Cell 1989;58:803–5. [12] Yamashita J, Itoh H, Hirashima M, Ogawa M, Nishikawa S, Yurugi T, et al. Flk1positive cells derived from embryonic stem cells serve as vascular progenitors. Nature 2000;408:92–6. [13] Yost MJ, Baicu CF, Stonerock CE, Goodwin RL, Price RL, Davis M, et al. A novel tubular scaffold for cardiovascular tissue engineering. Tissue Eng 2004;10:273–84. [14] Valarmathi MT, Yost MJ, Goodwin RL, Potts JD. The influence of proepicardial cells on the osteogenic potential of marrow stromal cells in a three-dimensional tubular scaffold. Biomaterials 2008;29:2203–16. [15] Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa, NJ: Humana Press; 2000. p. 365–86. [16] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29. e45. [17] Valarmathi MT, Yost MJ, Goodwin RL, Potts JD. A three-dimensional tubular scaffold that modulates the osteogenic and vasculogenic differentiation of rat bone marrow stromal cells. Tissue Eng 2008;14:491–504. [18] Voyta JC, Via DP, Butterfield CE, Zetter BR. Identification and isolation of endothelial cells based on their increased uptake of acetylated-low density lipoprotein. J Cell Biol 1984;6:2034–40. [19] Hanaichi T, Sato T, Iwamoto T, Malavasi-Yamashiro J, Hoshino M, Mizuno N. A stable lead by modification of Sato’s method. J Electron Microsc (Tokyo) 1986;35:304–6. [20] Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30: e36. [21] Anokhina EB, Buravkova LB. Heterogenecity of stromal cell precursors isolated from rat bone marrow. Cell Tissue Biology 2007;1:1–7 (Original article in Russian - Tsitologiya 2007;49:40–47). [22] His W. Lecithoblast und angioblast der wirbeltiere. Abhandl Math-Phys Ges Wiss 1900;26:171–328. [23] Prater DN, Case J, Ingram DA, Yoder MC. Working hypothesis to redefine endothelial progenitor cells. Leukemia 2007;21:1141–9.
1112
M.T. Valarmathi et al. / Biomaterials 30 (2009) 1098–1112
[24] Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells 2001;19:180–92. [25] Carmeliet P, Luttun A. The emerging role of the bone marrow-derived stem cells in (therapeutic) angiogenesis. Thromb Haemost 2001;86:289–97. [26] Lanza RP, Langer R, Vacanti J. Principles of tissue engineering. San Diego, CA: Academic Press; 2000. [27] Vailhe B, Vittet D, Feige JJ. In vitro models of vasculogenesis and angiogenesis. Lab Invest 2001;81:439–52. [28] Folkman J, Haudenschild C. Angiogenesis in vitro. Nature 1980;288:551–6. [29] Kleinman HK, McGarvey ML, Liotta LA, Robey PG, Tryggvason K, Martin GR. Isolation and characterization of type IV procollagen, laminin, and heparan sulfate proteoglycan from the EHS sarcoma. Biochemistry 1982;21:6188–93. [30] Madri JA, Pratt BM, Tucker AM. Phenotypic modulation of endothelial cells by transforming growth factor-b depends upon the composition and organization of the extracellular matrix. J Cell Biol 1988;106:1375–84. [31] Montesano R, Orci L, Vassalli JD. In vitro rapid organization of endothelial cells into capillary-like network is promoted by collagen matrices. J Cell Biol 1983;97:1648–52.
[32] Ingber DE, Folkman J. Mechanochemical switching between growth and differentiation during fibroblast growth factor-stimulated angiogenesis in vitro: role of extracellular matrix. J Cell Biol 1989;109:317–30. [33] Albelda SM, Muller WA, Buck CA, Newman PJ. Molecular and cellular properties of PECAM-1 (endoCAM/CD31): a novel vascular cell-cell adhesion molecule. J Cell Biol 1991;114:1059–68. [34] Shalaby F, Ho J, Stanford WL, Fischer K-D, Schuh AC, Schwartz L, et al. A requirement for Flk-1 in primitive and definitive hematopoiesis and vasculogenesis. Cell 1997;89:981–90. [35] Bautch VL, Redick SD, Scalaia A, Harmaty M, Carmeliet P, Rapoport R. Characterization of the vasculogenic block in the absence of vascular endothelial growth factor-A. Blood 2000;95:1979–87. [36] Bertolini F, Shaked Y, Mancuso P, Kerbel RS. The multifaceted circulating endothelial cell in cancer: towards marker and target identification. Nat Rev Cancer 2006;6:835–45. [37] Frid MG, Kale VA, Stenmark KR. Mature vascular endothelium can give rise to smooth muscle cells via endothelial-mesenchymal transdifferentiation: in vitro analysis. Circ Res 2002;90:1189–96.
