A Sequence-Ready Physical Map of a Region of 12q24.1

GENOMICS

45, 271–278 (1997) GE974888

ARTICLE NO.

A Sequence-Ready Physical Map of a Region of 12q24.1 Beatrice Renault,*,1 Alain Hovnanian,† Steven Bryce,‡ Joan-Jung Chang,* Stephanie Lau,* Anavaj Sakuntabhai,† Sarah Monk,† Simon Carter,‡ Colin J. D. Ross,‡ Joanna Pang,§ Rebecca Twells,§ Susan Chamberlain,§ Anthony P. Monaco,† Tom Strachan,‡ and Raju Kucherlapati* *Department of Molecular Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461; †The Wellcome Trust Center for Human Genetics, Windmill Road, Headington, Oxford OX3 7BN, United Kingdom; ‡Department of Human Genetics, University of Newcastle, Ridley Building, Claremont Place, Newcastle upon Tyne NE1 7RU, United Kingdom; and §Department of Biochemistry and Molecular Genetics, St. Mary’s Hospital Medical School, Norfolk Place, Paddington, London W1PG, United Kingdom Received April 4, 1997; accepted June 26, 1997

We developed a sequence-ready map of a part of human chromosome 12q24.1. We utilized a number of sequence-tagged site (STS) markers from 12q24.1 to screen large insert bacterial chromosome libraries and a chromosome 12-specific cosmid library. The clones were assembled into contiguous sets (contigs) by STS-content analysis. Contigs were extended by obtaining end sequences of bacterial clones, generation of additional STSs, rescreening the libraries, and screening the additional clones for the presence of STSs. The resulting contig covers nearly 2 Mb of DNA and provides an average marker resolution of 16 kb. Based on the STS content, we developed fingerprints of a subset of clones. The STS content and fingerprint data allowed us to define a minimal tiling path of clones. These clones are being used to sequence this part of chromosome 12. This contig contains the Ataxin 2 gene, and it covers the interval harboring the gene responsible for Darier disease. q 1997 Academic Press

INTRODUCTION

A goal of the human genome effort is to obtain the complete nucleotide sequence of all the human chromosomes by the year 2005 (Collins and Galas, 1993). This effort is proceeding in several stages. The first stage was the construction of a genetic linkage map. Several groups contributed to the development of such a map, which has an average resolution greater than 1 cM (Gyapay et al., 1994; Dib et al., 1996; Murray et al., 1994). The second step was the construction of a physical map. Physical mapping efforts have taken two forms. One was the development of a map of ordered markers using radiation hybrids (Cox et al., 1990; Hud1 To whom correspondence should be addressed. Telephone: (718) 430-2848. Fax: (718) 430-8778. E-mail: [email protected].

son et al., 1995), and the second was the development of maps based on overlapping cloned fragments of human DNA. These efforts, in turn, were divided into genomewide efforts (Bellane-Chantelot et al., 1992; Chumakov et al., 1995; Cohen et al., 1993; Hudson et al., 1995) and individual chromosome-based efforts. Several chromosome-based maps with differing degrees of marker density and resolution have been reported (Bell et al., 1995; Gemmill et al., 1995; Krauter et al., 1995; Collins et al., 1995; Chumakov et al., 1992a,b; Doggett et al., 1995; Foote et al., 1992). Most of these maps are based on the development of overlapping sets of DNA cloned into yeast artificial chromosomes (YACs). Although different approaches were used in the construction of physical maps, the most widely used method is sequence-tagged sites (STS) content mapping (Green and Olson, 1990). Although the YAC contiguous (contig) maps are of good quality, the YACs themselves are not suitable to generate direct sequencing substrates. The reasons for this lie in the fact that the YACs are relatively large and are difficult to purify from the rest of the yeast genome. They have a high degree of chimerism and occasionally have internal rearrangements. The successes of the yeast genome sequencing effort (Dujon et al., 1994; Johnston et al., 1994; Goffeau et al., 1996) and the ongoing Caenorhabditis elegans genome sequence effort (Sulston et al., 1992; Wilson et al., 1994; Hodgkin et al., 1995) suggest that overlapping bacterial clones are ideal substrates for preparing sequencing substrates. Several human genomic libraries with DNA cloned into bacterial artificial chromosomes (BACs) and P1 artificial chromosomes (PAC) (Shizuya et al., 1992; Ioannou et al., 1994) are available. Efforts to convert the current physical maps into sequence-ready maps are under way. The development of sequence-ready maps in yeast and C. elegans proceeded on a genome-wide basis. The basic strategies were to obtain a fingerprint of each of

271

AID

GENO 4888

/

6r44$$$$21

10-02-97 02:30:15

0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.

gnma

272

RENAULT ET AL.

the bacterial clones (mostly phage and cosmid clones) and make two-by-two comparisons to establish overlaps (Link and Olson, 1991; Riles et al., 1993). The success of these methods was based on the facts that the genomes were relatively small and the fingerprint patterns were not too complex because of the use of phage and cosmid vectors for generating the libraries. The significantly larger size of the human genome and the complexity of the fingerprints obtained from BAC and PAC clones prevent the direct importation of these methods for whole-genome mapping. Such an approach would also not utilize the rich physical mapping information that is available for the human genome. Fingerprinting methods were used with success to construct cosmid contigs for significant portions of chromosomes 16 and 19 (Carrano et al., 1989; Stallings et al., 1990, 1992; Doggett et al., 1995), but additional large insert clone resources were required to assemble complete maps for these chromosomes. Therefore, a method that fully utilizes the low-resolution map data and results in a highly accurate bacterial clone map with significant clone depth is highly desirable. Sequence-tagged sites, which are represented by a PCR primer pair defining a unique portion of the human genome, have evolved as an important currency in the human gene mapping efforts. Highly polymorphic markers, nonpolymorphic markers, as well as genes and expressed sequence tags (ESTs) can be represented by STSs, and the presence or absence of the corresponding genomic sequences in appropriate DNA preparations can be assessed by PCR. The use of STS content to construct physical maps was originally described by Green and Olson (1990). Most of the clone-based physical maps of the human genome are STS-content maps. Based on the robustness of the STS-content mapping strategy and the DNA fingerprinting strategy, we developed a reliable, fast, and accurate method for generating high-resolution physical maps and for deducing a set of minimal tiling path clones that can be used to generate the immediate sequencing substrates. We described the construction of a YAC contig map for chromosome 12 (Krauter et al., 1995). The map was constructed by identifying YACs containing one or more chromosome markers and testing the STS content of each YAC. This low-resolution map is being continuously refined and extended. Using the YAC contig map as a framework, we began an effort to convert portions of the map into a high-resolution sequence-ready map. We now describe a PAC, BAC, and cosmid-based map of a portion of chromosome 12 which spans nearly 2 Mb of DNA. MATERIALS AND METHODS Libraries and library screening. Three clone libraries were used to construct the high-resolution map. The first was a PAC library constructed by de Jong and colleagues (Ioannou et al., 1994). For this study, clones corresponding to six genome equivalents were used. The PAC clones were arrayed into 384-well microtiter plates, and the clones were also provided as a high-density gridded array

AID

GENO 4888

/

6r44$$$$21

10-02-97 02:30:15

on filters. Each 22 1 22-cm filter contained 18,432 individual clones. The second library is a chromosome 12-specific cosmid library (Montgomery et al., 1993) containing six genome equivalents. These clones were arrayed into 96-well microtiter plates and onto 3 1 4 filters. Each filter contained 1536 clones. BAC clones identified by Pulst et al. (1996) to be in the region were purchased from Research Genetics. To generate probes for hybridization, PCR primers corresponding to individual nonpolymorphic STSs were used to amplify the corresponding DNA from the human genome. The PCR products were radiolabeled by a random priming method and used for hybridization. Following hybridization, the filters were washed at high stringency and autoradiographs were obtained. Individual clones corresponding to positive signals were isolated from frozen plates and grown, and PAC, BAC, or cosmid DNA was extracted by standard alkaline lysis methods. Clone end sequences. Clone ends were obtained by vectorette PCR (Riley, 1990) or by direct end sequencing. For end sequencing, 5 mg of PAC DNA was digested with EcoRI and RNase and extracted with phenol/chloroform. One to two micrograms of digested DNA was subjected to direct sequencing using ABI377 sequencing unit and dye terminator chemistry. We used 30 pmol of the following primers: SP6, CCGCCTGGCCGTCGACATTTAGGTGACACTATAGAAG and T7, TCGGTCGAGCTTGACATTGTA. Direct sequencing of cosmid DNA was performed using standard T3 and T7 primers. The sequences obtained were tested using the BLAST program available through NCBI to identify repetitive elements or any other homology. Unique sequences were selected and submitted to the Primer program (Version 0.5; Whitehead Institute, MIT Center for Genome Research) to design primer pairs. PCR. PCR amplification was conducted in a total volume of 20 ml containing 1.5–2 mM MgCl2 , 200 mM dNTPs, 50 mM KCl, 10 mM Tris–HCl, pH 8.3, 30 ng/ml BSA, 20 ng of each primer, 5–100 ng of template DNA, and 0.2 U of Taq polymerase (Perkin–Elmer). Amplification was performed in an Omnigene thermocycler (Hybaid) and involved an initial denaturation step of 2 min at 947C followed by 25–30 cycles of 947C for 15 s, 52–587C for 15 s, and 727C for 10 s and a final extension for 5 min at 727C. The annealing temperatures and MgCl2 concentrations varied for different primer sets. Information about all the primers generated in this work has been submitted and is available through GDB. Fingerprinting. One to two micrograms of PAC or BAC DNA was digested with NotI/EcoRI restriction enzymes while 0.5–1 mg of cosmid DNA was digested with SfiI/EcoRI. DNA was fractionated on a 0.8% agarose gel in 11 TAE for 24 h at 45 V. Buffer was changed after 12 h. The gel was stained with ethidium bromide, and the image was captured on computer. The image was analyzed by the software FragmentN package from Molecular Dynamics to determine the molecular weights of the different bands.

RESULTS

Strategy. We have chosen a part of chromosome 12, 12q24.1, for the construction of the high-resolution map. In the YAC contig map that we described, this region was an island that contained only two markers and was represented by nine YACs. The first step of the process was to increase the marker density and YAC coverage in this region. This was accomplished with the aid of the CEPH/Ge´ne´thon and Whitehead Institute genome databases and the use of the ICI YAC library and isolation of several end STSs. The succeeding steps in map construction are shown in Fig. 1. This process involved the use of labeled PCR products corresponding to unique STSs and screening a 61 PAC genomic library (Ioannou et al., 1994) and a 61 chromosome 12-specific cosmid library. Positive clones were

gnma

SEQUENCE-READY PHYSICAL MAP OF 12q24.1

FIG. 1. Strategy for developing a sequence-ready map.

pooled into individual pools of 22 clones. Each of the pools was tested with each of the markers utilized for screening by the PCR-based assay. Any markers that failed to recognize clones were set aside. Individual members of the pools were then tested for STS content. This procedure yielded several contigs. The contigs were extended and the gaps were filled by sequencing of ends from the clones that were at the outer edges of each contig, generating new STSs, rescreening the library, and repeating the process described above. After the contig was completed, STS-content-based minimal tiling path clones were subjected to fingerprinting to define the final minimal tiling path clones. To identify PAC and cosmid clones, we used a total of 41 probes for hybridization and identified 154 PAC clones and 174 cosmids. Of these, 63 PACs (41%) and 110 of the cosmids (63%) were positive for at least one marker by the STS-content analysis. The remaining clones were considered false positives and discarded. Several BAC clones from 12q24.1 described by Pulst et al. (1996) were incorporated into the map. At the end of each round of hybridization and STScontent analysis, the clones were assembled into contigs. To extend the contigs and to fill gaps between contigs, we developed a method to generate additional STSs. This method involved sequencing of ends of cosmids or PACs which, by STS content, were most likely to be located at the ends of individual contigs. PAC DNA was digested with EcoRI, which yields two vectorinsert junction fragments for each clone. The total EcoRI digestion products were used for sequencing with primers from the vector ends. Total DNA from individual cosmids was used for sequencing with T3 and T7 primers. The products were sequenced on ABI377 automated sequencing units. The sequences were then tested for the presence of repetitive sequences. Unique sequences were used to generate pairs of primers defining new STSs. The STSs were used to screen members of the adjacent contig. If all members of the adjacent contig were negative for the STS, it

AID

GENO 4888

/

6r44$$$$21

10-02-97 02:30:15

273

was used to rescreen the library. This procedure was repeated until a complete contig was obtained. Our direct sequencing reactions were successful in yielding 65% high-quality end sequences from which a total of 33 PAC ends and 48 cosmid ends yielded STSs. The contig that we constructed by this method is shown in Fig. 2. The contig that we constructed contains a total of 242 clones. The map contains 23 YACs, 99 PACs, 10 BACs, and 110 cosmids. The map contains a total of 146 markers of which 10 are polymorphic, 102 are nonpolymorphic, and 34 are genes/ESTs. The average clone depth per marker is 9.9. The map is flanked by the Ge´ne´thon genetic markers D12S1339 (AFM240we1) proximally and D12S1616 (AFMa219zg5) and D12S1340 (AFM291xe9) distally. In the latest version of the Ge´ne´thon map (Dib et al., 1996) all of these markers have the same genetic location of 120.5 cM. This observation suggests that genetic recombination in this region is relatively infrequent. Of the 10 genetic markers that are present in our map, 5 were derived by Ge´ne´thon, 4 by us, and 1 by the Utah group. All of these markers can be separated on the physical map and are integrated into a single map with a unique order. The monomorphic markers were principally derived from ends of human DNA clones and a large proportion were derived from this study. The genes and ESTs that are present on the map deserve special mention. Some of these STSs, derived from the ends of clones, showed homology to known genes or ESTs. Comparison of the end sequence of YAC 884h11 identified one new human gene homologous to a glutathione reductase. Another cluster of ESTs (SGC 34324) identified a MAP kinase-activated protein kinase 2 gene. Since several genes/ESTs on our map were developed by different groups, we were able to integrate the different maps. We examined several databases to examine the number of ESTs corresponding to each marker that was placed on our map. Almost all of the markers that were placed on the map are members of EST clusters (Table 1), and in several cases more than one member of the cluster has been mapped by us and others (Schuler et al., 1996). Minimal tiling path. Based upon STS content, it is possible to establish a minimal tiling of clones that span the region. Before the clones can be subjected to sequencing, it is important to establish that the clones do indeed represent the genomic DNA. To ascertain this feature, we chose a total of 57 clones that cover nearly 2 Mb of DNA for fingerprinting. These clones constitute a twofold coverage of the minimal tiling path clones. Their DNA was digested with NotI (PACs) or SfiI (cosmids), which cuts at the junction of the vector and insert, and EcoRI. The products were fractionated on agarose gels and the images analyzed for fragment sizes. Results of a part of this analysis are shown in

gnma

FIG. 2. Physical map of 12q24.1. The line extending accross the top represents the 12q24.1 region. The centromere is to the left and the telomere is to the right. The names of all the markers that have been placed on the physical map are written above the line. When the relative order of two or more markers could not be determined unambiguously a bracket above the line spans the markers. YACs are represented by a black line, PACs by a green line, cosmids by a blue line, and BACs by an orange line. The name of each clone corresponds 274

AID

GENO 4888

/

6r44$$4888

10-02-97 02:30:15

gnma

275

SEQUENCE-READY PHYSICAL MAP OF 12q24.1

TABLE 1 Summary of the ESTs and Genes Present in the High-Resolution Map Unigene marker

cDNA clones in Unigene clusters

No. of markers in transcript map

WI-14197 SGC-33766 D12S2220 ATP2A2 SGC-35037 D12S1143E D12S2236 PPP1CC FB11E11 WI-17428 SGC-32083 SGC-35065 SCA2 WI-14855 WI-14804 ALDH2 SGC-34324 SGC-31784 WI-12421 WI-15340 D12S2289 RPL6 PTPN11 WI-11137 OIAS I SHGC-1102

67 2 9 239 2 14 34 37 1 3 10 4 24 4 15 42 17 15 32 45 19 523 7 22 32 12

2 1 3 1 1 0 0 1 1 1 1 1 1 1 2 2 2 2 2 2 0 1 2 2 2 3

Note. Information was obtained from the Unigene web site (http:// www.ncbi.nlm.nih.gov/UniGene/index.html).

Fig. 3. In most cases, every band that was present in the minimal tiling path of clones was present in at least 2 clones, indicating that the clones accurately represent the genomic DNA. None of the clones that constitute the contig had any markers missing, suggesting that the integrity of the clones is high and that they have not suffered any internal rearrangement. Examination of the sizes of DNA fragments that constitute the fingerprints allowed us to establish the fragments that overlap between adjacent members of the minimal tiling path. Based on the STS content and fingerprint data, we established a minimal tiling path of clones for the region flanked by D12S2242 and D12S2296 markers. The minimal tiling path contains 21 clones. The combined length of these 21 clones is estimated to be 2360 kb (19 1 120 / 2 1 40). Of the 111 markers that were present on the map, 73 were nonoverlapping and 38 were overlapping, suggesting that the average degree of overlap among the clones is 25%. Therefore, the true

size of the contig can be estimated to be 2360 1 0.75 Å 1770 kb. Since this region contains 111 markers, the marker resolution would be 16 kb. Accuracy of the map. The accuracy of the map we constructed can be assessed in different ways. The average depth of clones/marker is a good indication of the accuracy. The fact that in our map the average depth is 9.9 provides a high level of confidence in its accuracy. A second method of assessing map accuracy is to compare our map to those available. We made comparisons of our maps with the WI YAC map, the WI RH map, and the Stanford RH map. The WI YAC map has 33 markers, and our map shares 30 of these markers. The WI RH map also contains 33 markers of which 18 were uniquely ordered. The Stanford RH map in this region contains 13 markers, and our map shares 7 of these markers. The results of comparison between our map and that generated by the Whitehead Institute are shown in Fig. 4. For this comparison, we only used those markers that are shared by both maps. In this region, the relative order of the markers was established by RH mapping, and each of them had a different odds ratio. There were four markers, the order of which was established with an odds ratio of 300:1. They are, in order, WI-6850, WI-7485, WI-1432, and WI-8457. Our map also provides the same order. The positions of 6 markers on the WI map differed from their positions on our map. Since the odds ratios for the order of these markers is usually less than 100:1, it is not surprising that their relative order was inaccurate on the RH map. Pulst et al. (1996) reported a physical map of a region surrounding the Ataxin 2 gene. Our map shares 5 markers with this map, and the relative orders of these markers in both maps are identical. DISCUSSION

We developed a strategy to construct high-resolution physical maps for human chromosomes. The product of this strategy is a well-ordered bacterial clone contig from which the direct substrates for sequencing can be generated. This approach uses all of the available mapping data for a part of the human chromosome. We utilized the maps generated by us and by the genome centers at the Whitehead Institute, Stanford University, Ge´ne´thon, and other places. The high-resolution map that was presented here integrates all of the markers from the different sources. The method that was used to generate the bacterial clone contig is different from the other methods that have been employed. In yeast and C. elegans, a global approach was used to fingerprint bacteriophage or cos-

to the plate address in each library. The STS content of each clone is indicated by symbols: black circle, highly polymorphic marker; blue square, monomorphic marker; red triangle, gene or EST. A square bracket indicates the clone lacks the marker(s) in the interval. A red border around any symbol indicates that the STS was derived from the end sequence of the clone. Genetic distances in centimorgans (Genethon map) are indicated below the line. A square red bracket on the top of markers indicates that the STSs belong to the same Unigene cluster. The clones chosen for the tiling path are boxed in black. The yellow bar indicates a gap in the contig.

AID

GENO 4888

/

6r44$$$$21

10-02-97 02:30:15

gnma

276

RENAULT ET AL.

mid clones and assemble contigs based upon overlaps. The size of the human genome prevents the use of a similar approach. An alternative strategy for generating bacterial clone contigs is to screen genomic libraries with markers from a region of the chromosome and directly fingerprint the positive clones. However, our experience showed that such a screen would yield a number of false positives and, unless eliminated, would cause serious problems in contig assembly. We believe that the false positives are obtained because the probes are capable of hybridizing to related sequences as well as to their cognate sequences. The false positives can be eliminated by STS-content analysis. Our method took advantage of the highly robust STS-content method not only to eliminate false positives, but to assemble the clones into a contig. The assembly of the contig in 12q24.1 was complicated by the fact that we did not have many markers to start the building of a bacterial clone contig. We

FIG. 3. Example of fingerprinting. Ethidium bromide-stained agarose gel with DNA from PACs and BACs digested with EcoRI and NotI. The names of the clones are indicated on the top of the gel. The length of the gel required two photographs. The * indicates corresponding positions in the gel.

AID

GENO 4888

/

6r44$$$$21

10-02-97 02:30:15

FIG. 4. Comparison between the Whitehead Institute radiation hybrid map (WI RH map) and the AECOM map. Only the common markers are shown. The markers are listed in order from pter to qter. Data were extracted from the Whitehead Institute web site (http://www-genome.wi.mit.edu). The markers in bold are STSs placed on the 300:1 framework map.

started in a region that proved to be more than 2 Mb in size but contained only 2 markers. This paucity of markers required development of additional STSs from island contigs and rescreening the library. The number of library screens that is required to construct a contig is a direct function of the number of markers available in a given interval and the average distance between markers. Screening of a multigenome equivalent library with an average insert size of 100 kb should yield a nearly 200-kb contig with each marker. Therefore, a single screening with 10 markers from a 1-Mb region should give a complete contig for that region. This expectation would be realized if all of the markers are uniformly distributed in the 1-Mb interval. Our approach of end sequencing of the clones representing the outer ends of bacterial clone contigs provides a method to fill the gaps. This method is quick and direct and enables generation of new STSs even if the ends contain short repetitive sequences. The resolution provided in our map, 16 kb, should prove useful in sequence assembly. The knowledge about sequences corresponding to our markers should allow rapid ordering and orientation of early stage sequence contigs, facilitating the finishing process. The contig described here is currently being sequenced. The 12q24.1 region is of interest because genes for several human diseases have been placed or genetically mapped to this region. The gene whose mutations lead to the spinocerebellar ataxia 2 has been mapped to this region (Pulst et al., 1996; Sanpei et al., 1996; Imbert et al., 1996) and is on our map. This map is also a part of the region in which the gene for Darier disease has been mapped. Carter et al. (1994) reported that the Darier disease locus maps to a 4-cM interval between D12S105 and D12S129. Wakem et al. (1996) narrowed this region to 2 cM flanked by D12S234 and D12S129.

gnma

SEQUENCE-READY PHYSICAL MAP OF 12q24.1

The physical map described here falls in this region and may therefore harbor the gene that is mutated in Darier disease. The 2-Mb region is expected to contain as many as 60 genes, and the map contains 26 genes/ ESTs or EST clusters. It is likely that the sequencing effort would uncover the rest of the genes. It is also of interest to note that all the genetic markers present in our map mapped to the same location. The fact that markers located more than 2 Mb away cannot be distinguished from each other on the genetic linkage map suggests that recombination in this interval is suppressed. The reasons for this suppression of recombination are not known. ACKNOWLEDGMENTS This work is supported by a grant to R.K. (NIH HG00965), the Human Genetics Program at AECOM, and a Cancer Center Grant (CA13330) to AECOM. A.H. held a Wellcome Trust and an EEC Research Fellowship, A.S. is supported by a Thai government studentship, and S.M. holds a Wellcome Trust Prize studentship. We thank Thomas Zucker-Scharff for his help with analysis of the fingerprint data and Vivian Gradus for preparing the manuscript.

REFERENCES Bell, C. J., Budarf, M. L., Nieuwenhuijsen, B. W., Barnoski, B. L., Buetow, K. H., Campbell, K., Colbert, A. M. E., Collins, J., Daly, M., Desjardins, P. R., DeZwaan, T., Eckman, B., Foote, S., Hart, K., Hiester, K., Van Het Hoog, M. J., Hopper, E., Kaufman, A., McDermid, H. E., Overton, G. C., Reeve, M. P., Searls, D. B., Stein, L., Valmiki, V. H., Watson, E., Williams, S., Winston, R., Nussbaum, R. L., Lander, E. S., Fischbeck, K. H., Emanuel, B. S., and Hudson, T. J. (1995). Integration of physical, breakpoint and genetic maps of chromosome 22: Localization of 587 yeast artificial chromosomes with 238 mapped markers. Hum. Mol. Genet. 4: 59–69. Bellanne-Chantelot, C., Lacroix, B., Ougen, P., Billault, A., Beaufils, S., Bertrand, S., Georges, I., Glibert, R., Gros, I., Lucotte, G., Susini, L., Codani, J.-J., Gesnouin, P., Pook, S., Vaysseix, G., Lu-Kuo, J., Reid, T., Ward, D., Chumakov, I., LePaslier, D., Barillot, E., and Cohen, D. (1992). Mapping the whole human genome by fingerprinting yeast artificial chromosomes. Cell 70: 1059–1068. Carrano, A. V., deJong, P. J., Branscomb, E., Slezak, T., and Watkins, B. W. (1989). Constructing chromosome- and region-specific cosmid maps of the human genome. Genome 31: 1059–1065. Carter, S. A., Bryce, S. D., Munro, C. S., Healy, E., Bashir, R., Weissenbach, J., LeBlanc-Straceski, J., Kucherlapati, R., Stephenson, A., Rees, J. L., and Strachan, T. (1994). Linkage analyses in British pedigrees suggest a single locus for Darier disease and narrow the location to the interval between D12S105 and D12S129. Genomics 24: 378–382. Chumakov, I., Rigault, P., Guillou, S., Ougen, P., Billaut, A., Guasconi, G., Gervy, P., LeGall, I., Soularue, P., Grinas, L., Bougueleret, L., Bellane-Chantelot, G., LaCroix, B., Barillot, E., Gesnouin, P., Pook, S., Vaysseix, G., Frelat, G., Schmitz, A., Sambucy, J.-L., Bosch, A., Estivill, X., Weissenbach, J., Vignal, A., Riethman, H., Cox, D., Patterson, D., Gardiner, K., Hattori, M., Sakaki, Y., Ichikawa, H., Ohki, M., LePaslier, D., Heilig, R., Antonarakis, S., and Cohen, D. (1992a). Continuum of ovlerapping clones spanning the entire human chromosome 21q. Nature 359: 380–387. Chumakov, I. M., LeGall, I., Billault, A., Ougen, P., Soularue, P., Guillou, S., Rigault, P., Bui, H., De Tand, M. F., Barillot, E., Abderrahim, H., Cherif, D., Berger, R., LePaslier, D., and Cohen, D. (1992b). Isolation of chromosome 21-specific yeast artificial chromosomes from a total human genome library. Nature Genet. 1: 222–225.

AID

GENO 4888

/

6r44$$$$21

10-02-97 02:30:15

277

Chumakov, I. M., Rigault, P., Le Gall, I., Bellanne´-Chantelot, C., Billault, A., Guillou, S., Soularue, P., Guasconi, G., Poullier, E., Gros, I., Belova, M., Sambucy, J.-L., Susini, L., Gervy, P., Gilbert, F., Beaufils, S., Bul, H., Massart, C., De Tand, M.-F., Dukasz, F., Lecoulant, S., Ougen, P., Perrot, V., Saumier, M., Soravito, C., Bahouaylla, R., Cohen-Akenine, A., Barillot, E., Bertrand, S., Codani, J.-J., Caterina, D., Georges, I., Lacroix, B., Lucotte, G., Sahbatou, M., Schmit, C., Sangouard, M., Tubacher, E., Dib, C., Faure´, S., Fizames, C., Gyapay, G., Millasseau, P., Nguyen, S., Muselet, D., Vignal, A., Morissette, J., Menninger, J., Lieman, J., Desai, T., Banks, A., Bray-Ward, P., Ward, D., Hudson, T., Gerety, S., Foote, S., Stein, L., Page, D. C., Lander, E. S., Weissenbach, J., LePaslier, D., and Cohen, D. (1995). A YAC contig map of the human genome. Nature 377: 175–297. Cohen, D., Chumakov, I., and Weissenbach, J. (1993). A first generation physical map of the human genome. Nature 366: 698–701. Collins, F., and Galas, D. (1993). A new five year plan for the U.S. Human Genome Project. Science 262: 43–46. Collins, J. E., Cole, C. G., Smink, L. J., Garrett, C. L., Leversha, M. A., Soderlund, C. A., Maslen, G. L., Everett, L. A., Rice, K. M., Coffey, A. J., Gregory, S., Gwilliam, R., Dunham, A., Davies, A. F., Hassock, S., Todd, C. M., Lehrach, H., Hulsebos, T. J.,M., Weissenbach, J., Morrow, B., Kucherlapati, R. S., Wadey, R., Scambler, P. J., Kim, U.-J., Simon, M. I., Carter, N. P., Durbin, R., Dumanski, J. P., Bentley, D. R., and Dunham, I. (1995). A high density YAC contig map of human chromosome 22. Nature 377: 367–371. Cox, D. R., Burmeister, M., Price, E. R., Kim, S., and Myers, R. M. (1990). Radiation hybrid mapping: A somatic cell genetic method for constructing high-resolution maps of mammalian chromosomes. Science 250: 245–250. Dib, C., Faure, S., Fizames, C., Samson, D., Drouot, N., Vignal, A., Millasseau, P., Marc, S., Hazan, J., Seboun, E., Lathrop, M., Gyapay, G., Morisette, J., and Weissenbach, J. (1996). A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380: A1–A128. Doggett, N. A., Goodwin, L. A., Tesmer, J. G., Meincke, L. J., Bruce, D. C., Clark, L. M., Altherr, M. R., Ford, A. A., Chi, H.-C., Marrone, B. L., Longmire, J. L., Lane, S. A., Whitmore, S. A., Lowenstein, M. G., Sutherland, R. D., Mundt, M. O., Knill, E. H., Bruno, W. J., Macken, C. A., Torney, D. C., Wu, J.-R., Griffith, J., Sutherland, G. R., Deaven, L. L., Callen, D. F., and Moyzis, R. K. (1995). An integrated physical map of human chromosome 16. Nature 377: 335–366. Dujon, B., Alexandraki, D., Andre´, B., Ansorge, W., Baladron, V., et al. (1994). Complete DNA sequence of yeast chromosome XI. Nature 369: 371–378. Foote, S., Vollrath, D., Hilton, A., and Page, D. C. (1992). The human Y chromosome: Overlapping DNA clones spanning the euchromatic region. Science 258: 60–66. Gemmill, R. M., Chumakov, I., Scott, P., Waggoner, B., Rigault, P., Cypser, J., Chen, Q., Weissenbach, J., Gardiner, K., Wang, H., Pekarsky, Y., Le Gall, I., Le Paslier, D., Guillou, S., Li, E., Robinson, L., Hahner, L., Todd, S., Cohen, D., and Drabkin, H. A. (1995). A second generation YAC contig map of human chromosome 3. Nature 377: 299–320. Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes, H. W., Murakami, Y., Philippsen, P., Tettelin, H., and Oliver, S. G. (1996). Life with 6000 genes. Science 274: 563–567. [Review] Green, E. D., and Olson, M. V. (1990). Chromosomal region of the cystic fibrosis gene in yeast artificial chromosomes: A model for human genome mapping. Science 250: 94–98. Gyapay, G., Morrissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernardi, G., Lathrop, M., and Weissenbach, J. (1994). The 1993–94 Genethon human genetic linkage map. Nature Genet. 7: 246–339. Hodgkin, J., Plasterk, R. H. A., and Waterston, R. H. (1995). The

gnma

278

RENAULT ET AL.

nematode Caenorhabditis elegans and its genome. Science 270: 410–414. Hudson, T. J., Stein, L. D., Gerety, S. S., Ma, J., Castle, A. B., Silva, J., Slonim, D. K., Baptista, R., Kruglyak, L., Xu, S.-H., Hu, X., Colbert, A. M. E., Rosenberg, C., Reeve-Daly, M. P., Rozen, S., Hui, L., Wu, X., Vestergaard, C., Wilson, K. M., Bae, J. S., Maitra, S., Ganiatsas, S., Evans, C. A., DeAngelis, M. M., Ingalls, K. A., Nahf, R. W., Horton, L. T., Jr., Anderson, M. O., Collymore, A. J., Ye, W., Kouyoumjian, V., Zemsteva, I. S., Tam, J., Devine, R., Courtney, D. F., Renaud, M. T., Nguyen, H., O’Connor, T. J., Fizames, C., Faure´, S., Gyapay, G., Dib, C., Morissette, J., Orlin, J. B., Birren, B. W., Goodman, N., Weissenbach, J., Hawkins, T. L., Foote, S., Page, D. C., and Lander, E. S. (1995). An STS-based map of the human genome. Science 270: 1945–1954. Imbert, G., Saudou, F., Yvert, G., Devys, D., Trottier, Y., Garnier, J.-M., Weber, C., Mandel, J.-L., Cancel, G., Abbas, N., Durr, A., Didierjean, O., Stevanin, G., Agid, Y., and Brice, A. (1996). Cloning of the gene for spinocerebellar ataxia 2 reveals a locus with high sensitivity to expanded CAG/glutamine repeats. Nature Genet. 14: 285–291. Ioannou, P. A., Amemiya, C. T., Garnes, J., Kroisel, P. M., Shizuya, H., Chen, C., Batzer, M. A., and deJong, P. J. (1994). A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nature Genet. 6: 84–89. Johnston, M., Andrews, S., Brinkman, R., Cooper, J., Ding, H., Dover, J., Du, Z., Favello, A., Fulton, L., Gattung, S., Geisel, C., Kirsten, J., Kucaba, T., Hillier, L., Jier, M., Johnston, L., Yangston, Y., Latreille, P., Louis, E. J., Macri, C., Mardis, E., Menezes, S.,Mouser, L., Nhan, M., Rifkin, L., Riles, L., St. Peter, H., Trev-

N., Lopes-Cendes, I., Pearlman, S., Starkman, S., Orozco-Diaz, G., Lunkes, A., deJong, P., Rouleau, G. A., Auburger, G., Korenberg, J. R., Figueroa, C., and Sahba, S. (1996). Moderate expansion of a normally biallelic trinucleotide repeat in spinocerebellar ataxia type 2. Nature Genet. 14: 269–276. Riles, L., Dutchik, J. E., Baktha, A., McCauley, B. K., Thayer, E. C., Leckie, M. P., Braden, V. V., Depke, J. E., and Olson, M. V. (1993). Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae at a resolution of 2.6 kilobase pairs. Genetics 134: 81– 150. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887–2890. Sanpei, K., Takano, H., Igarashi, S., Sato, T., Oyake, M., Sasaki, H., Wakisaka, A., Tashiro, K., Ishida, Y., Ikeuchi, T., Koide, R., Saito, M., Sato, A., Tanaka, T., Hanyu, S., Takiyama, Y., Nishizawa, M., Shimizu, N., Nomura, Y., Segawa, M., Iwabuchi, K., Eguchi, I., Tanaka, H., Takahashi, H., and Tsuji, S. (1996). Identification of the spinocerebellar ataxia type 2 gene using a direct identification of repeat expansion and cloning technique, DIRECT. Nature Genet. 14: 277–284. Schuler, G. D., Boguski, M. S., Hudson, T. J., Hui, L., Ma, J., Castle, A. B., Wu, X., Silva, J., Nusbaum, H. C., Birren, B. B., Slonim, D. K., Rozen, S., Stein, L. D., Page, D., Lander, E. S., Stewart, E. A., Aggarwal, A., Bajorek, E., Brady, S., Chu, S., Fang, N., Hadley, D., Harris, M., Hussain, S., Hudson, J. R., Jr., et al. (1996). Genome maps 7: The human transcript map. Science 274: 547– 562.